Search Results

Search found 3825 results on 153 pages for 'regex negation'.

Page 116/153 | < Previous Page | 112 113 114 115 116 117 118 119 120 121 122 123  | Next Page >

  • not autolinking all-numeric twitter hashtags in perl?

    - by all_numeric_no_hash
    I'm producing HTML from twitter search results. Happily using the Net::Twitter module :-) One of the rules in Twitter is that all-numeric hashtags are not links. This allows to unambiguously tweet things like "ur not my #1 anymore", as in here: http://twitter.com/natarias2007/status/11246320622 The solution I came up with looks like: $tweet =~ s{#([0-9]*[A-Za-z_]+[0-9]*)}{<a href="http://twitter.com/search?q=%23$1">#$1</a>}g; It seems to work (let's hope), but I'm still curious... how would you do it?

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • extract word with regular expression

    - by farka
    I have a string 1/temperatoA,2/CelcieusB!23/33/44,55/66/77 and I would like to extract the words temperatoA and CelcieusB. I have this regular expression (\d+/(\w+),?)*! but I only get the match 1/temperatoA,2/CelcieusB! Why?

    Read the article

  • How can I match everything in a string until the second occurrence of a delimiter with a regular expression?

    - by Steve
    I am trying to refine a preg_match_all by finding the second occurrence of a period then a space: <?php $str = "East Winds 20 knots. Gusts to 25 knots. Waters a moderate chop. Slight chance of showers."; preg_match_all ('/(^)((.|\n)+?)(\.\s{2})/',$str, $matches); $dataarray=$matches[2]; foreach ($dataarray as $value) { echo $value; } ?> But it does not work: the {2} occurrence is incorrect. I have to use preg_match_all because I am scraping dynamic HTML. I want to capture this from the string: East Winds 20 knots. Gusts to 25 knots.

    Read the article

  • Finding C#-style unescaped strings using regular expressions

    - by possan
    I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

    Read the article

  • Regular expression - starting and ending with a letter, accepting only letters, numbers and _

    - by jreid9001
    I'm trying to write a regular expression which specifies that text should start with a letter, every character should be a letter, number or underscore, there should not be 2 underscores in a row and it should end with a letter or number. At the moment, the only thing I have is ^[a-zA-Z]\w[a-zA-Z1-9_] but this doesn't seem to work properly since it only ever matches 3 characters, and allows repeated underscores. I also don't know how to specify requirements for the last character.

    Read the article

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • In Perl, how to match several prefixes

    - by xorsyst
    I have 2 input files. One is a list of prefix and lengths, like this: 101xxx 102xxx 30xx 31xx (where x is any number) And another is a list of numbers. I want to iterate through the second file, matching each number against any of the prefix/lengths. This is fairly easy. I build a list of regexps: my @regexps = ('101...', '102...', '30..', '31..'); Then: foreach my $regexp (@regexps) { if (/$regexp/) { # do something But, as you can guess, this is slow for a long list. I could convert this to a single regexp: my $super_regexp = '101...|102...|30..|31..'; ...but, what I need is to know which regexp matched the item, and what the ..s matched. I tried this: my $catching_regexp = '(101)(...)|(102)(...)|(30)(..)|(31)(..)'; but then I don't know whether to look in $1, $3, %5 or $7. Any ideas? How can I match against any of these prefix/lengths and know which prefix, and what the remaining digits where?

    Read the article

  • parse unformatted string into dictionary with python

    - by user553131
    I have following string. DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) Key: a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO I need to create dictionary so it would be like { "DATE": "12242010", "Key Type": "Nod32 Anti-Vir (30d trial)", "Key": "a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO" } The problem is that string is unformatted DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) there is no space after Date before Key Type also it would be nice to have some validation for Key, eg if there are 5 chars in each box of key and number of boxes I am a beginner in python and moreover in regular expressions. Thanks a lot.

    Read the article

  • javascript regular expressions

    - by Zhasulan Berdybekov
    Help me with regular expressions. I need to check the text on the hour and minute. That is the first case, the text can be from 0 to 12. In the second case, the text can be from 1 to 60. this is my code: var hourRegEx = /^([0-9]{2})$/; //You can fix this line of code? $(document).ready( function(){ $('form.form').submit(function(){ if( $('input.hour').val().match(hourRegEx) ){ return true; } return false; }); }); In my case, the code says that, for example 52, too, the correct answer

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Regular Expression

    - by Blanca
    Hi! i would like to avoid texts like this one: height="49" with a regular expresion. I tought in .replaceAll("\s*="*"",""); (replaceAll is used as a method in a java class), but eclipse don't allowed me to do that. Any other suggestion?? tx!

    Read the article

  • python and regular expression with unicode

    - by bsn
    I need to delete some unicode symbols from the string '?????? ??????? ???????????? ??????????' I know they exist here for sure. I try: re.sub('([\u064B-\u0652\u06D4\u0670\u0674\u06D5-\u06ED]+)', '', '?????? ??????? ???????????? ??????????') but it doesn't work. String stays the same. ant suggestion what i do wrong?

    Read the article

  • dropping characters from regular expression groups

    - by tcurdt
    The goal: I want to convert a number from the format "10.234,56" to "10234.56" Using this simple approach almost gets us there /([\d\.]+),(\d\d)/ => '\1.\2' The problem is that the first group of the match (of course) still contains the '.' character. So questions are: Is it possible to exclude a character from the group somehow? How would you solve this with a single regexp (I know this is a trivial problem when not using a single regexp)

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • mine phrases (up to 3 words) from a given text

    - by DS_web_developer
    I asked before for a simple solution to my problem (using sphinx search service) but I got nowhere... someone has kindly provided me with this code <?php /** * $Project: GeoGraph $ * $Id$ * * GeoGraph geographic photo archive project * This file copyright (C) 2005 Barry Hunter ([email protected]) * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation; either version 2 * of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program; if not, write to the Free Software * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. */ /** * Provides the methods for updating the worknet tables * * @package Geograph * @author Barry Hunter <[email protected]> * @version $Revision$ */ function addTwoLetterPhrase($phrase) { global $w2; $w2[$phrase] = (isset($w2[$phrase]))?($w2[$phrase]+1):1; } function addThreeLetterPhrase($phrase) { global $w3; $w3[$phrase] = (isset($w3[$phrase]))?($w3[$phrase]+1):1; } function updateWordnet(&$db,$text,$field,$id) { global $w1,$w2,$w3; $alltext = strtolower(preg_replace('/\W+/',' ',str_replace("'",'',$text))); if (strlen($text)< 1) return; $words = preg_split('/ /',$alltext); $w1 = array(); $w2 = array(); $w3 = array(); //build a list of one word phrases foreach ($words as $word) { $w1[$word] = (isset($w1[$word]))?($w1[$word]+1):1; } //build a list of two word phrases $text = $alltext; $text = preg_replace('/(\w+) (\w+)/e','addTwoLetterPhrase("$1 $2")',$text); $text = $alltext; $text = preg_replace('/(\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+)/e','addTwoLetterPhrase("$1 $2")',$text); //build a list of three word phrases $text = $alltext; $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); $text = $alltext; $text = preg_replace('/(\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); $text = $alltext; $text = preg_replace('/(\w+) (\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); foreach ($w1 as $word=>$count) { $db->Execute("insert into wordnet1 set gid = $id,words = '$word',$field = $count");// ON DUPLICATE KEY UPDATE $field=$field+$count"); } foreach ($w2 as $word=>$count) { $db->Execute("insert into wordnet2 set gid = $id,words = '$word',$field = $count"); } foreach ($w3 as $word=>$count) { $db->Execute("insert into wordnet3 set gid = $id,words = '$word',$field = $count"); } } ?> It works fine and does almost exactly what I need....... except.... it is not utf8 friendly... I mean... it splits whole words into parts (on special chars) where it shouldn't! so my guess is I should use multibyte functions instead of regular preg_replace... I tried to replace preg_replace with mb_ereg_replace but it is not working as it should... at least not for 2 and 3 words phrases any ideas?

    Read the article

< Previous Page | 112 113 114 115 116 117 118 119 120 121 122 123  | Next Page >