Search Results

Search found 12834 results on 514 pages for 'small wolf'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 183/514 | < Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >

  • Iframe covers navigation bar, needs close, open to fix?

    - by kuyanatan
    I have a small webpage with a form, iframe-d in. When I put invalid input inside the form, the iframe covers up the navigation bar and I can't get the navigation bar back without closing and opening the page again. Here is where I am (temporarily) hosting the webpage: dl.dropbox.com/u/1144456/rlp/v2/demo.html the css stylesheet: dl.dropbox.com/u/1144456/rlp/v2/contact-us.htm To recreate this problem, click the last tab and just click submit.

    Read the article

  • How to display a status message in the Gnome panel?

    - by George Edison
    I have a Gnome applet I've been working on. It is written in Python and it displays the progress of something in a small label. My question is: what is the best way to display status notifications to the user? On Ubuntu, I notice that whenever I connect to a network or adjust the volume, a black box appears in the upper-right corner. Is there a way to do something like that with Python?

    Read the article

  • How to know that a php project is using Zend framework?

    - by Wing C. Chen
    I am writing a piece of small software to go through the folders and files of all the php projects that are passed in and detect if any of them is actually also a Zend project. Is there any particular file that I can immediately read and tell that the current project is a Zend project? or is there any convenient way to tell?

    Read the article

  • Can Android OS be programmed to interface with a external device via the mini-USB port?

    - by user322865
    Basic example, if I bought a chipset with a light socket and bulb soldered to the chipset; then put a USB cable with the mini-USB plug on the end to get plugged into the android phone. Can I write a Java application to turn on/off the light, get the status of the light(on/off) and maybe power a super-small led/bulb with power from the phone itself? Any insight at all would be greatly appreciated. Thank you

    Read the article

  • PHPMailer - what sending method is most appropriate?

    - by Stomped
    Hello. I need to use PHPMailer to send emails out for the following reasons: small lists (less then 500) password resets general notifications, 100ish emails at a time And PHPMailer gives me the option to send via mail(), sendmail, or SMTP. Is there any reason to prefer one of these methods over the other? I don't know enough about email services in general to make an informed decision.

    Read the article

  • I'm tired of JButtons, how can I make a nicer GUI in java ?

    - by Jules Olléon
    So far I've only build "small" graphical applications, using swing and JComponents as I learned at school. Yet I can't bear ugly JButtons anymore. I've tried to play with the different JButton methods, like changing colors, putting icons etc. but I'm still not satisfied. How do you make a nicer GUI in java ? I'm looking for not-too-heavy alternatives (like, without big frameworks or too complicated libraries).

    Read the article

  • Redirect question using mod_rewrite (no extensions - root of site)

    - by alex
    Hi, I'm having a small problem with mod_rewrite I have the following in my .htacces: Options +FollowSymlinks RewriteEngine on RewriteRule ^(.+)\.htm$ index.php?name=$1 [NC] This is my index.php file: <?php echo $_GET['name]; ?> This works great for the following url: www.mySite.com/this is an example.htm this would display "this is an example" What i'm trying to do however, is get it to do the same, without the .htm extension: for example: www.mySite.com/this is an example Any ideas? (dont think it's relevant but i'm using xampp to test this)

    Read the article

  • jquery, safari & jqzoom plugin - issue with document.ready

    - by mmuller
    Hi, I have a small issue with jQuery on Safari (Mac OSX 10.6) - the page loads fine under Firefox (Mac) and Internet Explorer (Win) but has to be refreshed to work properly in Safari... http://7souls.co.uk/store/index.php?dispatch=products.view&product_id=29788 If you hover over the image it is meant to show a magnified version to the right hand side - which works on the first page load on all browsers except Safari on the Mac. You have to refresh the page to get it to work under safari. Any Ideas, MM

    Read the article

  • java array manipulation

    - by sachin
    Hi, I'm a beginner in java. I want the logic of the small program. I have two arrays array = {a1,a2,a3,a4,a5,,,,,,,,,an} and array2 = {b1,b2,b3,b4,,,,,,,,,,,bn} I want string as: a1b1,a2a3b2b3,a4a5a6b4b5b6,..........an Please tell me what will be the logic.

    Read the article

  • Minimalist Wiki like script

    - by arthurprs
    I'm trying to find a simple wiki like script to setup a personal directory, browser favorites simply doesn't do anymore and i have lots of small files on my flash drive Desired features file upload not bloated works on a common webhost (aka php) Thanks in advance

    Read the article

  • Why is a c++ reference considered safer than a pointer?

    - by anand.arumug
    When the c++ compiler generates very similar assembler code for a reference and pointer, why is using references preferred (and considered safer) compared to pointers? I did see Difference between pointer variable and reference variable in C++ which discusses the differences between them. EDIT-1: I was looking at the assembler code generated by g++ for this small program: int main(int argc, char* argv[]) { int a; int &ra = a; int *pa = &a; }

    Read the article

  • What is the most efficient procedure for implementing a sortable ajax list on the backend?

    - by HenryL
    The most common method is to assign a sequential order field for each item in the list and do an update that maintains the sequence with every ajax sort operation. Unfortunately, this requires an update to each item of the list every time someone sorts. This is fine for small lists, but what's the best way to implement sorting for larger lists that are constantly updated? I am looking for something that minimizes DB IO.

    Read the article

  • Changing background image of a Drupal page based on user's selection...?

    - by Sambo
    Hi I'm trying to give my users the functionality to change what the background image used on a page is. The list of background images will be a small number that won't really change. I thought I could add a few Taxonomy terms...one for each background type...then apply a class to the body tag when the page is viewed. Does this sound feasible and if so how would I go about doing it? Thanks Sam

    Read the article

  • Amazon Web Services Apache Server

    - by Samnsparky
    I am trying to get a feel for the costs imposed by running apache on AWS continually. Assuming that the service is scarcely used, does anyone know how many cpu hours that would eat up in a month just by sitting there and running? I understand that this is slightly impractical but I am trying to figure out what the cost of entry is to deploy an application on this platform (as compared to GAE). I suspect it to be small but I would like to know.

    Read the article

  • Form validation with optional File Upload field callback

    - by MotiveKyle
    I have a form with some input fields and a file upload field in the same form. I am trying to include a callback into the form validation to check for file upload errors. Here is the controller for adding and the callback: public function add() { if ($this->ion_auth->logged_in()): //validate form input $this->form_validation->set_rules('title', 'title', 'trim|required|max_length[66]|min_length[2]'); // link url $this->form_validation->set_rules('link', 'link', 'trim|required|max_length[255]|min_length[2]'); // optional content $this->form_validation->set_rules('content', 'content', 'trim|min_length[2]'); $this->form_validation->set_rules('userfile', 'image', 'callback_validate_upload'); $this->form_validation->set_error_delimiters('<small class="error">', '</small>'); // if form was submitted, process form if ($this->form_validation->run()) { // add pin $pin_id = $this->pin_model->create(); $slug = strtolower(url_title($this->input->post('title'), TRUE)); // path to pin folder $file_path = './uploads/' . $pin_id . '/'; // if folder doesn't exist, create it if (!is_dir($file_path)) { mkdir($file_path); } // file upload config variables $config['upload_path'] = $file_path; $config['allowed_types'] = 'jpg|png'; $config['max_size'] = '2048'; $config['max_width'] = '1920'; $config['max_height'] = '1080'; $config['encrypt_name'] = TRUE; $this->load->library('upload', $config); // upload image file if ($this->upload->do_upload()) { $this->load->model('file_model'); $image_id = $this->file_model->insert_image_to_db($pin_id); $this->file_model->add_image_id_to_pin($pin_id, $image_id); } } // build page else: // User not logged in redirect("login", 'refresh'); endif; } The callback: function validate_upload() { if ($_FILES AND $_FILES['userfile']['name']): if ($this->upload->do_upload()): return true; else: $this->form_validation->set_message('validate_upload', $this->upload->display_errors()); return false; endif; else: return true; endif; } I am getting the error Fatal error: Call to a member function do_upload() on a non-object on line 92 when I try to run this. Line 92 is the if ($this->upload->do_upload()): line in the validate_upload callback. Am I going about this the right way? What's triggering this error?

    Read the article

  • Multicore programming: what's necessary to do it?

    - by Casey
    I have a quadcore processor and I would really like to take advantage of all those cores when I'm running quick simulations. The problem is I'm only familiar with the small Linux cluster we have in the lab and I'm using Vista at home. What sort of things do I want to look into for multicore programming with C or Java? What is the lingo that I want to google? Thanks for the help.

    Read the article

  • .NET / WPF Alternative

    - by eWolf
    I know the .NET framework and WPF pretty well, but I think the whole thing has gotten too blown up, especially for small apps as the whole .NET framework 3.5 weighs 197 MB by now. I am looking for a language/framework/library that provides functionality similar to that of WPF (animations, gradients, a.s.o.) and the .NET framework (of course not everything, but the basic features) and which is faster and more lightweight than the .NET framework and creates smaller and faster applications than the ones using .NET. Do you have any suggestions?

    Read the article

  • How can I disable mouse click event system wide using C#?

    - by mazzzzz
    Hey guys, I have a laptop with a very sensitive touch pad, and wanted to code a small program that could block the mouse input when I was typing a paper or something. I didn't think it would be hard to do, considering everything I've seen on low-level hooks, but I was wrong (astounding, right?). I looked at a few examples, but the examples I've seen either block both keyboard and mouse, or just hide the mouse. Any help with this would be great.

    Read the article

  • Histogram in Matplotlib with input file

    - by Arkapravo
    I wish to make a Histogram in Matplotlib from an input file containing the raw data (.txt). I am facing issues in referring to the input file. I guess it should be a rather small program. Any Matplotlib gurus, any help ? I am not asking for the code, some inputs should put me on the right way !

    Read the article

  • Documentation on System.Deployment

    - by krisnam
    I have a Win Application which is publish using ClickOnce deployment (go though VS IDE). I want to develop another small application (Web) to do this deployment process without going though VS IDE. I heard about System.Deployment and Microsoft.Build.BuildEngine name spaces. But I count find good doc to solve my problem. If you have one please send me any references.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 179 180 181 182 183 184 185 186 187 188 189 190  | Next Page >