Search Results

Search found 6155 results on 247 pages for 'escape characters'.

Page 138/247 | < Previous Page | 134 135 136 137 138 139 140 141 142 143 144 145  | Next Page >

  • Sql server messed up degree symbol

    - by user228058
    Some of the degree sysmbols in my sql server database are displaying like this: 173-¦F. When I do a search for that - SELECT * FROM PRoduct WHERE description LIKE '%-¦%', it does not bring them up. How can I find (and replace) such characters?

    Read the article

  • Scraping &#151 character (long dash) error in Nokogiri

    - by DavidP6
    I having trouble scraping a certain long dash that is encoded as — ; on the Time magazine site. It looks like this: —. It works fine when this dash is encoded as mdash, but when the problem dash is scraped, it is returned as unknown characters. I am using Nokogiri and am wondering if I have to use some sort of special encoding? The page says it is encoded with UTF-8.

    Read the article

  • How would you write a program to find the shortest pangram in a list of words?

    - by jonathanasdf
    Given a list of words which contains the letters a-z at least once, how would you write a program to find the shortest pangram counted by number of characters (not counting spaces) as a combination of the words? Since I am not sure whether short answers exist, this is not code golf, but rather just a discussion of how you would approach this. However, if you think you can manage to write a short program that would do this, then go ahead, and this might turn into code golf :)

    Read the article

  • Python RegExp exception

    - by Jasie
    How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

    Read the article

  • Does UrlDecode handle plus (+) correctly?

    - by harpo
    According to RFC 2396, The plus "+", dollar "$", and comma "," characters have been added to those in the "reserved" set, since they are treated as reserved within the query component. Indeed, search this site for "plus + comma , dollar $", and you get http://stackoverflow.com/search?q=plus+%2B+comma+,+dollar+$ Plus is only encoded (by the application) when it's not being used as a delimiter. But as others have observed, .NET's UrlDecode function converts plus to space. Where is this behavior specified?

    Read the article

  • Creating a unique URL safe hash

    - by Ben Foster
    I want to hash/encode a unique integer (database ID) to create a similarly unique string. It needs to meet the following requirements: Must start with a letter or number, and can contain only letters and numbers. All letters in a container name must be lowercase. Must be from 3 through 63 characters long (although the shorter the better) The result does not need to be reversible, just repeatable - so a 1-way hash would be fine.

    Read the article

  • Create, sort, and print a list of 100 random ints in the fewest chars of code

    - by TheSoftwareJedi
    What is the least amount of code you can write to create, sort (ascending), and print a list of 100 random positive integers? By least amount of code I mean characters contained in the entire source file, so get to minifying. I'm interested in seeing the answers using any and all programming languages. Let's try to keep one answer per language, edit the previous to correct or simplify. If you can't edit, comment?

    Read the article

  • Special chars in Amazon S3 keys?

    - by Martin
    Is it possible to have special characters like åäö in the key? If i urlencode the key before storing it works, but i cant really find a way to access the object. If i write åäö in the url i get access denied (like i get if the object is not found). If i urlencode the url i paste in the browser i get "InvalidURICouldn't parse the specified URI". Is there some way to do this?

    Read the article

  • Drill down rss reader iphone

    - by bing
    Hi everyone, I have made a simple rss reader. The app loads an xml atom file in an array. Now I have added categories to my atom feed, which are first loaded in the array What is the best way to add drill down functionality programmatically. Now only the categories are loaded into the array and displayed. This is the implementation code ..... loading xml file <snip> ..... - (void)parserDidStartDocument:(NSXMLParser *)parser { NSLog(@"found file and started parsing"); } - (void)parser:(NSXMLParser *)parser parseErrorOccurred:(NSError *)parseError { NSString * errorString = [NSString stringWithFormat:@"Unable to download story feed from web site (Error code %i )", [parseError code]]; NSLog(@"error parsing XML: %@", errorString); UIAlertView * errorAlert = [[UIAlertView alloc] initWithTitle:@"Error loading content" message:errorString delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; [errorAlert show]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict{ //NSLog(@"found this element: %@", elementName); currentElement = [elementName copy]; if ([elementName isEqualToString:@"entry"]) { // clear out our story item caches... Categoryentry = [[NSMutableDictionary alloc] init]; currentID = [[NSMutableString alloc] init]; currentTitle = [[NSMutableString alloc] init]; currentSummary = [[NSMutableString alloc] init]; currentContent = [[NSMutableString alloc] init]; } } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName{ //NSLog(@"ended element: %@", elementName); if ([elementName isEqualToString:@"entry"]) { // save values to an entry, then store that item into the array... [Categoryentry setObject:currentTitle forKey:@"title"]; [Categoryentry setObject:currentID forKey:@"id"]; [Categoryentry setObject:currentSummary forKey:@"summary"]; [Categoryentry setObject:currentContent forKey:@"content"]; [categories addObject:[Categoryentry copy]]; NSLog(@"adding category: %@", currentTitle); } } - (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string{ //NSLog(@"found characters: %@", string); // save the characters for the current item... if ([currentElement isEqualToString:@"title"]) { [currentTitle appendString:string]; } else if ([currentElement isEqualToString:@"id"]) { [currentID appendString:string]; } else if ([currentElement isEqualToString:@"summary"]) { [currentSummary appendString:string]; } else if ([currentElement isEqualToString:@"content"]) { [currentContent appendString:string]; } } - (void)parserDidEndDocument:(NSXMLParser *)parser { [activityIndicator stopAnimating]; [activityIndicator removeFromSuperview]; NSLog(@"all done!"); NSLog(@"categories array has %d entries", [categories count]); [newsTable reloadData]; }

    Read the article

  • Why use spaces instead of tabs for indentation? [closed]

    - by erenon
    Possible Duplicate: Are spaces preferred over tabs for indentation? Why do most coding standards recommend the use of spaces instead of tabs? Tabs can be configured to be as many characters wide as needed, but spaces can't. Example: Zend cs Pear cs Pear manual: This helps to avoid problems with diffs, patches, SVN history and annotations. How could tabs cause problems?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How do I write a Oracle SQl query for this tricky question...

    - by atrueguy
    Here is the table data with the column name as Ships. +--------------+ Ships | +--------------+ Duke of north | ---------------+ Prince of Wales| ---------------+ Baltic | ---------------+ In the Outcomes table, transform names of the ships containing more than one space, as follows: Replace all characters between the first and the last spaces (excluding these spaces) by symbols of an asterisk (*). The number of asterisks must be equal to number

    Read the article

  • timeout stringwithcontentsofurl

    - by sergiobuj
    Hi, I have this call to stringwithcontentsofurl: [NSString stringWithContentsOfURL:url usedEncoding:NSASCIIStringEncoding error:nil]; How can I give that a simple timeout? I don't want to use threads or operation queues (the content of the url is about 100 characters), I just don't want to wait too long when the connection is slow.

    Read the article

  • [PHP] Read and write to a file while keeping lock

    - by Znarkus
    Hi! I am making a simple page load counter by storing the current count in a file. This is how I want to do this: Lock the file Read the current count Increment it Write new count Unlock file/close it Can this be done? As I understand it, the file can't be written to without losing the lock. The only way I have come up with to tackle this, is to write a character using "r+" mode, and then counting characters.

    Read the article

  • php regex - replace on "\${1}"

    - by Qiao
    found this regex: insert " " every 10 characters: $text = preg_replace("|(.{10})|u", "\${1}"." ", $text); can you, please, explain what \${1} means. Why using \ and what curly brackets means?

    Read the article

  • UILabel to render partial character using clip

    - by magic-c0d3r
    I want a UILabel to render a partial character by setting the lineBreakMode to clip. But it is clipping the entire character. Is there a different way to clip a word so that only partial character is displayed? Lets say I have a string like: "Hello Word" and that string is in a myLabel with a width that only fits the 5 characters and part of the "W" I want it still to render part of the "W" and not drop it from the render.

    Read the article

  • how could I store data within a GUID

    - by Mark
    I have an application that I want to represent a users session (just small pieces of data here and there) within a GUID. Its a 16 HEX characters (so 16^16 possible values) string and I want to 'encode' some data within that GUID. How can I achieve this? I am really after any ideas and implementations here, Ive not yet decided on the best mechanism for it yet. I would also like encryption to be involved if possible... Thanks a lot Mark

    Read the article

  • Problem with regular expression for some special parttern.

    - by SpawnCxy
    Hi all, I got a problem when I tried to find some characters with following code: preg_match_all('/[\w\uFF10-\uFF19\uFF21-\uFF3A\uFF41-\uFF5A]/',$str,$match); //line 5 print_r($match); And I got error as below: Warning: preg_match_all() [function.preg-match-all]: Compilation failed: PCRE does not support \L, \l, \N, \U, or \u at offset 4 in E:\mycake\app\webroot\re.php on line 5 I'm not so familiar with reg expression and have no idea about this error.How can I fix this?Thanks.

    Read the article

< Previous Page | 134 135 136 137 138 139 140 141 142 143 144 145  | Next Page >