Search Results

Search found 14260 results on 571 pages for 'regex group'.

Page 172/571 | < Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >

  • How can I improve this regular expression?

    - by Michael Haren
    I want a regular expression to match valid input into a Tags input field with the following properties: 1-5 tags Each tag is 1-30 characters long Valid tag characters are [a-zA-Z0-9-] input and tags can be separated by any amount of whitespace Here's what I have so far--it seems to work but I'm interested how it could be simplified or if it has any major flaws: \s*[a-zA-Z0-9-]{1,30}(\s+[a-zA-Z0-9-]{1,30}){0,4}\s* // that is: \s* // match all beginning whitespace [a-zA-Z0-9-]{1,30} // match the first tag (\s+[a-zA-Z0-9-]{1,30}){0,4} // match all subsequent tags \s* // match all ending whitespace Preprocessing the input to make the whitespace issue easier isn't an option (e.g. trimming or adding a space). If it matters, this will be used in javascript. Any suggestions would be appreciated, thanks!

    Read the article

  • How can I match everything in a string until the second occurrence of a delimiter with a regular expression?

    - by Steve
    I am trying to refine a preg_match_all by finding the second occurrence of a period then a space: <?php $str = "East Winds 20 knots. Gusts to 25 knots. Waters a moderate chop. Slight chance of showers."; preg_match_all ('/(^)((.|\n)+?)(\.\s{2})/',$str, $matches); $dataarray=$matches[2]; foreach ($dataarray as $value) { echo $value; } ?> But it does not work: the {2} occurrence is incorrect. I have to use preg_match_all because I am scraping dynamic HTML. I want to capture this from the string: East Winds 20 knots. Gusts to 25 knots.

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • not autolinking all-numeric twitter hashtags in perl?

    - by all_numeric_no_hash
    I'm producing HTML from twitter search results. Happily using the Net::Twitter module :-) One of the rules in Twitter is that all-numeric hashtags are not links. This allows to unambiguously tweet things like "ur not my #1 anymore", as in here: http://twitter.com/natarias2007/status/11246320622 The solution I came up with looks like: $tweet =~ s{#([0-9]*[A-Za-z_]+[0-9]*)}{<a href="http://twitter.com/search?q=%23$1">#$1</a>}g; It seems to work (let's hope), but I'm still curious... how would you do it?

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • javascript regular expressions

    - by Zhasulan Berdybekov
    Help me with regular expressions. I need to check the text on the hour and minute. That is the first case, the text can be from 0 to 12. In the second case, the text can be from 1 to 60. this is my code: var hourRegEx = /^([0-9]{2})$/; //You can fix this line of code? $(document).ready( function(){ $('form.form').submit(function(){ if( $('input.hour').val().match(hourRegEx) ){ return true; } return false; }); }); In my case, the code says that, for example 52, too, the correct answer

    Read the article

  • python and regular expression with unicode

    - by bsn
    I need to delete some unicode symbols from the string '?????? ??????? ???????????? ??????????' I know they exist here for sure. I try: re.sub('([\u064B-\u0652\u06D4\u0670\u0674\u06D5-\u06ED]+)', '', '?????? ??????? ???????????? ??????????') but it doesn't work. String stays the same. ant suggestion what i do wrong?

    Read the article

  • parse unformatted string into dictionary with python

    - by user553131
    I have following string. DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) Key: a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO I need to create dictionary so it would be like { "DATE": "12242010", "Key Type": "Nod32 Anti-Vir (30d trial)", "Key": "a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO" } The problem is that string is unformatted DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) there is no space after Date before Key Type also it would be nice to have some validation for Key, eg if there are 5 chars in each box of key and number of boxes I am a beginner in python and moreover in regular expressions. Thanks a lot.

    Read the article

  • Is it possible to exclude some elements from parsing when using regular expression and .replace()?

    - by Fletus Mefitis
    <script language="javascript"> $("div.post-content , .parsedsig").each(function(){ if($(this).html().indexOf("[/tabulaScriptum]") != -1) { pattern = /\[tabulaScriptum=(.*?)\]([^\[]*)\[\/tabulaScriptum\]/gi $(this).html($(this).html().replace(pattern, "<div class='tabulaScriptum'><div class='tabulaNomen'>$1</div><div class='tabulaImpleo'>$2</div></div>")) } }); </script> This script is working perfectly, except for one thing... I need not to replace [tabulaScriptum=][/tabulaScriptum] in certain elements. For example, I don't want to replace those "tags" in element that has class .code-box. Is it possible? Clarification: element .code-box is located within .post-content. Clarification #2: this script creates simple division spoiler. .tabulaScriptum is spoier's body, .tabulaNomen is spoiler's name and button which, in turn, reveals(or hides) .tabulaImpleo on click. Reveal\hide script is located in some other place, and I didn't post it here since it doesn't really matter. Clarification #3: http://jsfiddle.net/PRtsw/1/ fiddle.

    Read the article

  • Regular Expression

    - by Blanca
    Hi! i would like to avoid texts like this one: height="49" with a regular expresion. I tought in .replaceAll("\s*="*"",""); (replaceAll is used as a method in a java class), but eclipse don't allowed me to do that. Any other suggestion?? tx!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • mine phrases (up to 3 words) from a given text

    - by DS_web_developer
    I asked before for a simple solution to my problem (using sphinx search service) but I got nowhere... someone has kindly provided me with this code <?php /** * $Project: GeoGraph $ * $Id$ * * GeoGraph geographic photo archive project * This file copyright (C) 2005 Barry Hunter ([email protected]) * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation; either version 2 * of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program; if not, write to the Free Software * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. */ /** * Provides the methods for updating the worknet tables * * @package Geograph * @author Barry Hunter <[email protected]> * @version $Revision$ */ function addTwoLetterPhrase($phrase) { global $w2; $w2[$phrase] = (isset($w2[$phrase]))?($w2[$phrase]+1):1; } function addThreeLetterPhrase($phrase) { global $w3; $w3[$phrase] = (isset($w3[$phrase]))?($w3[$phrase]+1):1; } function updateWordnet(&$db,$text,$field,$id) { global $w1,$w2,$w3; $alltext = strtolower(preg_replace('/\W+/',' ',str_replace("'",'',$text))); if (strlen($text)< 1) return; $words = preg_split('/ /',$alltext); $w1 = array(); $w2 = array(); $w3 = array(); //build a list of one word phrases foreach ($words as $word) { $w1[$word] = (isset($w1[$word]))?($w1[$word]+1):1; } //build a list of two word phrases $text = $alltext; $text = preg_replace('/(\w+) (\w+)/e','addTwoLetterPhrase("$1 $2")',$text); $text = $alltext; $text = preg_replace('/(\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+)/e','addTwoLetterPhrase("$1 $2")',$text); //build a list of three word phrases $text = $alltext; $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); $text = $alltext; $text = preg_replace('/(\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); $text = $alltext; $text = preg_replace('/(\w+) (\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); foreach ($w1 as $word=>$count) { $db->Execute("insert into wordnet1 set gid = $id,words = '$word',$field = $count");// ON DUPLICATE KEY UPDATE $field=$field+$count"); } foreach ($w2 as $word=>$count) { $db->Execute("insert into wordnet2 set gid = $id,words = '$word',$field = $count"); } foreach ($w3 as $word=>$count) { $db->Execute("insert into wordnet3 set gid = $id,words = '$word',$field = $count"); } } ?> It works fine and does almost exactly what I need....... except.... it is not utf8 friendly... I mean... it splits whole words into parts (on special chars) where it shouldn't! so my guess is I should use multibyte functions instead of regular preg_replace... I tried to replace preg_replace with mb_ereg_replace but it is not working as it should... at least not for 2 and 3 words phrases any ideas?

    Read the article

< Previous Page | 168 169 170 171 172 173 174 175 176 177 178 179  | Next Page >