Search Results

Search found 12834 results on 514 pages for 'small wolf'.

Page 184/514 | < Previous Page | 180 181 182 183 184 185 186 187 188 189 190 191  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Run javascript function after Server-Side validation is complete.

    - by Ed Woodcock
    Ok, I've got a lightbox with a small form (2 fields) in it, inside an UpdatePanel, and I want to close this lightbox (must be done via javascript) when the 'Save' button is pressed. However, there is a need to have a server-side CustomValidator on the page, and I only want to close the lightbox if this returns as valid. Does anyone know a way to trigger javascript (or jQuery) code from a server-side validator?

    Read the article

  • Wordpress: How to be redirected to the page when inserting it's page ID into numeric form input with

    - by Daniel
    I would like to know if there's exists some simple code to get to the page i know its ID , I would like to create small input (no matter where in templates)from where the people can easily get to the page if they know it's page ID (4numeric ID is better to remember - permalink name you can mistake . I have the girls portfolio in wordpress - portfolio=pages x jobs in clubs offers=posts , I would like the girls portfolios to be easily findable by ID(s) , if possible the same for the posts=jobs in clubs The best solution little 4-5numeric input and send=go button in sidebar.php - index.php etc

    Read the article

  • How can I multiply each item in an array easily with PHP?

    - by Henry
    I have an array called $times. It is a list of small numbers (15,14,11,9,3,2). These will be user submitted and are supposed to be minutes. As PHP time works on seconds, I would like to multiply each element of my array by 60. I've been playing around with array_walk and array_map but I can't get those working :S Thanks.

    Read the article

  • Redirection in Rails

    - by Cyborgo
    Hi, I have a small question regarding rails. I have a search controller which searches for a name in database, if found shows the details about it or else I am redirecting to the new name page. Is there anyway after redirection that the name searched for to automatically appear in the new form page? Thanks in advance.

    Read the article

  • How a programmer should motivate himself ?

    - by Indigo Praveen
    Hi All, The question came into my mind because from last 2-3 months I am feeling a kind of bored in my job. Actually there is nothing happening in the project, I just have to create some class , properties and some small routines to do some functionality. I hope you guys must have gone through this phase as well in your career. Please share your experience how did you motivate yourself in this kind of situation ?

    Read the article

  • Why should I use "Web 2.0"-style URLs?

    - by hydrapheetz
    In short, why use something like http://stackoverflow.com/badges/6/supporter instead of something "simpler" (and subjectively, at that) like http://stackoverflow.com/badges/6/. Even on my own site I've just been using /post/6/ to reference posts (by IDs, even though I still store a slug.) Instead of /post/6/small-rant-on-urls, and in some cases, they can get even more absurd, much more so than is really necessary.

    Read the article

  • CSS: What is the proper way to deal with multiple classes of Text

    - by DavidR
    So I'm on commission for a website, and I'm trying to improve my code. When dealing with a website with multiple types of font (here it's large, there it's small, there it's bold, here it's underlined, etc.) is this where we use the h1-h6, or do we reserve those for times when there is a definite hierarchy, using instead <p class="xxx"> to define different classes for text?

    Read the article

  • MS Stack web host with HIPAA expertice?

    - by AndrewCr
    I'm a consultant, helping a provider of small medical practice management software move to the web. We're looking for a host that has experience with HIPAA-compliance, and supports the MS Web stack (IIS / .net / SQL Server) Can anyone here provide a recommendation of such a hosting company? Thanks, Andrew

    Read the article

  • Is it reasonable to use OpenGL for desktop applications?

    - by JamesK89
    I've been writing a small desktop gadget-type application that displays scrolling text along the bottom of the screen (Similar to the old CNN news ticker), however the performance of GDI is just unsatisfactory (As high as 8-12% on a quad core and 20% on a single core) even after I've attempted to clean out bottlenecks. I was considering using OpenGL instead to render everything, but I don't know if that is a reasonable option to require users to have hardware acceleration for a tiny app like this. Does anybody have any input on this?

    Read the article

  • ios App Disclaimer

    - by Max
    I am writing an application for iPhone and had some questions regarding eula :- If I do not include any disclaimer/ eula in my app, then would Apple's standard EULA http://www.apple.com/legal/internet-services/itunes/appstore/dev/stdeula/ automatically apply to my app ? If I include a small disclaimer inside my application (as a popup on initial screen), then would Apple's EULA still cover my app ? I tried downloading few apps on my ipad and did not see Apple's standard EULA. So, where can I actually see the EULA before downloading something ?

    Read the article

  • How to cast an NSDecimal value into an NSInteger value?

    - by mystify
    I have an situation where I get an NSDecimal, and I need an NSInteger. I do know it is a very small value (this is absolutely sure). It won't be bigger than 100. So It would be perfectly fine to cast it to NSInteger, no overflow would happen. How could this be done? There's just an -doubleValue method in NSDecimal.

    Read the article

  • Executing JavaScript with Python without X.

    - by Thomas
    I want to parse a html-page that unfortunately requires JavaScript to show any content. In order to do so I use a small python-script that pulls the html-code of the page, but after that I have to execute the JavaScript in a DOM-context which seems pretty hard. To make it even harder I want to use it in a server environment that has no X11-server. Note: I already read about http://code.google.com/p/pywebkitgtk/ but it seems to need a X-server.

    Read the article

  • NSString stringWithFormat question

    - by John Smith
    I am trying to build a small table using NSString. I cannot seem to format the strings properly. Here is what I have [NSString stringWithFormat:@"%8@: %.6f",e,v] where e is an NSString from somewhere else, and v is a float. What I want is output something like this: Grapes: 20.3 Pomegranates: 2.5 Oranges: 15.1 What I get is Grapes:20.3 Pomegranates:2.5 Oranges:15.1 How can I fix my format to do something like this?

    Read the article

  • Why won't the following haskell code compile?

    - by voxcogitatio
    I'm in the process of writing a small lisp interpreter in haskell. In the process i defined this datatype, to get a less typed number; data Number = _Int Integer | _Rational Rational | _Float Double deriving(Eq,Show) Compiling this fails with the following error: ERROR "types.hs":16 - Syntax error in data type declaration (unexpected `|') Line 16 is the line w. the first '|' in the code above.

    Read the article

  • Optimizing list comprehension to find pairs of co-prime numbers

    - by user3685422
    Given A,B print the number of pairs (a,b) such that GCD(a,b)=1 and 1<=a<=A and 1<=b<=B. Here is my answer: return len([(x,y) for x in range(1,A+1) for y in range(1,B+1) if gcd(x,y) == 1]) My answer works fine for small ranges but takes enough time if the range is increased. such as 1 <= A <= 10^5 1 <= B <= 10^5 is there a better way to write this or can this be optimized?

    Read the article

  • Bash: easy way to put a configurable load on a system?

    - by WizardOfOdds
    In order to test how a program reacts when system resources become scarce (mainly the CPU but I'm interested in disk I/O too), I'd like to put an arbitrary load on the system. Currently I'm doing something like this: #!/bin/bash while true do echo "a" >> a.txt md5 a.txt done I could also start mp3-encoding audio files, or whatever. What would be an easy and small Bash script that could be used to simulate an arbitrary load, ideally configurable using parameter(s)?

    Read the article

  • What is the recommended way to handle different user roles in a C# application?

    - by Sergio Tapia
    I'm going to make a small application for a business that will be used locally for scanning, and storing documents in a database located on the local machine or on a machine located in the same LAN. I could create a table called Users with username and password and according to the usertype ID show a form, or another form. But I'm more interested in the recommended approach by seasoned programmers. Any advice?

    Read the article

< Previous Page | 180 181 182 183 184 185 186 187 188 189 190 191  | Next Page >