Search Results

Search found 88840 results on 3554 pages for 'code complexity'.

Page 1083/3554 | < Previous Page | 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090  | Next Page >

  • how to remove empty tags in input xml

    - by SGB
    My java module gets a huge input xml from a mainframe. Unfortunately, the mainframe is unable to skip optional elements when it is not a leaf node, with the result that I get a LOT of empty tags in my input : So, <pre><code><SSN>111111111</SSN> <Employment> <Current> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Current> <Previous> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Previous> </Employment> <MaritalStatus>Single</MaritalStatus> </code></pre> should be <SSN>111111111</SSN> <MaritalStatus>Single</MaritalStatus> I use jaxb to unmarshall the input xml string that the mainframe sends it. Is there a clean/ easy way to remove all the empty group tags, or do I have to do this manuall in the code for each element. I have over 35 elements in my input xml, so I would love to it if jaxb itself had a way of doing this automatically? Thanks, SGB

    Read the article

  • Ajax method call

    - by LooDaFunk
    Hi, I am trying to call a simple method in my code behind using Jquery with Ajax. But I get a 404 not found exception everytime. Unfortunately this is a web forms solution. So I dont have all the perks of MVC :( It does get into the javascript method and gives the alert but won't go into my c# method. My previous experience of using this Jquery method is in an MVC website. Is it compatible with webforms sites? Here is the code: http://pastebin.com/Xdey4XTS Thanks Merry Christmas!

    Read the article

  • Determine when using the VC90 compiler in VS2010 instead of VS2008?

    - by Dan
    Is there a (Microsoft-specific) CPP macro to determine when I'm using the VC9 compiler in Visual Studio 2010 as opposed to Visual Studio 2008? _MSC_VER returns the compiler version, so with VS2010 multi-targeting feature, I'll get the same result as with VS2008. The reason for wanting to know the difference is that I created a new VS2010 project which contains code removed from a larger project. I just left the VS2008 stuff "as is" since we're moving away from VS2008 "soon" anyway and I didn't want to go through the hassle of creating a vcproj file along with the new vcxproj. For now, I've just defined my own macro to indicate whether the code is compiled into its own DLL or not; it works just fine, but it would be nice if there were something slightly more elegant.

    Read the article

  • Using type hints in Clojure for Java return values

    - by mikera
    I'm working on some Java / Clojure interoperability and came across a reflection warning for the following code: (defn load-image [resource-name] (javax.imageio.ImageIO/read (.getResource (class javax.imageio.ImageIO) resource-name))) => Reflection warning, clojure/repl.clj:37 - reference to field read can't be resolved. I'm surprised at this because getResource always returns a URL and I would therefore expect the compiler to use the appropriate static method in javax.imageio.ImageIO/read. The code works fine BTW so it is clearly finding the right method at run time. So two questions: Why is this returning a reflection warning? What type hint do I need to fix this?

    Read the article

  • Why isn't the "this." command needed in this constructor? (java)

    - by David
    I'm reading a book about java. It just got to explaining how you create a class called "deck" which contains an array of cards as its instance variable(s). Here is the code snippit: class Deck { Card[] cards; public Deck (int n) { cards = new Card[n]; } } why isn't the this. command used? for example why isn't the code this: class Deck { Card[[] cards; public Deck (int n) { this.cards = new Card[n]; } }

    Read the article

  • What to beware of reading old Numarray tutorials and examples?

    - by DarenW
    Python currently uses Numpy for heavy duty math and image processing. The earlier Numeric and Numarray are obsolete, but still today there are many tutorials, notes, sample code and other documentation using them. Some of these cover special topics of interest, some are well written but haven't been updated or replaced, or are otherwise of use. Quite a bit is the same between Numeric, Numarray and Numpy, so I usually get good mileage out these older docs. Ocassionaly, though, I run into a line of code that results in error. Not often enough to remember how to get around it, but usually I figure it out at the cost of some time. What are the main things to watch out for when relying on such older documentation for current Numpy use? Is there a list of how to translate the differences that exist?

    Read the article

  • Method of getting text on a windows form ( unmanaged C++ project )

    - by Donovan
    I'm in the process of learning C++. I've created a boilerplate Win32 app within VC++ 2008. I've studied through the code and am ready do do a bit of experimenting. I thought it would be cool to print all the windows messages received in the message loop to the form created via the boilerplate code. I for the life of me, can't figure out the method of getting text onto that form. I can't seem to identify and named object that I can use to reference that damn form. The best I can figure is I need to use the handle to reference the form somehow. Still, even if I did know how to reference the form, I'm not sure I know how I would create a label to display the text. Anyway, if someone could just point out what methodology I need to learn to make this happen it would be much appreciated. Thanks, Donovan

    Read the article

  • Need to pick contact from a dialog preference

    - by MLW
    I would like to add a preference setting that uses an ACTION_PICK intent. My goal is to acquire the phone number of a contact in my phone by using a preference. Is this possible? I can run this code from my activity but I discovered I cannot run it from a class that extends DialogPreference. Intent intentContact = new Intent(Intent.ACTION_PICK, ContactsContract.Contacts.CONTENT_URI); startActivityForResult(intentContact, PICK_CONTACT); Or is there a way to start a new activity from a preference? Then that activity could execute the above two lines of code?

    Read the article

  • Which data structure for List of objects + datagrid wiev

    - by Martin
    Hi, I have to develop a code which will store a list of objects, as example below 101, value 11, value 12, value 13 ...etc 102, value 21, value 22, value 23 ...etc 103, value 31, value 32, value 33 ...etc 104, value 41, value 42, value 43 ...etc Now, the difficulty is, that first column is an identifier, and whole table should always be sorted by it. Easy access to each element is required. Additionally, list should be easily updated, and extended by adding element at the end as well as in front and still keep being sorted by first column. Finally, I would like to be able to display values of the above in datagridview. What is most important is a performance of the implementation, as rows will be updated many times per second, and datagridview should be able to display all changes immediately. I was thinking about creating class for the values, and then a Dictionary but encountered a problem with displaying values in gridview. What would be the most optimal way of implementing the code? Thanks in advance Martin

    Read the article

  • Cookie is not getting deleted in IE 8.

    - by Ajit
    Hello guys, I'm trying to delete a cookie but somehow it is not getting deleted in IE 8 This is the code i'm using HttpCookie userCookie = Request.Cookies[cookieName]; if (userCookie != null) { userCookie.Expires = DateTime.Now.AddDays(-1); if (!string.IsNullOrEmpty(cookieDomain)) userCookie.Domain = cookieDomain; Response.Cookies.Add(userCookie); } It is working fine in firfox and chrome . Suppose the name of the cookie is testcookie. We created this cookie from xyz.com and we set the domain of the cookie as ".xyz.com". Now we are deleting or expiring this cookie from subdomain.xyz.com. We are deleting the cookie with the code we have mentioned above.

    Read the article

  • Why does my submit button fail to trigger Javascript MVC?

    - by user54197
    I have a simple code from a book and the code should display data from my controller in the "results" span. What am I missing? <asp:Content ID="Content2" ContentPlaceHolderID="MainContent" runat="server"> <script type="text/javascript"> $("form[action$='GetQuote']").submit(function() { $.post($(this).attr("action"), $(this).serialize(), function(response) { $("#results").html(response); }); return false; }); </script> <h2>Index</h2> <%using (Html.BeginForm("GetQuote","Stocks")) { %> Symbol: <%= Html.TextBox("symbol") %> <input type="submit" /> <span id="results"></span> <% } %> <p><i><%=DateTime.Now.ToLongTimeString() %></i></p> </asp:Content>

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

  • Cannot execute cut-n-paste VBScripts

    - by IcedDante
    I have been going mad trying to figure out why my scripts weren't working, until I started copying and pasting sample source code directly from a few websites only to have it fail there as well. I am getting the following error in my VBScripts: C:\temp\vbs\script.vbs(19, 53) Microsoft VBScript compilation error: Expected statement' For a line of code that looks like this: wdoc.Application.Selection.Find.Execute Replace:=wdReplaceAll This is interfacing with Microsft Word in Office 2007 to conduct a search and replace. Index 53 point directly to the := part of the assignment. Since this type of syntax doesn't work on my machine and I am using it from several websites, I was wondering if the cscript.exe I use is out of date. Am I not calling cscript properly?

    Read the article

  • Method with throws Exception: Where is it actually handled?

    - by Esq
    Here is an example code, I am throwing an exception here, it works perfectly fine without the try/catch block of code for some reason. Do I have to handle this inside this method "EntryDelete" or Do I have to handle this where the method is called from? If so can I see an example, what do I have to import in there? What is the acceptable syntax or method to do this? public boolean EntryDelete(int entryId) throws SQLException{ this.open(); kDatabase.delete(kENTRY_TABLE, kENTRY_ENTRY_ID + "=" + entryId, null); this.close(); return true; } Thanks

    Read the article

  • a query is inserted from PHPMYAdmin but not from PHP

    - by iyad al aqel
    i'm writing a php code to insert form values in a forum values $dbServer = mysql_connect("localhost" , "root", "") ; if(!$dbServer) die ("Unable to connect"); mysql_select_db("kfumWonder"); $name= $_POST['name'] ; $password= md5($_POST['password']); $email= $_POST['email'] ; $major= $_POST['major'] ; $dateOfBirth=$_POST['dateOfBirth'] ; $webSite = $_POST['website']; $joinDate= date("Y m d") ; $query = "INSERT INTO user (name, password, email, major, dob, website, join_date) Values ('$name', '$password', '$email', '$major', '$dateOfBirth', '$webSite' , '$joinDate')" ; //echo $query ; $result = mysql_query($query) ; if (! $result ) echo " no results " ; this works perfectly fine when i took the printed query and run it in PHPMyAdmin but when i run this code nothing happens , any ideas !?

    Read the article

  • Is it a good idea to work on header files only, just at the start of the project?

    - by m4design
    To explain my point further, I'm a beginner in programming, and I'm working on a small project. Instead of separating the .cpp file from the header file, I'm implementing the code in the header files, and making one .cpp file for testing. I do this to have less files, hence easier navigation. Then later I'll separate the code as it should be. Will this cause any problems? should I continue doing that? Thanks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Add up values from a text file

    - by Stanley
    Hi Guys I have a text file that contains Amounts at Substring (34, 47) of each line. I need to sum Up all the Values to the End of the File. I have this code that I had started to build but I do not know how to proceed from here: public class Addup { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException, IOException { // TODO code application logic here FileInputStream fs = new FileInputStream("C:/Analysis/RL004.TXT"); BufferedReader br = new BufferedReader(new InputStreamReader(fs)); String line; while((line = br.readLine()) != null){ String num = line.substring(34, 47); double i = Double.parseDouble(num); System.out.println(i); } } } The output is like this: 1.44576457E4 2.33434354E6 4.56875685E3 The Amount is in two decimal Places and I need the result also in the Two decimal Places. What Is the Best way to achieve this?

    Read the article

  • generate all subsets of size k from a set

    - by Kumar
    hi, i want to generate all the subsets of size k from a set. eg:-say i have a set of 6 elements, i have to list all the subsets in which the cardinality of elements is 3. I tried looking for solution,but those are code snippets. Its been long since I have done coding,so I find it hard to understand the code and construct a executable program around it. A complete executable program in C or C++ will be quite helpful. Hoping of an optimal solution using recursion. Thanks in advance. Kumar.

    Read the article

  • Request attributes in jsf / icefaces behaves strange (survive request end)

    - by hubertg
    I have the following code in a listener method: FacesContext.getCurrentInstance().getExternalContext().getRequestMap().put("time", new Date()); When a button is clicked the following code is executed System.out.println(FacesContext.getCurrentInstance().getExternalContext().getRequestMap().get("time")); One could except that "time" is null when the listener was not executed while processing the current request, but: it seems like the "time" object survives the request processing. So when "time" has been set sometimes in the past it stays there... can anybody explain this? Thanks.

    Read the article

  • How to keep the popup menu of a JComboBox open on populating it ?

    - by Stormshadow
    I have a JComboBox on my Panel. One of the popup menu items is 'More' and when I click that I fetch more menu items and add them to the existing list. After this, I wish to keep the popup menu open so that the user realizes that more items have been fetched however, the popup closes. The event handler code I am using is as follows public void actionPerformed(ActionEvent e) { if (e.getSource() == myCombo) { JComboBox selectedBox = (JComboBox) e.getSource(); String item = (String) selectedBox.getSelectedItem(); if (item.toLowerCase().equals("more")) { fetchItems(selectedBox); } selectedBox.showPopup(); selectedBox.setPopupVisible(true); } } private void fetchItems(JComboBox box) { box.removeAllItems(); /* code to fetch items and store them in the Set<String> items */ for (String s : items) { box.addItem(s); } } I do not understand why the showPopup() and setPopupVisible() methods are not functioning as expected.

    Read the article

  • textfield value empty when i fill it with javascript

    - by Turi
    i am using modalpopup to enter some value in a textfield. after the value is selected in the modalpopup view, the modalpopup is closed and the value has taken the propriate value. Even if the value is displyed in the textfield, the textfield1.text returns me string empty. when i see the source code (html), i see that even that the textfield is displaying something it hasn't really this value in it, because the appropriate html input field hasn't value yet. thats the code i use to fill this textfield. function CloseRequestModal(s) { document.getElementById('<%=txtRequest.ClientID%>').value = s; var mpu = $find('<%=ModalPopupExtender3.ClientID%>'); mpu.hide(); } Please Help, Thanks in advance.

    Read the article

  • Error in asp.net C#

    - by Ishan
    How to pass Editor1 as Parameter: In my aspx.cs i am giving a call to a function which is in .cs file for the same project, as follows: protected void DropDownList2_SelectedIndexChanged(object sender, EventArgs e) { DropDown abs = new DropDown(); abs.dd(this.DropDownList2, this.DropDownList3); } .CS file code public void dd(DropDownList DropDownList2, DropDownList DropDownList3) { //My code which contains DropDownList2 DropDownList3 and Editor1 } The error that i am getting is: Error 1 The name 'Editor1' does not exist in the current context The way i have passed DropDownList2 and DropDownList3 i am not able to pass Editor1(It is an ajax control). How do i pass it?

    Read the article

  • Do you put a super() call a the beginning of your constructors?

    - by sleske
    This is a question about coding style and recommended practices: As explained in the answers to the question unnecessary to put super() in constructor?, if you write a constructor for a class that is supposed to use the default (no-arg) constructor from the superclass, you may call super() at the beginning of your constructor: public MyClass(int parm){ super(); // leaving this out makes no difference // do stuff... } but you can also omit the call; the compiler will in both cases act as if the super() call were there. So then, do you put the call into your constructors or not? On the one hand, one might argue that including the super() makes things more explicit. OTOH, I always dislike writing redundant code, so personally I tend to leave it out; I do however regularly see it in code from others. What are your experiences? Did you have problems with one or the other approach? Do you have coding guidelines which prescribe one approach?

    Read the article

< Previous Page | 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090  | Next Page >