Search Results

Search found 88840 results on 3554 pages for 'code complexity'.

Page 1082/3554 | < Previous Page | 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089  | Next Page >

  • Debugging a basic OpenGL texture fail? (iphone)

    - by Ben
    Hey all, I have a very basic texture map problem in GL on iPhone, and I'm wondering what strategies there are for debugging this kind of thing. (Frankly, just staring at state machine calls and wondering if any of them is wrong or misordered is no way to live-- are there tools for this?) I have a 512x512 PNG file that I'm loading up from disk (not specially packed), creating a CGBitmapContext, then calling CGContextDrawImage to get bytes out of it. (This code is essentially stolen from an Apple sample.) I'm trying to map the texture to a "quad", with code that looks essentially like this-- all flat 2D stuff, nothing fancy: glEnable(GL_TEXTURE_2D); glTexEnvf(GL_TEXTURE_ENV, GL_TEXTURE_ENV_MODE, GL_MODULATE); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_S, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_T, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR); glEnableClientState(GL_TEXTURE_COORD_ARRAY); GLfloat vertices[8] = { viewRect.origin.x, viewRect.size.height, viewRect.origin.x, viewRect.origin.y, viewRect.size.width, viewRect.origin.y, viewRect.size.width, viewRect.size.height }; GLfloat texCoords[8] = { 0, 1.0, 0, 0, 1.0, 0, 1.0, 1.0 }; glBindTexture(GL_TEXTURE_2D, myTextureRef); // This was previously bound to glVertexPointer(2, GL_FLOAT , 0, vertices); glTexCoordPointer(2, GL_FLOAT, 0, texCoords); glDrawArrays(GL_TRIANGLE_FAN, 0, 4); glDisableClientState(GL_TEXTURE_COORD_ARRAY); glDisable(GL_TEXTURE_2D); My supposedly textured area comes out just black. I see no debug output from the CG calls to set up the texture. glGetError reports nothing. If I simplify this code block to just draw the verts, but set up a pure color, the quad area lights up exactly as expected. If I clear the whole context immediately beforehand to red, I don't see the red-- which means something is being rendered there, but not the contents of my PNG. What could I be doing wrong? And more importantly, what are the right tools and techniques for debugging this sort of thing, because running into this kind of problem and not being able to "step through it" in a debugger in any meaningful way is a bummer. Thanks!

    Read the article

  • Run PHP class from JavaScript

    - by jarus
    I need to fire a php class from a javascript function. code: <input type="button" name="Submit" value="Submit" class="opinionbox" onclick="verifyControl('<?=$control_no?>')"/> function verifyControl(rNo) { Cont_no=document.getElementById("ContNo").value; if(rNo==Cont_no) { frames['frame1'].print(); showPage('payment'); } else if(rNo!=Cont_no) { alert("invalid control no"); } } i need to run the code $data = $obj_com -> getSelectedData('tbl', 'control_no', $contno); $control_no = $contno; $obj_com -> recordPay('tbl',$contno); inside the verifyControl() how can I do this?

    Read the article

  • Determine when using the VC90 compiler in VS2010 instead of VS2008?

    - by Dan
    Is there a (Microsoft-specific) CPP macro to determine when I'm using the VC9 compiler in Visual Studio 2010 as opposed to Visual Studio 2008? _MSC_VER returns the compiler version, so with VS2010 multi-targeting feature, I'll get the same result as with VS2008. The reason for wanting to know the difference is that I created a new VS2010 project which contains code removed from a larger project. I just left the VS2008 stuff "as is" since we're moving away from VS2008 "soon" anyway and I didn't want to go through the hassle of creating a vcproj file along with the new vcxproj. For now, I've just defined my own macro to indicate whether the code is compiled into its own DLL or not; it works just fine, but it would be nice if there were something slightly more elegant.

    Read the article

  • Using java class HttpsURLConnection

    - by KB22
    Hi all, I have a small piece of code which basically impements a HTTP-Client, i.e. it POSTS request and works with re RESPONSE. As long as HTTP is concenerned everthing work well. For some reason I now have to support HTTPS too. So here is briefly what I do in order to get a connection opened: URL url = new URL(serverAddress); HttpsURLConnection httpsConn = (HttpsURLConnection) url.openConnection(); This fails, stating: sun.net.www.protocol.https.HttpsURLConnectionImpl cannot be cast to com.sun.net.ssl.HttpsURLConnection I guess this is kinda trivial, but I just don't get what I'm doing wrong in this one... Googled it, and the code just looks right - not? any ideas are appreciated! thanks, K

    Read the article

  • Is there any performance overhead in using RaiseEvent in .net

    - by Sachin
    Is there any performance overhead in using RaiseEvent in .net I have a code which is similar to following. Dim _startTick As Integer = Environment.TickCount 'Do some Task' Dim duration As Integer = Environment.TickCount - _startTick Logger.Debug("Time taken : {0}", duration) RaiseEvent Datareceived() Above code returns Time Taken :1200 Time Taken :1400 But if remove RaiseEvent it returns Time Taken :110 Time Taken :121 I am surprised that the raiseevent is called after the logging of time taken. How it effects total time taken. I am working on Compact framework. Update: In the Eventhandler I had given a MsgBox. When I removed the message box it is now showing time taken as 110,121,etc i.e. less that 500 milliseconds. If I put the Msgbox back in eventhandler it shows 1200,1400,etc i.e. more that a second. More surprised now.(Event is raised after the logging part)

    Read the article

  • How can I export images from SQL Server to a file on disk?

    - by rball
    I have a User table that has all of their avatars saved in an image field. I'd like to just take that out of the database and store it as a regular file on disk. I looked around and saw some code for textcopy, but that doesn't seem to be on my machine for some reason. Here is the code I wrote up anyway. Anyone know a way to get this done? DECLARE @exec_str varchar (255) SELECT @exec_str = 'textcopy /S (local)\SQLEXPRESS' + --' /U ' + @login + --' /P ' + @password + ' /D thedatabase' + ' /T User'+ ' /C AvatarImage' + ' /F "d:\Avatars\' + User.Name + '.jpg"' + ' /O' FROM [User] WHERE UserID = 2 EXEC master..xp_cmdshell @exec_str

    Read the article

  • Content Being Echoed Below Footer in Category Post Template

    - by poindexter
    I have created a category template in Wordpress for all posts that are in the 'blog' category. The file name is single-blog.php. There is some conditional code in single.php that checks whether the post is in the 'blog' category and if it is it redirects it to single-blog.php. That seems to be working fine. The problem is that on all the individual 'blog' categorized posts the post title and content are echoed below the footer of the page. I do not know why they are showing up and I haven't been able to stop it or hide it. The Loop is getting closed on the template page, but I'm wondering if the Loop from single.php is somehow also being sent over. You can view an example of the problem here: http://69.20.59.228/2010/03/test-blog-post/ Please let me know if you have any suggestions. I am posting two sections of code below. The first is the conditional call in single.php. The second is the code from the single-blog.php (the category post template). the conditional call in single.php. <?php $post = $wp_query->post; if (in_category('blog')) { include(TEMPLATEPATH.'/single-blog.php'); }?> code from the single-blog.php (the category post template) <?php get_header(); ?> <?php get_sidebar(); ?> <p><h2>The IQNavigator Blog</h2></p> <em><a href="/category/blog">Blog Home</a></em> | <em><a href="/category/blog/feed/">Subscribe via RSS</a></em><p><br></br></p> <?php if (have_posts()) : while (have_posts()) : the_post(); ?> <div <?php post_class() ?> id="post-<?php the_ID(); ?>"> <h1 class="pagetitle"><?php the_title(); ?></h1> <!-- <p class="details">Posted <?php the_time('l, F jS, Y') ?> at <?php the_time() ?></p> --> <div class="entry"> <?php the_content('<p class="serif">Read the rest of this entry &raquo;</p>'); ?> <?php wp_link_pages(array('before' => '<p><strong>Pages:</strong> ', 'after' => '</p>', 'next_or_number' => 'number')); ?> <?php the_tags( '<p>Tags: ', ', ', '</p>'); ?> <p class="postmetadata alt"> <small> -----<br> Posted <?php /* This is commented, because it requires a little adjusting sometimes. You'll need to download this plugin, and follow the instructions: http://binarybonsai.com/wordpress/time-since/ */ /* $entry_datetime = abs(strtotime($post->post_date) - (60*120)); echo time_since($entry_datetime); echo ' ago'; */ ?> on <?php the_time('l, F jS, Y') ?>, filed under <?php the_category(', ') ?>. Follow any responses to this entry through the <?php post_comments_feed_link('RSS'); ?> feed. <?php if ( comments_open() && pings_open() ) { // Both Comments and Pings are open ?> <a href="#respond">Leave your own comment</a>, or <a href="<?php trackback_url(); ?>" rel="trackback">trackback</a> from your own site. <?php } elseif ( !comments_open() && pings_open() ) { // Only Pings are Open ?> Responses are currently closed, but you can <a href="<?php trackback_url(); ?> " rel="trackback">trackback</a> from your own site. <?php } elseif ( comments_open() && !pings_open() ) { // Comments are open, Pings are not ?> You can skip to the end and leave a response. Pinging is currently not allowed. <?php } elseif ( !comments_open() && !pings_open() ) { // Neither Comments, nor Pings are open ?> Both comments and pings are currently closed. <?php } edit_post_link('Edit this entry','','.'); ?> </small> </p> <?php the_tags( '<p>Tagged: ', ', ', '</p>'); ?> </div> </div> <?php comments_template(); ?> <?php endwhile; else: ?> <p>Sorry, no posts matched your criteria.</p> <?php endif; ?> <?php get_footer(); ?>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Practical Python-based visual programming environment?

    - by Who8MyLunch
    I am looking for a practical visual programming environment based on Python. My primary application is algorithm development for processing remote-sensing imagery. I was initially inspired by LabVIEW from National Instruments, but that is more geared towards laboratory measurements and simulations. I write a lot of prototype code in Python and do a lot of interactive analysis with IPython. Does there exist a visual framework where a "program" is represented by connected nodes which each read data, do some work, and output data to the next node? I would like to use Python to write the code residing in each node. So far the best I've seen is Orange http://www.ailab.si/orange/, but it does not have the ability to start/stop individual nodes.

    Read the article

  • Display `pretty output` of directory content from array

    - by user275074
    Hi, I'm using the following code to get an array of directories and their sub-directories where each contain file type extension: png. It works great but I need to be able to output the results of the array in a list style format e.g. Test - test2.png - test1.png subfolder - test3.png sub sub folder - test4.png etc Code: $filter=".png"; $directory='../test'; $it=new RecursiveDirectoryIterator("$directory"); foreach(new RecursiveIteratorIterator($it) as $file){ if(!((strpos(strtolower($file),$filter))===false)||empty($filter)){ $items[]=preg_replace("#\\\#", "/", $file); } } Example array of results: array ( 0 => '../test/test2.png', 1 => '../test/subfolder/subsubfolder/test3.png', 2 => '../test/subfolder/test3.png', 3 => '../test/test1.png', ) What would be the best way of achieving the desired result?

    Read the article

  • Type patterns in Haskell

    - by finnsson
    I'm trying to compile a simple example of generic classes / type patterns (see http://www.haskell.org/ghc/docs/latest/html/users_guide/generic-classes.html) in Haskell but it won't compile. Any ideas about what's wrong with the code would be helpful. According to the documentation there should be a module Generics with the data types Unit, :*:, and :+: but ghc (6.12.1) complaints about Not in scope: data constructor 'Unit' etc. It seems like there's a package instant-generics with the data types :*:, :+: and U but when I import that module (instead of Generics) I get the error Illegal type pattern in the generic bindings {myPrint _ = ""} The complete source code is import Generics.Instant class MyPrint a where myPrint :: a -> String myPrint {| U |} _ = "" myPrint {| a :*: b |} (x :*: y) = "" (show x) ++ ":*:" ++ (show y) myPrint {| a :+: b |} _ = "" data Foo = Foo String instance MyPrint a => MyPrint a main = myPrint $ Foo "hi" and I compile it using ghc --make Foo.hs -fglasgow-exts -XGenerics -XUndecidableInstances P.S. The module Generics export no data types, only the functions: canDoGenerics mkGenericRhs mkTyConGenericBinds validGenericInstanceType validGenericMethodType

    Read the article

  • How to automatically run in the background?

    - by Hun1Ahpu
    I'm not sure that it's not implemented yet, I hope that it is. But I know that in .Net programmers should manually run time-consuming task in the background thread. So every time we handle some UI event and we understand that this will take some time we also understand that this will hang UI thread and our application. And then we make all this Background work things and handle callbacks or whatever. So my question is: Is there in some language/platform a mechanism that will automatically run time-consuming tasks in the background and will do all related work itself? So we just write the code for handling specific UI event and this code will be somehow detected as time-consuming and will be executed in background. And if there isn't, then why?

    Read the article

  • python logparse search specific text

    - by krisdigitx
    hi, I am using this function in my code to return the strings i want from reading the log file, I want to grep the "exim" process and return the results, but running the code gives no error, but the output is limited to three lines, how can i just get the output only related to exim process.. #output: {'date': '13', 'process': 'syslogd', 'time': '06:27:33', 'month': 'May'} {'date': '13', 'process': 'exim[23168]:', 'time': '06:27:33', 'month': 'May'} {'May': ['syslogd']} #function: def generate_log_report(logfile): report_dict = {} for line in logfile: line_dict = dictify_logline(line) print line_dict try: month = line_dict['month'] date = line_dict['date'] time = line_dict['time'] #process = line_dict['process'] if "exim" in line_dict['process']: process = line_dict['process'] break else: process = line_dict['process'] except ValueError: continue report_dict.setdefault(month, []).append(process) return report_dict

    Read the article

  • What are your favorite extension methods for C#? (codeplex.com/extensionoverflow)

    - by bovium
    Let's make a list of answers where you post your excellent and favorite extension methods. The requirement is that the full code must be posted and a example and an explanation on how to use it. Based on the high interest in this topic I have setup an Open Source Project called extensionoverflow on Codeplex. Please mark your answers with an acceptance to put the code in the Codeplex project. Please post the full sourcecode and not a link. Codeplex News: 11.11.2008 XmlSerialize / XmlDeserialize is now Implemented and Unit Tested. 11.11.2008 There is still room for more developers. ;-) Join NOW! 11.11.2008 Third contributer joined ExtensionOverflow, welcome to BKristensen 11.11.2008 FormatWith is now Implemented and Unit Tested. 09.11.2008 Second contributer joined ExtensionOverflow. welcome to chakrit. 09.11.2008 We need more developers. ;-) 09.11.2008 ThrowIfArgumentIsNull in now Implemented and Unit Tested on Codeplex.

    Read the article

  • how to design this relation in a DB schema

    - by raticulin
    I have a table Car in my db, one of the columns is purchaseDate. I want to be able to tag every car with a number of Policies (limited to 10 policies). Each policy has a time to life (ttl, a duration of time, like '5 years', '10 months' etc), that is, for how long since the car's purchaseDate the policy can be applied. I need to perform the following actions: when inserting a Car, it will be set with a number of Policies (at least one is set) sometimes a Car will be updated to add/remove a Policy searches must be done taking into account date/policies, for example: 'select all cars that are not covered by any policy as of today' My current design is (pol0..pol9 are the policies): CREATE TABLE Car ( id int NOT NULL IDENTITY(1,1), purchaseDate datetime NOT NULL, //more stuff... pol0 smallint default NULL, pol1 smallint default NULL, pol2 smallint default NULL, pol3 smallint default NULL, pol4 smallint default NULL, pol5 smallint default NULL, pol6 smallint default NULL, pol7 smallint default NULL, pol8 smallint default NULL, pol9 smallint default NULL, PRIMARY KEY (id) ) CREATE TABLE Policy ( id smallint NOT NULL, name varchar(50) collate Latin1_General_BIN NOT NULL, ttl varchar(100) collate Latin1_General_BIN NOT NULL, PRIMARY KEY (id) ) The problem I am facing is that the sql to perform the query above is a nightmare to write. As I don't know in which column each policy can be, so I have to check all columns for every policy etc etc. So I am wondering wether it is worth changing this. My questions are: The smallint as Policy id was chosen instead of an 'int IDENTITY' in order to save some space as there are going to be millions of Car records. It just adds complexity when creating a Policy as we must handle the id etc. Was it worth doing this? I am thinking that maybe there is a much better design? Obviously we could move the policy/car relation to its own table CarPolicy, benefits would be: no limit on 10 policies per car adding/removing etc much easier when only the default policy is applied (when no others are applied one called Default policy is applied), we could signal that by not having any entry in CarPolicy, now this is just done inserting the Default policy id in one of the columns. The cons are that we would need to change the DB, ORM classes etc. What would you recommend? Maybe there is another smart way to implement this that we are not aware without using the CarPolicy table?

    Read the article

  • two HashMap iteration

    - by user431276
    I have two HashMaps and I can iterate both hashmaps with following code Iterator it = mp.entrySet().iterator(); while (it.hasNext()) { Map.Entry pairs = (Map.Entry)it.next(); String firstVal = pairs.getValue(); } Iterator it2 = mp2.entrySet().iterator(); while (it2.hasNext()) { Map.Entry pairs2 = (Map.Entry)it.next(); String SecondVal = pairs2.getValue(); } myFunction(firstVal, SecondVal) Is there anyway to iterate two hashmaps at the same time without using two loops? Currently, I have a method that accepts two parameters and each parameter value is stored in first and second hashmap. I have to iterate first hash then second to get values. I think there must be a good way to do it but I don't know :( P.S: there could be some errors in above code as this is just an example to explain my problem. Each iterator is a method in original program and accept one parameter. I couldn't copy past real time functions as they are HUGE !

    Read the article

  • mocking command object in grails controller results in hasErrors() return false no matter what! Plea

    - by egervari
    I have a controller that uses a command object in a controller action. When mocking this command object in a grails' controller unit test, the hasErrors() method always returns false, even when I am purposefully violating its constraints. def save = { RegistrationForm form -> if(form.hasErrors()) { // code block never gets executed } else { // code block always gets executed } } In the test itself, I do this: mockCommandObject(RegistrationForm) def form = new RegistrationForm(emailAddress: "ken.bad@gmail", password: "secret", confirmPassword: "wrong") controller.save(form) I am purposefully giving it a bad email address, and I am making sure the password and the confirmPassword properties are different. In this case, hasErrors() should return true... but it doesn't. I don't know how my testing can be any where reliable if such a basic thing does not work :/ Here is the RegistrationForm class, so you can see the constraints I am using: class RegistrationForm { def springSecurityService String emailAddress String password String confirmPassword String getEncryptedPassword() { springSecurityService.encodePassword(password) } static constraints = { emailAddress(blank: false, email: true) password(blank: false, minSize:4, maxSize: 10) confirmPassword(blank: false, validator: { confirmPassword, form -> confirmPassword == form.password }) } }

    Read the article

  • How to test the XML sent to a web service in Ruby/Rails

    - by Jason Langenauer
    I'm looking for the best way to write unit test for code that POSTs to an external web service. The body of the POST request is an XML document which describes the actions and data for the web service to perform. Now, I've wrapped the webservice in its own class (similar to ActiveResource), and I can't see any way to test the exact XML being generated by the class without breaking encapsulation by exposing some of the internal XML generation as public methods on the class. This seems to be a code smell - from the point-of-view of the users of the class, they should not know, nor care, how the class actually implements the web service call, be it with XML, JSON or carrier pigeons. For an example of the class: class Resource def new #initialize the class end def save! Http.post("http://webservice.com", self.to_xml) end private def to_xml # returns an XML representation of self end end I want to be able to test the XML generated to ensure it conforms to what the specs for the web service are expecting. So can I best do this, without making to_xml a public method?

    Read the article

  • EXC_BAD_ACCESS on iPhone (with debugger screenshot)

    - by VansFannel
    Hello. I'm developing an iPhone application that show the camera's view with this code: -(void) displayAR { [rootViewController presentModalViewController:[self cameraController] animated:NO]; [displayView setFrame:[[[self cameraController] view] bounds]]; } And hide the camera's view with this code: - (void) hideAR { [[self locationManager] stopUpdatingHeading]; [[self locationManager] stopUpdatingLocation]; [[self accelerometerManager] release]; [rootViewController dismissModalViewControllerAnimated:YES]; } When I call hideAR, I get an EXC_BAD_ACCESS with the following debugger screenshot: Any advice?

    Read the article

  • textfield value empty when i fill it with javascript

    - by Turi
    i am using modalpopup to enter some value in a textfield. after the value is selected in the modalpopup view, the modalpopup is closed and the value has taken the propriate value. Even if the value is displyed in the textfield, the textfield1.text returns me string empty. when i see the source code (html), i see that even that the textfield is displaying something it hasn't really this value in it, because the appropriate html input field hasn't value yet. thats the code i use to fill this textfield. function CloseRequestModal(s) { document.getElementById('<%=txtRequest.ClientID%>').value = s; var mpu = $find('<%=ModalPopupExtender3.ClientID%>'); mpu.hide(); } Please Help, Thanks in advance.

    Read the article

  • Do you put a super() call a the beginning of your constructors?

    - by sleske
    This is a question about coding style and recommended practices: As explained in the answers to the question unnecessary to put super() in constructor?, if you write a constructor for a class that is supposed to use the default (no-arg) constructor from the superclass, you may call super() at the beginning of your constructor: public MyClass(int parm){ super(); // leaving this out makes no difference // do stuff... } but you can also omit the call; the compiler will in both cases act as if the super() call were there. So then, do you put the call into your constructors or not? On the one hand, one might argue that including the super() makes things more explicit. OTOH, I always dislike writing redundant code, so personally I tend to leave it out; I do however regularly see it in code from others. What are your experiences? Did you have problems with one or the other approach? Do you have coding guidelines which prescribe one approach?

    Read the article

  • Adding business logic to a domain class using a getter style method name

    - by Richard Paul
    I'm attempting to add a method to a grails domain class, e.g. class Item { String name String getReversedName() { name.reverse() } } When I attempt to load the application using grails console I get the following error: Caused by: org.springframework.beans.factory.BeanCreationException: Error creating bean with name 'sessionFactory':Invocation of init method failed; nested exception is org.hibernate.PropertyNotFoundException: Could not find a setter for property reversedName in class Item ... 18 more It looks like Hibernate is interpreting getReversedName() as a getter for a property, however in this case it is a derived field and hence should not be persisted. Obviously in my actual code the business logic I'm exposing is more complex but it isn't relevant to this question. I want to be able to call item.reversedName in my code/gsps. How can I provide property (getter) access to a method in a Grails domain class without Grails attempting to map it with Hibernate?

    Read the article

  • Add up values from a text file

    - by Stanley
    Hi Guys I have a text file that contains Amounts at Substring (34, 47) of each line. I need to sum Up all the Values to the End of the File. I have this code that I had started to build but I do not know how to proceed from here: public class Addup { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException, IOException { // TODO code application logic here FileInputStream fs = new FileInputStream("C:/Analysis/RL004.TXT"); BufferedReader br = new BufferedReader(new InputStreamReader(fs)); String line; while((line = br.readLine()) != null){ String num = line.substring(34, 47); double i = Double.parseDouble(num); System.out.println(i); } } } The output is like this: 1.44576457E4 2.33434354E6 4.56875685E3 The Amount is in two decimal Places and I need the result also in the Two decimal Places. What Is the Best way to achieve this?

    Read the article

  • Cookie is not getting deleted in IE 8.

    - by Ajit
    Hello guys, I'm trying to delete a cookie but somehow it is not getting deleted in IE 8 This is the code i'm using HttpCookie userCookie = Request.Cookies[cookieName]; if (userCookie != null) { userCookie.Expires = DateTime.Now.AddDays(-1); if (!string.IsNullOrEmpty(cookieDomain)) userCookie.Domain = cookieDomain; Response.Cookies.Add(userCookie); } It is working fine in firfox and chrome . Suppose the name of the cookie is testcookie. We created this cookie from xyz.com and we set the domain of the cookie as ".xyz.com". Now we are deleting or expiring this cookie from subdomain.xyz.com. We are deleting the cookie with the code we have mentioned above.

    Read the article

< Previous Page | 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089  | Next Page >