Search Results

Search found 270542 results on 10822 pages for 'default stack size'.

Page 266/10822 | < Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >

• Can this way of storing typed objects be improved?

  - by Pindatjuh

  This is an "can it be improved"-question. Topic: Storing typed objects in memory. Background information: I'm building a compiler for the x86-32 Windows platform for my language. My goal includes typed objects. Idea: Every primitive is a semi-class (it can be used as if it was a normal class, but it's stored more compact). Every class is represented by primitives and some meta-data (containing class-properties, inheritance stuff, etc.). The meta-data is complex: it doesn't use fields but instead context-switches. For primitives, the meta-data is very small, compared to a "real" class, which is alot bigger. This enables another idea that "primitives are objects", in my language, which I found nessecairy. Example: If I have an array of 32 booleans, then the pure content of this array is exactly 4 byte (32 bits of booleans). The meta-data will contain flags that the type is an array of booleans, which contains 32 entries. The meta-data is very compacted, on bit-level: using a sort of "packing" mechanism, which is read by a FSM at runtime, when doing inspection of the type (like when passing the object to methods for checking, etc.) For instance (read from left to right, top to bottom, remember vertical position when going to the right, and check nearest column header for meaning of switch): Primitive? Array? Type-Meta 1 Byte? || Size (1 byte) 1 1 [...] 1 [...] done 0 2 Bytes? || Size (2 bytes) 1 [...] done || Size (4 bytes) 0 [...] done Integer? 1 Byte? 2 Bytes? 0 1 0 1 done 1 done 0 done Boolean? Byte? 0 1 0 done 1 done More-Primitives 0 .... Class-Stuff (Huge) 0 ... (After reaching done the data is inserted. || = byte alignment. [...] is variable sized. ... is not described here, for simplicity. And let's call them cost-based-data-structures.) For an array of 32 booleans containing all true values, the memory for this type would be (read top-down): 1 Primitive 1 Array 1 ArrayType: Primitive 0 Not-Array 0 Not-Integer 1 Boolean 0 Not-Byte (thus bit) 1 Integer Size: 1 Byte 00100000 Array size 01010101 01010101 01010101 01010101 Data (user defined) Thus, 8 bytes represent 32 booleans in an array: 11100101 00100000 01010101 01010101 01010101 01010101 How can I improve this? (Both performance- and memory-consumption wise)

  Read the article

• Basic shared memory program in C

  - by nicopuri

  Hi, I want to make a basic chat application in C using Shared memory. I am working in Linux. The application consist in writing the client and the server can read, and if the server write the client can read the message. I tried to do this, but I can't achieve the communication between client and server. The code is the following: Server.c int main(int argc, char **argv) { char *msg; static char buf[SIZE]; int n; msg = getmem(); memset(msg, 0, SIZE); initmutex(); while ( true ) { if( (n = read(0, buf, sizeof buf)) 0 ) { enter(); sprintf(msg, "%.*s", n, buf); printf("Servidor escribe: %s", msg); leave(); }else{ enter(); if ( strcmp(buf, msg) ) { printf("Servidor lee: %s", msg); strcpy(buf, msg); } leave(); sleep(1); } } return 0; } Client.c int main(int argc, char **argv) { char *msg; static char buf[SIZE-1]; int n; msg = getmem(); initmutex(); while(true) { if ( (n = read(0, buf, sizeof buf)) 0 ) { enter(); sprintf(msg, "%.*s", n, buf); printf("Cliente escribe: %s", msg); leave(); }else{ enter(); if ( strcmp(buf, msg) ) { printf("Cliente lee: %s", msg); strcpy(buf, msg); } leave(); sleep(1); } } printf("Cliente termina\n"); return 0; } The shared memory module is the folowing: #include "common.h" void fatal(char *s) { perror(s); exit(1); } char * getmem(void) { int fd; char *mem; if ( (fd = shm_open("/message", O_RDWR|O_CREAT, 0666)) == -1 ) fatal("sh_open"); ftruncate(fd, SIZE); if ( !(mem = mmap(NULL, SIZE, PROT_READ|PROT_WRITE, MAP_SHARED, fd, 0)) ) fatal("mmap"); close(fd); return mem; } static sem_t *sd; void initmutex(void) { if ( !(sd = sem_open("/mutex", O_RDWR|O_CREAT, 0666, 1)) ) fatal("sem_open"); } void enter(void) { sem_wait(sd); } void leave(void) { sem_post(sd); }

  Read the article

• Rails send mail with GMail

  - by Danny McClelland

  Hi Everyone, I am on rails 2.3.5 and have the latest Ruby installed and my application is running well, except, GMail emails. I am trying to setup my gmail imap connection which has worked previously but now doesnt want to know. This is my code: # Be sure to restart your server when you modify this file # Uncomment below to force Rails into production mode when # you don't control web/app server and can't set it the proper way # ENV['RAILS_ENV'] ||= 'production' # Specifies gem version of Rails to use when vendor/rails is not present RAILS_GEM_VERSION = '2.3.5' unless defined? RAILS_GEM_VERSION # Bootstrap the Rails environment, frameworks, and default configuration require File.join(File.dirname(__FILE__), 'boot') Rails::Initializer.run do |config| # Gems config.gem "capistrano-ext", :lib => "capistrano" config.gem "configatron" # Make Time.zone default to the specified zone, and make Active Record store time values # in the database in UTC, and return them converted to the specified local zone. config.time_zone = "London" # The internationalization framework can be changed to have another default locale (standard is :en) or more load paths. # All files from config/locales/*.rb,yml are added automatically. # config.i18n.load_path << Dir[File.join(RAILS_ROOT, 'my', 'locales', '*.{rb,yml}')] #config.i18n.default_locale = :de # Your secret key for verifying cookie session data integrity. # If you change this key, all old sessions will become invalid! # Make sure the secret is at least 30 characters and all random, # no regular words or you'll be exposed to dictionary attacks. config.action_controller.session = { :session_key => '_base_session', :secret => '7389ea9180b15f1495a5e73a69a893311f859ccff1ffd0fa2d7ea25fdf1fa324f280e6ba06e3e5ba612e71298d8fbe7f15fd7da2929c45a9c87fe226d2f77347' } config.active_record.observers = :user_observer end ActiveSupport::CoreExtensions::Date::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') ActiveSupport::CoreExtensions::Time::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') require "will_paginate" ActionMailer::Base.delivery_method = :smtp ActionMailer::Base.smtp_settings = { :enable_starttls_auto => true, :address => "smtp.gmail.com", :port => 587, :domain => "XXXXXXXX.XXX", :authentication => :plain, :user_name => "XXXXXXXXXX.XXXXXXXXXX.XXX", :password => "XXXXX" } But the above just results in an SMTP auth error in the production log. I have read varied reports of this not working in Rails 2.2.2 but nothing for 2.3.5, anyone got any ideas? Thanks, Danny

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Reason why UIImageView gives me a 'distorted' image sometimes

  - by Cedric Vandendriessche

  I have a custom UIView with a UILabel and a UIImageView subview. (tried using UIImageView subclass aswell). I assign an image to it and add the view to the screen. I wrote a function which adds the amount of LetterBoxes to the screen as there are letters in the word: - (void)drawBoxesForWord:(NSString *)word { if(boxesContainer == nil) { /* Create a container for the LetterBoxes (animation purposes) */ boxesContainer = [[UIView alloc] initWithFrame:CGRectMake(0, 205, 320, 50)]; [self.view addSubview:boxesContainer]; } /* Calculate width of letterboxes */ NSInteger numberOfCharacters = [word length]; CGFloat totalWidth = numberOfCharacters * 28 + (numberOfCharacters - 1) * 3; CGFloat leftCap = (320 - totalWidth) / 2; [letters removeAllObjects]; /* Draw the boxes to the screen */ for (int i = 0; i < numberOfCharacters; i++) { LetterBox *letter = [[LetterBox alloc] initWithFrame:CGRectMake(leftCap + i * 31 , 0, 28, 40)]; [letters addObject:letter]; [boxesContainer addSubview:letter]; [letter release]; }} This gives me the image below: http://www.imgdumper.nl/uploads2/4ba3b2c72bb99/4ba3b2c72abfd-Goed.png But sometimes it gives me this: imgdumper.nl/uploads2/4ba3b2d888226/4ba3b2d88728a-Fout.png I add them to the same boxesContainer but they first remove themselves from the superview, so it's not like you see them double or something. What I find weird is that they are all good or all bad.. This is the init function for my LetterBox: if (self == [super initWithFrame:aRect]) { /* Create the box image with same frame */ boxImage = [[UIImageView alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; boxImage.contentMode = UIViewContentModeScaleAspectFit; boxImage.image = [UIImage imageNamed:@"SpaceOpen.png"]; [self addSubview:boxImage]; /* Create the label with same frame */ letterLabel = [[UILabel alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; letterLabel.backgroundColor = [UIColor clearColor]; letterLabel.font = [UIFont fontWithName:@"ArialRoundedMTBold" size:26]; letterLabel.textColor = [UIColor blackColor]; letterLabel.textAlignment = UITextAlignmentCenter; [self addSubview:letterLabel]; } return self;} Does anyone have an idea why this could be? I'd rather have them display correctly every time :)

  Read the article

• Combining FileStream and MemoryStream to avoid disk accesses/paging while receiving gigabytes of data?

  - by w128

  I'm receiving a file as a stream of byte[] data packets (total size isn't known in advance) that I need to store somewhere before processing it immediately after it's been received (I can't do the processing on the fly). Total received file size can vary from as small as 10 KB to over 4 GB. One option for storing the received data is to use a MemoryStream, i.e. a sequence of MemoryStream.Write(bufferReceived, 0, count) calls to store the received packets. This is very simple, but obviously will result in out of memory exception for large files. An alternative option is to use a FileStream, i.e. FileStream.Write(bufferReceived, 0, count). This way, no out of memory exceptions will occur, but what I'm unsure about is bad performance due to disk writes (which I don't want to occur as long as plenty of memory is still available) - I'd like to avoid disk access as much as possible, but I don't know of a way to control this. I did some testing and most of the time, there seems to be little performance difference between say 10 000 consecutive calls of MemoryStream.Write() vs FileStream.Write(), but a lot seems to depend on buffer size and the total amount of data in question (i.e the number of writes). Obviously, MemoryStream size reallocation is also a factor. Does it make sense to use a combination of MemoryStream and FileStream, i.e. write to memory stream by default, but once the total amount of data received is over e.g. 500 MB, write it to FileStream; then, read in chunks from both streams for processing the received data (first process 500 MB from the MemoryStream, dispose it, then read from FileStream)? Another solution is to use a custom memory stream implementation that doesn't require continuous address space for internal array allocation (i.e. a linked list of memory streams); this way, at least on 64-bit environments, out of memory exceptions should no longer be an issue. Con: extra work, more room for mistakes. So how do FileStream vs MemoryStream read/writes behave in terms of disk access and memory caching, i.e. data size/performance balance. I would expect that as long as enough RAM is available, FileStream would internally read/write from memory (cache) anyway, and virtual memory would take care of the rest. But I don't know how often FileStream will explicitly access a disk when being written to. Any help would be appreciated.

  Read the article

• Issue accessing class variable from thread.

  - by James

  Hello, The code below is meant to take an arraylist of product objects as an input, spun thread for each product(and add the product to the arraylist 'products'), check product image(product.imageURL) availability, remove the products without images(remove the product from the arraylist 'products'), and return an arraylist of products with image available. package com.catgen.thread; import java.util.ArrayList; import java.util.Iterator; import java.util.List; import com.catgen.Product; import com.catgen.Utils; public class ProductFilterThread extends Thread{ private Product product; private List<Product> products = new ArrayList<Product>(); public ProductFilterThread(){ } public ProductFilterThread(Product product){ this.product = product; } public synchronized void addProduct(Product product){ System.out.println("Before add: "+getProducts().size()); getProducts().add(product); System.out.println("After add: "+getProducts().size()); } public synchronized void removeProduct(Product product){ System.out.println("Before rem: "+getProducts().size()); getProducts().remove(product); System.out.println("After rem: "+getProducts().size()); } public synchronized List<Product> getProducts(){ return this.products; } public synchronized void setProducts(List<Product> products){ this.products = products; } public void run(){ boolean imageExists = Utils.fileExists(this.product.ImageURL); if(!imageExists){ System.out.println(this.product.ImageURL); removeProduct(this.product); } } public List<Product> getProductsWithImageOnly(List<Product> products){ ProductFilterThread pft = null; try{ List<ProductFilterThread> threads = new ArrayList<ProductFilterThread>(); for(Product product: products){ pft = new ProductFilterThread(product); addProduct(product); pft.start(); threads.add(pft); } Iterator<ProductFilterThread> threadsIter = threads.iterator(); while(threadsIter.hasNext()){ ProductFilterThread thread = threadsIter.next(); thread.join(); } }catch(Exception e){ e.printStackTrace(); } System.out.println("Total returned products = "+getProducts().size()); return getProducts(); } } Calling statement: displayProducts = new ProductFilterThread().getProductsWithImageOnly(displayProducts); Here, when addProduct(product) is called from within getProductsWithImageOnly(), getProducts() returns the list of products, but that's not the case(no products are returned) when the method removeProduct() is called by a thread, because of which the products without images are never removed. As a result, all the products are returned by the module whether or not the contained products have images. What can be the problem here? Thanks in advance. James.

  Read the article

• synchronized in java - Proper use

  - by ZoharYosef

  I'm building a simple program to use in multi processes (Threads). My question is more to understand - when I have to use a reserved word synchronized? Do I need to use this word in any method that affects the bone variables? I know I can put it on any method that is not static, but I want to understand more. thank you! here is the code: public class Container { // *** data members *** public static final int INIT_SIZE=10; // the first (init) size of the set. public static final int RESCALE=10; // the re-scale factor of this set. private int _sp=0; public Object[] _data; /************ Constructors ************/ public Container(){ _sp=0; _data = new Object[INIT_SIZE]; } public Container(Container other) { // copy constructor this(); for(int i=0;i<other.size();i++) this.add(other.at(i)); } /** return true is this collection is empty, else return false. */ public synchronized boolean isEmpty() {return _sp==0;} /** add an Object to this set */ public synchronized void add (Object p){ if (_sp==_data.length) rescale(RESCALE); _data[_sp] = p; // shellow copy semantic. _sp++; } /** returns the actual amount of Objects contained in this collection */ public synchronized int size() {return _sp;} /** returns true if this container contains an element which is equals to ob */ public synchronized boolean isMember(Object ob) { return get(ob)!=-1; } /** return the index of the first object which equals ob, if none returns -1 */ public synchronized int get(Object ob) { int ans=-1; for(int i=0;i<size();i=i+1) if(at(i).equals(ob)) return i; return ans; } /** returns the element located at the ind place in this container (null if out of range) */ public synchronized Object at(int p){ if (p>=0 && p<size()) return _data[p]; else return null; }

  Read the article

• Can't iterate over nestled dict in django

  - by fredrik

  Hi, Im trying to iterate over a nestled dict list. The first level works fine. But the second level is treated like a string not dict. In my template I have this: {% for product in Products %} <li> <p>{{ product }}</p> {% for partType in product.parts %} <p>{{ partType }}</p> {% for part in partType %} <p>{{ part }}</p> {% endfor %} {% endfor %} </li> {% endfor %} It's the {{ part }} that just list 1 char at the time based on partType. And it seams that it's treated like a string. I can however via dot notation reach all dict but not with a for loop. The current output looks like this: Color C o l o r Style S ..... The Products object looks like this in the log: [{'product': <models.Products.Product object at 0x1076ac9d0>, 'parts': {u'Color': {'default': u'Red', 'optional': [u'Red', u'Blue']}, u'Style': {'default': u'Nice', 'optional': [u'Nice']}, u'Size': {'default': u'8', 'optional': [u'8', u'8.5']}}}] What I trying to do is to pair together a dict/list for a product from a number of different SQL queries. The web handler looks like this: typeData = Products.ProductPartTypes.all() productData = Products.Product.all() langCode = 'en' productList = [] for product in productData: typeDict = {} productDict = {} for type in typeData: typeDict[type.typeId] = { 'default' : '', 'optional' : [] } productDict['product'] = product productDict['parts'] = typeDict defaultPartsData = Products.ProductParts.gql('WHERE __key__ IN :key', key = product.defaultParts) optionalPartsData = Products.ProductParts.gql('WHERE __key__ IN :key', key = product.optionalParts) for defaultPart in defaultPartsData: label = Products.ProductPartLabels.gql('WHERE __key__ IN :key AND partLangCode = :langCode', key = defaultPart.partLabelList, langCode = langCode).get() productDict['parts'][defaultPart.type.typeId]['default'] = label.partLangLabel for optionalPart in optionalPartsData: label = Products.ProductPartLabels.gql('WHERE __key__ IN :key AND partLangCode = :langCode', key = optionalPart.partLabelList, langCode = langCode).get() productDict['parts'][optionalPart.type.typeId]['optional'].append(label.partLangLabel) productList.append(productDict) logging.info(productList) templateData = { 'Languages' : Settings.Languges.all().order('langCode'), 'ProductPartTypes' : typeData, 'Products' : productList } I've tried making the dict in a number of different ways. Like first making a list, then a dict, used tulpes anything I could think of. Any help is welcome! Bouns: If someone have an other approach to the SQL quires, that is more then welcome. I feel that it kinda stupid to run that amount of quires. What is happening that each product part has a different label base on langCode. ..fredrik

  Read the article

• curl problems in c++ class

  - by Danilo

  I read a few articles on c++ / curl here on stackoverflow and assembled the following. The main goal is to handle the whole request in an instance of a class -- and maybe later in a secondary thread. My problem is: "content_" seems to stay empty though its the same addr and HttpFetch.h: class HttpFetch { private: CURL *curl; static size_t handle(char * data, size_t size, size_t nmemb, void * p); size_t handle_impl(char * data, size_t size, size_t nmemb); public: std::string content_; static std::string url_; HttpFetch(std::string url); void start(); std::string data(); }; HttpFetch.cpp: HttpFetch::HttpFetch(std::string url) { curl_global_init(CURL_GLOBAL_ALL); //pretty obvious curl = curl_easy_init(); content_.append("Test"); std::cout << &content_ << "\n"; curl_easy_setopt(curl, CURLOPT_URL, &url); curl_easy_setopt(curl, CURLOPT_WRITEDATA, &content_); curl_easy_setopt(curl, CURLOPT_WRITEFUNCTION, &HttpFetch::handle); //curl_easy_setopt(curl, CURLOPT_VERBOSE, 1L); //tell curl to output its progress curl_easy_setopt(curl, CURLOPT_FOLLOWLOCATION, 1L); //std::cout << &content_ << "\n"; } void HttpFetch::start() { curl_easy_perform(curl); curl_easy_cleanup(curl); } size_t HttpFetch::handle(char * data, size_t size, size_t nmemb, void * p) { std::string *stuff = reinterpret_cast<std::string*>(p); stuff->append(data, size * nmemb); std::cout << stuff << "\n"; // has content from data in it! return size * nmemb; } main.cpp: #include "HttpFetch.h" int main(int argc, const char * argv[]) { HttpFetch call = *new HttpFetch("http://www.example.com"); call.start(); ::std::cout << call.content_ << "\n" } Thanks in advance

  Read the article

• Reason why UIImage gives me a 'distorted' image sometimes

  - by Cedric Vandendriessche

  I have a custom UIView with a UILabel and a UIImageView subview. (tried using UIImageView subclass aswell). I assign an image to it and add the view to the screen. I wrote a function which adds the amount of LetterBoxes to the screen (my custom class): - (void)drawBoxesForWord:(NSString *)word { if(boxesContainer == nil) { /* Create a container for the LetterBoxes (animation purposes) */ boxesContainer = [[UIView alloc] initWithFrame:CGRectMake(0, 205, 320, 50)]; [self.view addSubview:boxesContainer]; } /* Calculate width of letterboxes */ NSInteger numberOfCharacters = [word length]; CGFloat totalWidth = numberOfCharacters * 28 + (numberOfCharacters - 1) * 3; CGFloat leftCap = (320 - totalWidth) / 2; [letters removeAllObjects]; /* Draw the boxes to the screen */ for (int i = 0; i < numberOfCharacters; i++) { LetterBox *letter = [[LetterBox alloc] initWithFrame:CGRectMake(leftCap + i * 31 , 0, 28, 40)]; [letters addObject:letter]; [boxesContainer addSubview:letter]; [letter release]; }} This gives me the image below: http://www.imgdumper.nl/uploads2/4ba3b2c72bb99/4ba3b2c72abfd-Goed.png But sometimes it gives me this: imgdumper.nl/uploads2/4ba3b2d888226/4ba3b2d88728a-Fout.png I add them to the same boxesContainer but they first remove themselves from the superview, so it's not like you see them double or something. What I find weird is that they are all good or all bad.. This is the init function for my LetterBox: if (self == [super initWithFrame:aRect]) { /* Create the box image with same frame */ boxImage = [[UIImageView alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; boxImage.contentMode = UIViewContentModeScaleAspectFit; boxImage.image = [UIImage imageNamed:@"SpaceOpen.png"]; [self addSubview:boxImage]; /* Create the label with same frame */ letterLabel = [[UILabel alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; letterLabel.backgroundColor = [UIColor clearColor]; letterLabel.font = [UIFont fontWithName:@"ArialRoundedMTBold" size:26]; letterLabel.textColor = [UIColor blackColor]; letterLabel.textAlignment = UITextAlignmentCenter; [self addSubview:letterLabel]; } return self;} Does anyone have an idea why this could be? I'd rather have them display correctly every time :)

  Read the article

• CUDA memory transfer issue

  - by Vaibhav Sundriyal

  I am trying to execute a code which first transfers data from CPU to GPU memory and vice-versa. In spite of increasing the volume of data, the data transfer time remains the same as if no data transfer is actually taking place. I am posting the code. #include <stdio.h> /* Core input/output operations */ #include <stdlib.h> /* Conversions, random numbers, memory allocation, etc. */ #include <math.h> /* Common mathematical functions */ #include <time.h> /* Converting between various date/time formats */ #include <cuda.h> /* CUDA related stuff */ #include <sys/time.h> __global__ void device_volume(float *x_d,float *y_d) { int index = blockIdx.x * blockDim.x + threadIdx.x; } int main(void) { float *x_h,*y_h,*x_d,*y_d,*z_h,*z_d; long long size=9999999; long long nbytes=size*sizeof(float); timeval t1,t2; double et; x_h=(float*)malloc(nbytes); y_h=(float*)malloc(nbytes); z_h=(float*)malloc(nbytes); cudaMalloc((void **)&x_d,size*sizeof(float)); cudaMalloc((void **)&y_d,size*sizeof(float)); cudaMalloc((void **)&z_d,size*sizeof(float)); gettimeofday(&t1,NULL); cudaMemcpy(x_d, x_h, nbytes, cudaMemcpyHostToDevice); cudaMemcpy(y_d, y_h, nbytes, cudaMemcpyHostToDevice); cudaMemcpy(z_d, z_h, nbytes, cudaMemcpyHostToDevice); gettimeofday(&t2,NULL); et = (t2.tv_sec - t1.tv_sec) * 1000.0; // sec to ms et += (t2.tv_usec - t1.tv_usec) / 1000.0; // us to ms printf("\n %ld\t\t%f\t\t",nbytes,et); et=0.0; //printf("%f %d\n",seconds,CLOCKS_PER_SEC); // launch a kernel with a single thread to greet from the device //device_volume<<<1,1>>>(x_d,y_d); gettimeofday(&t1,NULL); cudaMemcpy(x_h, x_d, nbytes, cudaMemcpyDeviceToHost); cudaMemcpy(y_h, y_d, nbytes, cudaMemcpyDeviceToHost); cudaMemcpy(z_h, z_d, nbytes, cudaMemcpyDeviceToHost); gettimeofday(&t2,NULL); et = (t2.tv_sec - t1.tv_sec) * 1000.0; // sec to ms et += (t2.tv_usec - t1.tv_usec) / 1000.0; // us to ms printf("%f\n",et); cudaFree(x_d); cudaFree(y_d); cudaFree(z_d); return 0; } Can anybody help me with this issue? Thanks

  Read the article

• What's New in ASP.NET 4

  - by Navaneeth

  The .NET Framework version 4 includes enhancements for ASP.NET 4 in targeted areas. Visual Studio 2010 and Microsoft Visual Web Developer Express also include enhancements and new features for improved Web development. This document provides an overview of many of the new features that are included in the upcoming release. This topic contains the following sections: ASP.NET Core Services ASP.NET Web Forms ASP.NET MVC Dynamic Data ASP.NET Chart Control Visual Web Developer Enhancements Web Application Deployment with Visual Studio 2010 Enhancements to ASP.NET Multi-Targeting ASP.NET Core Services ASP.NET 4 introduces many features that improve core ASP.NET services such as output caching and session state storage. Extensible Output Caching Since the time that ASP.NET 1.0 was released, output caching has enabled developers to store the generated output of pages, controls, and HTTP responses in memory. On subsequent Web requests, ASP.NET can serve content more quickly by retrieving the generated output from memory instead of regenerating the output from scratch. However, this approach has a limitation — generated content always has to be stored in memory. On servers that experience heavy traffic, the memory requirements for output caching can compete with memory requirements for other parts of a Web application. ASP.NET 4 adds extensibility to output caching that enables you to configure one or more custom output-cache providers. Output-cache providers can use any storage mechanism to persist HTML content. These storage options can include local or remote disks, cloud storage, and distributed cache engines. Output-cache provider extensibility in ASP.NET 4 lets you design more aggressive and more intelligent output-caching strategies for Web sites. For example, you can create an output-cache provider that caches the "Top 10" pages of a site in memory, while caching pages that get lower traffic on disk. Alternatively, you can cache every vary-by combination for a rendered page, but use a distributed cache so that the memory consumption is offloaded from front-end Web servers. You create a custom output-cache provider as a class that derives from the OutputCacheProvider type. You can then configure the provider in the Web.config file by using the new providers subsection of the outputCache element For more information and for examples that show how to configure the output cache, see outputCache Element for caching (ASP.NET Settings Schema). For more information about the classes that support caching, see the documentation for the OutputCache and OutputCacheProvider classes. By default, in ASP.NET 4, all HTTP responses, rendered pages, and controls use the in-memory output cache. The defaultProvider attribute for ASP.NET is AspNetInternalProvider. You can change the default output-cache provider used for a Web application by specifying a different provider name for defaultProvider attribute. In addition, you can select different output-cache providers for individual control and for individual requests and programmatically specify which provider to use. For more information, see the HttpApplication.GetOutputCacheProviderName(HttpContext) method. The easiest way to choose a different output-cache provider for different Web user controls is to do so declaratively by using the new providerName attribute in a page or control directive, as shown in the following example: <%@ OutputCache Duration="60" VaryByParam="None" providerName="DiskCache" %> Preloading Web Applications Some Web applications must load large amounts of data or must perform expensive initialization processing before serving the first request. In earlier versions of ASP.NET, for these situations you had to devise custom approaches to "wake up" an ASP.NET application and then run initialization code during the Application_Load method in the Global.asax file. To address this scenario, a new application preload manager (autostart feature) is available when ASP.NET 4 runs on IIS 7.5 on Windows Server 2008 R2. The preload feature provides a controlled approach for starting up an application pool, initializing an ASP.NET application, and then accepting HTTP requests. It lets you perform expensive application initialization prior to processing the first HTTP request. For example, you can use the application preload manager to initialize an application and then signal a load-balancer that the application was initialized and ready to accept HTTP traffic. To use the application preload manager, an IIS administrator sets an application pool in IIS 7.5 to be automatically started by using the following configuration in the applicationHost.config file: <applicationPools> <add name="MyApplicationPool" startMode="AlwaysRunning" /> </applicationPools> Because a single application pool can contain multiple applications, you specify individual applications to be automatically started by using the following configuration in the applicationHost.config file: <sites> <site name="MySite" id="1"> <application path="/" serviceAutoStartEnabled="true" serviceAutoStartProvider="PrewarmMyCache" > <!-- Additional content --> </application> </site> </sites> <!-- Additional content --> <serviceAutoStartProviders> <add name="PrewarmMyCache" type="MyNamespace.CustomInitialization, MyLibrary" /> </serviceAutoStartProviders> When an IIS 7.5 server is cold-started or when an individual application pool is recycled, IIS 7.5 uses the information in the applicationHost.config file to determine which Web applications have to be automatically started. For each application that is marked for preload, IIS7.5 sends a request to ASP.NET 4 to start the application in a state during which the application temporarily does not accept HTTP requests. When it is in this state, ASP.NET instantiates the type defined by the serviceAutoStartProvider attribute (as shown in the previous example) and calls into its public entry point. You create a managed preload type that has the required entry point by implementing the IProcessHostPreloadClient interface, as shown in the following example: public class CustomInitialization : System.Web.Hosting.IProcessHostPreloadClient { public void Preload(string[] parameters) { // Perform initialization. } } After your initialization code runs in the Preload method and after the method returns, the ASP.NET application is ready to process requests. Permanently Redirecting a Page Content in Web applications is often moved over the lifetime of the application. This can lead to links to be out of date, such as the links that are returned by search engines. In ASP.NET, developers have traditionally handled requests to old URLs by using the Redirect method to forward a request to the new URL. However, the Redirect method issues an HTTP 302 (Found) response (which is used for a temporary redirect). This results in an extra HTTP round trip. ASP.NET 4 adds a RedirectPermanent helper method that makes it easy to issue HTTP 301 (Moved Permanently) responses, as in the following example: RedirectPermanent("/newpath/foroldcontent.aspx"); Search engines and other user agents that recognize permanent redirects will store the new URL that is associated with the content, which eliminates the unnecessary round trip made by the browser for temporary redirects. Session State Compression By default, ASP.NET provides two options for storing session state across a Web farm. The first option is a session state provider that invokes an out-of-process session state server. The second option is a session state provider that stores data in a Microsoft SQL Server database. Because both options store state information outside a Web application's worker process, session state has to be serialized before it is sent to remote storage. If a large amount of data is saved in session state, the size of the serialized data can become very large. ASP.NET 4 introduces a new compression option for both kinds of out-of-process session state providers. By using this option, applications that have spare CPU cycles on Web servers can achieve substantial reductions in the size of serialized session state data. You can set this option using the new compressionEnabled attribute of the sessionState element in the configuration file. When the compressionEnabled configuration option is set to true, ASP.NET compresses (and decompresses) serialized session state by using the .NET Framework GZipStreamclass. The following example shows how to set this attribute. <sessionState mode="SqlServer" sqlConnectionString="data source=dbserver;Initial Catalog=aspnetstate" allowCustomSqlDatabase="true" compressionEnabled="true" /> ASP.NET Web Forms Web Forms has been a core feature in ASP.NET since the release of ASP.NET 1.0. Many enhancements have been in this area for ASP.NET 4, such as the following: The ability to set meta tags. More control over view state. Support for recently introduced browsers and devices. Easier ways to work with browser capabilities. Support for using ASP.NET routing with Web Forms. More control over generated IDs. The ability to persist selected rows in data controls. More control over rendered HTML in the FormView and ListView controls. Filtering support for data source controls. Enhanced support for Web standards and accessibility Setting Meta Tags with the Page.MetaKeywords and Page.MetaDescription Properties Two properties have been added to the Page class: MetaKeywords and MetaDescription. These two properties represent corresponding meta tags in the HTML rendered for a page, as shown in the following example: <head id="Head1" runat="server"> <title>Untitled Page</title> <meta name="keywords" content="keyword1, keyword2' /> <meta name="description" content="Description of my page" /> </head> These two properties work like the Title property does, and they can be set in the @ Page directive. For more information, see Page.MetaKeywords and Page.MetaDescription. Enabling View State for Individual Controls A new property has been added to the Control class: ViewStateMode. You can use this property to disable view state for all controls on a page except those for which you explicitly enable view state. View state data is included in a page's HTML and increases the amount of time it takes to send a page to the client and post it back. Storing more view state than is necessary can cause significant decrease in performance. In earlier versions of ASP.NET, you could reduce the impact of view state on a page's performance by disabling view state for specific controls. But sometimes it is easier to enable view state for a few controls that need it instead of disabling it for many that do not need it. For more information, see Control.ViewStateMode. Support for Recently Introduced Browsers and Devices ASP.NET includes a feature that is named browser capabilities that lets you determine the capabilities of the browser that a user is using. Browser capabilities are represented by the HttpBrowserCapabilities object which is stored in the HttpRequest.Browser property. Information about a particular browser's capabilities is defined by a browser definition file. In ASP.NET 4, these browser definition files have been updated to contain information about recently introduced browsers and devices such as Google Chrome, Research in Motion BlackBerry smart phones, and Apple iPhone. Existing browser definition files have also been updated. For more information, see How to: Upgrade an ASP.NET Web Application to ASP.NET 4 and ASP.NET Web Server Controls and Browser Capabilities. The browser definition files that are included with ASP.NET 4 are shown in the following list: •blackberry.browser •chrome.browser •Default.browser •firefox.browser •gateway.browser •generic.browser •ie.browser •iemobile.browser •iphone.browser •opera.browser •safari.browser A New Way to Define Browser Capabilities ASP.NET 4 includes a new feature referred to as browser capabilities providers. As the name suggests, this lets you build a provider that in turn lets you write custom code to determine browser capabilities. In ASP.NET version 3.5 Service Pack 1, you define browser capabilities in an XML file. This file resides in a machine-level folder or an application-level folder. Most developers do not need to customize these files, but for those who do, the provider approach can be easier than dealing with complex XML syntax. The provider approach makes it possible to simplify the process by implementing a common browser definition syntax, or a database that contains up-to-date browser definitions, or even a Web service for such a database. For more information about the new browser capabilities provider, see the What's New for ASP.NET 4 White Paper. Routing in ASP.NET 4 ASP.NET 4 adds built-in support for routing with Web Forms. Routing is a feature that was introduced with ASP.NET 3.5 SP1 and lets you configure an application to use URLs that are meaningful to users and to search engines because they do not have to specify physical file names. This can make your site more user-friendly and your site content more discoverable by search engines. For example, the URL for a page that displays product categories in your application might look like the following example: http://website/products.aspx?categoryid=12 By using routing, you can use the following URL to render the same information: http://website/products/software The second URL lets the user know what to expect and can result in significantly improved rankings in search engine results. the new features include the following: The PageRouteHandler class is a simple HTTP handler that you use when you define routes. You no longer have to write a custom route handler. The HttpRequest.RequestContext and Page.RouteData properties make it easier to access information that is passed in URL parameters. The RouteUrl expression provides a simple way to create a routed URL in markup. The RouteValue expression provides a simple way to extract URL parameter values in markup. The RouteParameter class makes it easier to pass URL parameter values to a query for a data source control (similar to FormParameter). You no longer have to change the Web.config file to enable routing. For more information about routing, see the following topics: ASP.NET Routing Walkthrough: Using ASP.NET Routing in a Web Forms Application How to: Define Routes for Web Forms Applications How to: Construct URLs from Routes How to: Access URL Parameters in a Routed Page Setting Client IDs The new ClientIDMode property makes it easier to write client script that references HTML elements rendered for server controls. Increasing use of Microsoft Ajax makes the need to do this more common. For example, you may have a data control that renders a long list of products with prices and you want to use client script to make a Web service call and update individual prices in the list as they change without refreshing the entire page. Typically you get a reference to an HTML element in client script by using the document.GetElementById method. You pass to this method the value of the id attribute of the HTML element you want to reference. In the case of elements that are rendered for ASP.NET server controls earlier versions of ASP.NET could make this difficult or impossible. You were not always able to predict what id values ASP.NET would generate, or ASP.NET could generate very long id values. The problem was especially difficult for data controls that would generate multiple rows for a single instance of the control in your markup. ASP.NET 4 adds two new algorithms for generating id attributes. These algorithms can generate id attributes that are easier to work with in client script because they are more predictable and that are easier to work with because they are simpler. For more information about how to use the new algorithms, see the following topics: ASP.NET Web Server Control Identification Walkthrough: Making Data-Bound Controls Easier to Access from JavaScript Walkthrough: Making Controls Located in Web User Controls Easier to Access from JavaScript How to: Access Controls from JavaScript by ID Persisting Row Selection in Data Controls The GridView and ListView controls enable users to select a row. In previous versions of ASP.NET, row selection was based on the row index on the page. For example, if you select the third item on page 1 and then move to page 2, the third item on page 2 is selected. In most cases, is more desirable not to select any rows on page 2. ASP.NET 4 supports Persisted Selection, a new feature that was initially supported only in Dynamic Data projects in the .NET Framework 3.5 SP1. When this feature is enabled, the selected item is based on the row data key. This means that if you select the third row on page 1 and move to page 2, nothing is selected on page 2. When you move back to page 1, the third row is still selected. This is a much more natural behavior than the behavior in earlier versions of ASP.NET. Persisted selection is now supported for the GridView and ListView controls in all projects. You can enable this feature in the GridView control, for example, by setting the EnablePersistedSelection property, as shown in the following example: <asp:GridView id="GridView2" runat="server" PersistedSelection="true"> </asp:GridView> FormView Control Enhancements The FormView control is enhanced to make it easier to style the content of the control with CSS. In previous versions of ASP.NET, the FormView control rendered it contents using an item template. This made styling more difficult in the markup because unexpected table row and table cell tags were rendered by the control. The FormView control supports RenderOuterTable, a property in ASP.NET 4. When this property is set to false, as show in the following example, the table tags are not rendered. This makes it easier to apply CSS style to the contents of the control. <asp:FormView ID="FormView1" runat="server" RenderTable="false"> For more information, see FormView Web Server Control Overview. ListView Control Enhancements The ListView control, which was introduced in ASP.NET 3.5, has all the functionality of the GridView control while giving you complete control over the output. This control has been made easier to use in ASP.NET 4. The earlier version of the control required that you specify a layout template that contained a server control with a known ID. The following markup shows a typical example of how to use the ListView control in ASP.NET 3.5. <asp:ListView ID="ListView1" runat="server"> <LayoutTemplate> <asp:PlaceHolder ID="ItemPlaceHolder" runat="server"></asp:PlaceHolder> </LayoutTemplate> <ItemTemplate> <% Eval("LastName")%> </ItemTemplate> </asp:ListView> In ASP.NET 4, the ListView control does not require a layout template. The markup shown in the previous example can be replaced with the following markup: <asp:ListView ID="ListView1" runat="server"> <ItemTemplate> <% Eval("LastName")%> </ItemTemplate> </asp:ListView> For more information, see ListView Web Server Control Overview. Filtering Data with the QueryExtender Control A very common task for developers who create data-driven Web pages is to filter data. This traditionally has been performed by building Where clauses in data source controls. This approach can be complicated, and in some cases the Where syntax does not let you take advantage of the full functionality of the underlying database. To make filtering easier, a new QueryExtender control has been added in ASP.NET 4. This control can be added to EntityDataSource or LinqDataSource controls in order to filter the data returned by these controls. Because the QueryExtender control relies on LINQ, but you do not to need to know how to write LINQ queries to use the query extender. The QueryExtender control supports a variety of filter options. The following lists QueryExtender filter options. Term Definition SearchExpression Searches a field or fields for string values and compares them to a specified string value. RangeExpression Searches a field or fields for values in a range specified by a pair of values. PropertyExpression Compares a specified value to a property value in a field. If the expression evaluates to true, the data that is being examined is returned. OrderByExpression Sorts data by a specified column and sort direction. CustomExpression Calls a function that defines custom filter in the page. For more information, see QueryExtenderQueryExtender Web Server Control Overview. Enhanced Support for Web Standards and Accessibility Earlier versions of ASP.NET controls sometimes render markup that does not conform to HTML, XHTML, or accessibility standards. ASP.NET 4 eliminates most of these exceptions. For details about how the HTML that is rendered by each control meets accessibility standards, see ASP.NET Controls and Accessibility. CSS for Controls that Can be Disabled In ASP.NET 3.5, when a control is disabled (see WebControl.Enabled), a disabled attribute is added to the rendered HTML element. For example, the following markup creates a Label control that is disabled: <asp:Label id="Label1" runat="server"   Text="Test" Enabled="false" /> In ASP.NET 3.5, the previous control settings generate the following HTML: <span id="Label1" disabled="disabled">Test</span> In HTML 4.01, the disabled attribute is not considered valid on span elements. It is valid only on input elements because it specifies that they cannot be accessed. On display-only elements such as span elements, browsers typically support rendering for a disabled appearance, but a Web page that relies on this non-standard behavior is not robust according to accessibility standards. For display-only elements, you should use CSS to indicate a disabled visual appearance. Therefore, by default ASP.NET 4 generates the following HTML for the control settings shown previously: <span id="Label1" class="aspNetDisabled">Test</span> You can change the value of the class attribute that is rendered by default when a control is disabled by setting the DisabledCssClass property. CSS for Validation Controls In ASP.NET 3.5, validation controls render a default color of red as an inline style. For example, the following markup creates a RequiredFieldValidator control: <asp:RequiredFieldValidator ID="RequiredFieldValidator1" runat="server"   ErrorMessage="Required Field" ControlToValidate="RadioButtonList1" /> ASP.NET 3.5 renders the following HTML for the validator control: <span id="RequiredFieldValidator1"   style="color:Red;visibility:hidden;">RequiredFieldValidator</span> By default, ASP.NET 4 does not render an inline style to set the color to red. An inline style is used only to hide or show the validator, as shown in the following example: <span id="RequiredFieldValidator1"   style"visibility:hidden;">RequiredFieldValidator</span> Therefore, ASP.NET 4 does not automatically show error messages in red. For information about how to use CSS to specify a visual style for a validation control, see Validating User Input in ASP.NET Web Pages. CSS for the Hidden Fields Div Element ASP.NET uses hidden fields to store state information such as view state and control state. These hidden fields are contained by a div element. In ASP.NET 3.5, this div element does not have a class attribute or an id attribute. Therefore, CSS rules that affect all div elements could unintentionally cause this div to be visible. To avoid this problem, ASP.NET 4 renders the div element for hidden fields with a CSS class that you can use to differentiate the hidden fields div from others. The new classvalue is shown in the following example: <div class="aspNetHidden"> CSS for the Table, Image, and ImageButton Controls By default, in ASP.NET 3.5, some controls set the border attribute of rendered HTML to zero (0). The following example shows HTML that is generated by the Table control in ASP.NET 3.5: <table id="Table2" border="0"> The Image control and the ImageButton control also do this. Because this is not necessary and provides visual formatting information that should be provided by using CSS, the attribute is not generated in ASP.NET 4. CSS for the UpdatePanel and UpdateProgress Controls In ASP.NET 3.5, the UpdatePanel and UpdateProgress controls do not support expando attributes. This makes it impossible to set a CSS class on the HTMLelements that they render. In ASP.NET 4 these controls have been changed to accept expando attributes, as shown in the following example: <asp:UpdatePanel runat="server" class="myStyle"> </asp:UpdatePanel> The following HTML is rendered for this markup: <div id="ctl00_MainContent_UpdatePanel1" class="expandoclass"> </div> Eliminating Unnecessary Outer Tables In ASP.NET 3.5, the HTML that is rendered for the following controls is wrapped in a table element whose purpose is to apply inline styles to the entire control: FormView Login PasswordRecovery ChangePassword If you use templates to customize the appearance of these controls, you can specify CSS styles in the markup that you provide in the templates. In that case, no extra outer table is required. In ASP.NET 4, you can prevent the table from being rendered by setting the new RenderOuterTable property to false. Layout Templates for Wizard Controls In ASP.NET 3.5, the Wizard and CreateUserWizard controls generate an HTML table element that is used for visual formatting. In ASP.NET 4 you can use a LayoutTemplate element to specify the layout. If you do this, the HTML table element is not generated. In the template, you create placeholder controls to indicate where items should be dynamically inserted into the control. (This is similar to how the template model for the ListView control works.) For more information, see the Wizard.LayoutTemplate property. New HTML Formatting Options for the CheckBoxList and RadioButtonList Controls ASP.NET 3.5 uses HTML table elements to format the output for the CheckBoxList and RadioButtonList controls. To provide an alternative that does not use tables for visual formatting, ASP.NET 4 adds two new options to the RepeatLayout enumeration: UnorderedList. This option causes the HTML output to be formatted by using ul and li elements instead of a table. OrderedList. This option causes the HTML output to be formatted by using ol and li elements instead of a table. For examples of HTML that is rendered for the new options, see the RepeatLayout enumeration. Header and Footer Elements for the Table Control In ASP.NET 3.5, the Table control can be configured to render thead and tfoot elements by setting the TableSection property of the TableHeaderRow class and the TableFooterRow class. In ASP.NET 4 these properties are set to the appropriate values by default. CSS and ARIA Support for the Menu Control In ASP.NET 3.5, the Menu control uses HTML table elements for visual formatting, and in some configurations it is not keyboard-accessible. ASP.NET 4 addresses these problems and improves accessibility in the following ways: The generated HTML is structured as an unordered list (ul and li elements). CSS is used for visual formatting. The menu behaves in accordance with ARIA standards for keyboard access. You can use arrow keys to navigate menu items. (For information about ARIA, see Accessibility in Visual Studio and ASP.NET.) ARIA role and property attributes are added to the generated HTML. (Attributes are added by using JavaScript instead of included in the HTML, to avoid generating HTML that would cause markup validation errors.) Styles for the Menu control are rendered in a style block at the top of the page, instead of inline with the rendered HTML elements. If you want to use a separate CSS file so that you can modify the menu styles, you can set the Menu control's new IncludeStyleBlock property to false, in which case the style block is not generated. Valid XHTML for the HtmlForm Control In ASP.NET 3.5, the HtmlForm control (which is created implicitly by the <form runat="server"> tag) renders an HTML form element that has both name and id attributes. The name attribute is deprecated in XHTML 1.1. Therefore, this control does not render the name attribute in ASP.NET 4. Maintaining Backward Compatibility in Control Rendering An existing ASP.NET Web site might have code in it that assumes that controls are rendering HTML the way they do in ASP.NET 3.5. To avoid causing backward compatibility problems when you upgrade the site to ASP.NET 4, you can have ASP.NET continue to generate HTML the way it does in ASP.NET 3.5 after you upgrade the site. To do so, you can set the controlRenderingCompatibilityVersion attribute of the pages element to "3.5" in the Web.config file of an ASP.NET 4 Web site, as shown in the following example: <system.web>   <pages controlRenderingCompatibilityVersion="3.5"/> </system.web> If this setting is omitted, the default value is the same as the version of ASP.NET that the Web site targets. (For information about multi-targeting in ASP.NET, see .NET Framework Multi-Targeting for ASP.NET Web Projects.) ASP.NET MVC ASP.NET MVC helps Web developers build compelling standards-based Web sites that are easy to maintain because it decreases the dependency among application layers by using the Model-View-Controller (MVC) pattern. MVC provides complete control over the page markup. It also improves testability by inherently supporting Test Driven Development (TDD). Web sites created using ASP.NET MVC have a modular architecture. This allows members of a team to work independently on the various modules and can be used to improve collaboration. For example, developers can work on the model and controller layers (data and logic), while the designer work on the view (presentation). For tutorials, walkthroughs, conceptual content, code samples, and a complete API reference, see ASP.NET MVC 2. Dynamic Data Dynamic Data was introduced in the .NET Framework 3.5 SP1 release in mid-2008. This feature provides many enhancements for creating data-driven applications, such as the following: A RAD experience for quickly building a data-driven Web site. Automatic validation that is based on constraints defined in the data model. The ability to easily change the markup that is generated for fields in the GridView and DetailsView controls by using field templates that are part of your Dynamic Data project. For ASP.NET 4, Dynamic Data has been enhanced to give developers even more power for quickly building data-driven Web sites. For more information, see ASP.NET Dynamic Data Content Map. Enabling Dynamic Data for Individual Data-Bound Controls in Existing Web Applications You can use Dynamic Data features in existing ASP.NET Web applications that do not use scaffolding by enabling Dynamic Data for individual data-bound controls. Dynamic Data provides the presentation and data layer support for rendering these controls. When you enable Dynamic Data for data-bound controls, you get the following benefits: Setting default values for data fields. Dynamic Data enables you to provide default values at run time for fields in a data control. Interacting with the database without creating and registering a data model. Automatically validating the data that is entered by the user without writing any code. For more information, see Walkthrough: Enabling Dynamic Data in ASP.NET Data-Bound Controls. New Field Templates for URLs and E-mail Addresses ASP.NET 4 introduces two new built-in field templates, EmailAddress.ascx and Url.ascx. These templates are used for fields that are marked as EmailAddress or Url using the DataTypeAttribute attribute. For EmailAddress objects, the field is displayed as a hyperlink that is created by using the mailto: protocol. When users click the link, it opens the user's e-mail client and creates a skeleton message. Objects typed as Url are displayed as ordinary hyperlinks. The following example shows how to mark fields. [DataType(DataType.EmailAddress)] public object HomeEmail { get; set; } [DataType(DataType.Url)] public object Website { get; set; } Creating Links with the DynamicHyperLink Control Dynamic Data uses the new routing feature that was added in the .NET Framework 3.5 SP1 to control the URLs that users see when they access the Web site. The new DynamicHyperLink control makes it easy to build links to pages in a Dynamic Data site. For information, see How to: Create Table Action Links in Dynamic Data Support for Inheritance in the Data Model Both the ADO.NET Entity Framework and LINQ to SQL support inheritance in their data models. An example of this might be a database that has an InsurancePolicy table. It might also contain CarPolicy and HousePolicy tables that have the same fields as InsurancePolicy and then add more fields. Dynamic Data has been modified to understand inherited objects in the data model and to support scaffolding for the inherited tables. For more information, see Walkthrough: Mapping Table-per-Hierarchy Inheritance in Dynamic Data. Support for Many-to-Many Relationships (Entity Framework Only) The Entity Framework has rich support for many-to-many relationships between tables, which is implemented by exposing the relationship as a collection on an Entity object. New field templates (ManyToMany.ascx and ManyToMany_Edit.ascx) have been added to provide support for displaying and editing data that is involved in many-to-many relationships. For more information, see Working with Many-to-Many Data Relationships in Dynamic Data. New Attributes to Control Display and Support Enumerations The DisplayAttribute has been added to give you additional control over how fields are displayed. The DisplayNameAttribute attribute in earlier versions of Dynamic Data enabled you to change the name that is used as a caption for a field. The new DisplayAttribute class lets you specify more options for displaying a field, such as the order in which a field is displayed and whether a field will be used as a filter. The attribute also provides independent control of the name that is used for the labels in a GridView control, the name that is used in a DetailsView control, the help text for the field, and the watermark used for the field (if the field accepts text input). The EnumDataTypeAttribute class has been added to let you map fields to enumerations. When you apply this attribute to a field, you specify an enumeration type. Dynamic Data uses the new Enumeration.ascx field template to create UI for displaying and editing enumeration values. The template maps the values from the database to the names in the enumeration. Enhanced Support for Filters Dynamic Data 1.0 had built-in filters for Boolean columns and foreign-key columns. The filters did not let you specify the order in which they were displayed. The new DisplayAttribute attribute addresses this by giving you control over whether a column appears as a filter and in what order it will be displayed. An additional enhancement is that filtering support has been rewritten to use the new QueryExtender feature of Web Forms. This lets you create filters without requiring knowledge of the data source control that the filters will be used with. Along with these extensions, filters have also been turned into template controls, which lets you add new ones. Finally, the DisplayAttribute class mentioned earlier allows the default filter to be overridden, in the same way that UIHint allows the default field template for a column to be overridden. For more information, see Walkthrough: Filtering Rows in Tables That Have a Parent-Child Relationship and QueryableFilterRepeater. ASP.NET Chart Control The ASP.NET chart server control enables you to create ASP.NET pages applications that have simple, intuitive charts for complex statistical or financial analysis. The chart control supports the following features: Data series, chart areas, axes, legends, labels, titles, and more. Data binding. Data manipulation, such as copying, splitting, merging, alignment, grouping, sorting, searching, and filtering. Statistical formulas and financial formulas. Advanced chart appearance, such as 3-D, anti-aliasing, lighting, and perspective. Events and customizations. Interactivity and Microsoft Ajax. Support for the Ajax Content Delivery Network (CDN), which provides an optimized way for you to add Microsoft Ajax Library and jQuery scripts to your Web applications. For more information, see Chart Web Server Control Overview. Visual Web Developer Enhancements The following sections provide information about enhancements and new features in Visual Studio 2010 and Visual Web Developer Express. The Web page designer in Visual Studio 2010 has been enhanced for better CSS compatibility, includes additional support for HTML and ASP.NET markup snippets, and features a redesigned version of IntelliSense for JScript. Improved CSS Compatibility The Visual Web Developer designer in Visual Studio 2010 has been updated to improve CSS 2.1 standards compliance. The designer better preserves HTML source code and is more robust than in previous versions of Visual Studio. HTML and JScript Snippets In the HTML editor, IntelliSense auto-completes tag names. The IntelliSense Snippets feature auto-completes whole tags and more. In Visual Studio 2010, IntelliSense snippets are supported for JScript, alongside C# and Visual Basic, which were supported in earlier versions of Visual Studio. Visual Studio 2010 includes over 200 snippets that help you auto-complete common ASP.NET and HTML tags, including required attributes (such as runat="server") and common attributes specific to a tag (such as ID, DataSourceID, ControlToValidate, and Text). You can download additional snippets, or you can write your own snippets that encapsulate the blocks of markup that you or your team use for common tasks. For more information on HTML snippets, see Walkthrough: Using HTML Snippets. JScript IntelliSense Enhancements In Visual 2010, JScript IntelliSense has been redesigned to provide an even richer editing experience. IntelliSense now recognizes objects that have been dynamically generated by methods such as registerNamespace and by similar techniques used by other JavaScript frameworks. Performance has been improved to analyze large libraries of script and to display IntelliSense with little or no processing delay. Compatibility has been significantly increased to support almost all third-party libraries and to support diverse coding styles. Documentation comments are now parsed as you type and are immediately leveraged by IntelliSense. Web Application Deployment with Visual Studio 2010 For Web application projects, Visual Studio now provides tools that work with the IIS Web Deployment Tool (Web Deploy) to automate many processes that had to be done manually in earlier versions of ASP.NET. For example, the following tasks can now be automated: Creating an IIS application on the destination computer and configuring IIS settings. Copying files to the destination computer. Changing Web.config settings that must be different in the destination environment. Propagating changes to data or data structures in SQL Server databases that are used by the Web application. For more information about Web application deployment, see ASP.NET Deployment Content Map. Enhancements to ASP.NET Multi-Targeting ASP.NET 4 adds new features to the multi-targeting feature to make it easier to work with projects that target earlier versions of the .NET Framework. Multi-targeting was introduced in ASP.NET 3.5 to enable you to use the latest version of Visual Studio without having to upgrade existing Web sites or Web services to the latest version of the .NET Framework. In Visual Studio 2008, when you work with a project targeted for an earlier version of the .NET Framework, most features of the development environment adapt to the targeted version. However, IntelliSense displays language features that are available in the current version, and property windows display properties available in the current version. In Visual Studio 2010, only language features and properties available in the targeted version of the .NET Framework are shown. For more information about multi-targeting, see the following topics: .NET Framework Multi-Targeting for ASP.NET Web Projects ASP.NET Side-by-Side Execution Overview How to: Host Web Applications That Use Different Versions of the .NET Framework on the Same Server How to: Deploy Web Site Projects Targeted for Earlier Versions of the .NET Framework

  Read the article

• windows xp mode for windows 7 - save text input language settings

  - by Gero

  When I change the 'default language' in 'text services and input languages' in windows xp mode from EN-US to DE-DE the settings are reverted with the next logoff / reboot - EN-US is the default language again. Is there a way around this behaviour? I'm using the default 'XPMUser' in windows xp mode. I also checked 'turn off advanced text services' and disabled the language bar and windows xp remembers these settings - just not the default language..

  Read the article

• Ububtu server 12.04 auto installation freezes at kickseeding running if ks.cfg has post scripts

  - by john206

  I'm trying to make a custom Ubuntu Server iso file. Kickstart file (ks.cfg) runs smooth when there is no %post in the file and Ubuntu installs correctly with ks configuration. Installation finishes installing base, apt, grub and It echos: Kickseed Running... and it freezes @ 0% I thought may be apt-get update doesnt work in ks file, I tried to install other apps like apache2 but no luck I have created dozen iso images and installed them in Virtual Box.I have been googling for 3 days and checked out ubuntu forums but haven't figured out the issue. I appreciate your help. This is how I made the iso image. My ks.file and txt.cfg files located in isolinux directory: root@ubuntu:/home/work mount -o loop ubuntu-12.04-amd64.iso original-iso/ rsync -a original-iso/ custom-iso/ cp ks.cfg custom-iso/isolinux/ cp txt.cfg custom-iso/isolinux/ chmod -R 777 custom-iso/ #Creating Iso image mkisofs -D -r -V “$IMAGE_NAME” -cache-inodes -J -l -b isolinux/isolinux.bin -c isolinux/boot.cat -no-emul-boot -boot-load-size 4 -boot-info-table -o ~/ubuntu-12.04-alternate-custom-amd64.iso custom-iso/ ks.cfg #Generated by Kickstart Configurator #platform=AMD64 or Intel EM64T #System language lang en_US #Language modules to install langsupport en_US #System keyboard keyboard us #System mouse mouse #System timezone timezone America/Los_Angeles #Root password rootpw --iscrypted somethingsomething #Initial user user ubuntu --fullname "ubuntu" --iscrypted --password somethingsomething. #Reboot after installation reboot #Use text mode install text #Install OS instead of upgrade install #Use CDROM installation media cdrom #System bootloader configuration bootloader --location=mbr #Clear the Master Boot Record zerombr yes #Partition clearing information clearpart --all --initlabel #Disk partitioning information part /boot --size 128 --fstype=ext3 --asprimary part / --size 512 --fstype=ext3 --asprimary part swap --size 512 part /tmp --size 512 --fstype=ext3 part /var --size 512 --fstype=ext3 part /usr --size 4096 --fstype=ext3 part /home --size 2048 --fstype=ext3 #System authorization infomation auth --useshadow --enablemd5 #Network information network --bootproto=dhcp --device=eth0 #Firewall configuration firewall --disabled --http --ftp --ssh #X Window System configuration information xconfig --depth=32 --resolution=1024x768 --defaultdesktop=GNOME %post apt-get update mkdir /home/user txt.cfg default autoinstall label autoinstall menu label ^Install Custom Ubuntu Server kernel /install/vmlinuz append file=/cdrom/preseed/ubuntu-server.seed initrd=/install/initrd.gz quiet ks=cdrom:/isolinux/ks.cfg -- label install menu label ^Install Ubuntu Server kernel /install/vmlinuz append file=/cdrom/preseed/ubuntu-server.seed vga=788 initrd=/install/initrd.gz quiet -- label cloud menu label ^Multiple server install with MAAS kernel /install/vmlinuz append modules=maas-enlist-udeb vga=788 initrd=/install/initrd.gz quiet -- label check menu label ^Check disc for defects kernel /install/vmlinuz append MENU=/bin/cdrom-checker-menu vga=788 initrd=/install/initrd.gz quiet -- label memtest menu label Test ^memory kernel /install/mt86plus label hd menu label ^Boot from first hard disk localboot 0x80

  Read the article

• Using Windows 8 with Bootcamp?

  - by Farhad Yusufali

  I am trying to install Windows 8 using Bootcamp on OSX Mountain Lion. I need a bootable CD. Does the bootable CD have to be the size of the ISO image or can it be smaller (since it only contains the installer)? If it does not in fact have to be the size of the ISO image, what's the minimum required size of the CD I insert into my drive to create a bootable CD? (i.e. the minimum size of a bootable USB is 8GB)

  Read the article

• Benchmark MySQL Cluster using flexAsynch: No free node id found for mysqld(API)?

  - by quanta

  I am going to benchmark MySQL Cluster using flexAsynch follow this guide, details as below: mkdir /usr/local/mysqlc732/ cd /usr/local/src/mysql-cluster-gpl-7.3.2 cmake . -DCMAKE_INSTALL_PREFIX=/usr/local/mysqlc732/ -DWITH_NDB_TEST=ON make make install Everything works fine until this step: # /usr/local/mysqlc732/bin/flexAsynch -t 1 -p 80 -l 2 -o 100 -c 100 -n FLEXASYNCH - Starting normal mode Perform benchmark of insert, update and delete transactions 1 number of concurrent threads 80 number of parallel operation per thread 100 transaction(s) per round 2 iterations Load Factor is 80% 25 attributes per table 1 is the number of 32 bit words per attribute Tables are with logging Transactions are executed with hint provided No force send is used, adaptive algorithm used Key Errors are disallowed Temporary Resource Errors are allowed Insufficient Space Errors are disallowed Node Recovery Errors are allowed Overload Errors are allowed Timeout Errors are allowed Internal NDB Errors are allowed User logic reported Errors are allowed Application Errors are disallowed Using table name TAB0 NDBT_ProgramExit: 1 - Failed ndb_cluster.log: WARNING -- Failed to allocate nodeid for API at 127.0.0.1. Returned eror: 'No free node id found for mysqld(API).' I also have recompiled with -DWITH_DEBUG=1 -DWITH_NDB_DEBUG=1. How can I run flexAsynch in the debug mode? # /usr/local/mysqlc732/bin/flexAsynch -h FLEXASYNCH Perform benchmark of insert, update and delete transactions Arguments: -t Number of threads to start, default 1 -p Number of parallel transactions per thread, default 32 -o Number of transactions per loop, default 500 -l Number of loops to run, default 1, 0=infinite -load_factor Number Load factor in index in percent (40 -> 99) -a Number of attributes, default 25 -c Number of operations per transaction -s Size of each attribute, default 1 (PK is always of size 1, independent of this value) -simple Use simple read to read from database -dirty Use dirty read to read from database -write Use writeTuple in insert and update -n Use standard table names -no_table_create Don't create tables in db -temp Create table(s) without logging -no_hint Don't give hint on where to execute transaction coordinator -adaptive Use adaptive send algorithm (default) -force Force send when communicating -non_adaptive Send at a 10 millisecond interval -local 1 = each thread its own node, 2 = round robin on node per parallel trans 3 = random node per parallel trans -ndbrecord Use NDB Record -r Number of extra loops -insert Only run inserts on standard table -read Only run reads on standard table -update Only run updates on standard table -delete Only run deletes on standard table -create_table Only run Create Table of standard table -drop_table Only run Drop Table on standard table -warmup_time Warmup Time before measurement starts -execution_time Execution Time where measurement is done -cooldown_time Cooldown time after measurement completed -table Number of standard table, default 0

  Read the article

• RHEL5: Can't create sparse file bigger than 256GB in tmpfs

  - by John Kugelman

  /var/log/lastlog gets written to when you log in. The size of this file is based off of the largest UID in the system. The larger the maximum UID, the larger this file is. Thankfully it's a sparse file so the size on disk is much smaller than the size ls reports (ls -s reports the size on disk). On our system we're authenticating against an Active Directory server, and the UIDs users are assigned end up being really, really large. Like, say, UID 900,000,000 for the first AD user, 900,000,001 for the second, etc. That's strange but should be okay. It results in /var/log/lastlog being huuuuuge, though--once an AD user logs in lastlog shows up as 280GB. Its real size is still small, thankfully. This works fine when /var/log/lastlog is stored on the hard drive on an ext3 filesystem. It breaks, however, if lastlog is stored in a tmpfs filesystem. Then it appears that the max file size for any file on the tmpfs is 256GB, so the sessreg program errors out trying to write to lastlog. Where is this 256GB limit coming from, and how can I increase it? As a simple test for creating large sparse files I've been doing: dd if=/dev/zero of=sparse-file bs=1 count=1 seek=300GB I've tried Googling for "tmpfs max file size", "256GB filesystem limit", "linux max file size", things like that. I haven't been able to find much. The only mention of 256GB I can find is that ext3 filesystems with 2KB blocks are limited to 256GB files. But our hard drives are formatted with 4K blocks so that doesn't seem to be it--not to mention this is happening in a tmpfs mounted ON TOP of the hard drive so the ext3 partition shouldn't be a factor. This is all happening on a 64-bit Red Hat Enterprise Linux 5.4 system. Interestingly, on my personal development machine, which is a 32-bit Fedora Core 6 box, I can create 300GB+ files in tmpfs filesystems no problem. On the RHEL5.4 systems it is no go.

  Read the article

• How to remove file association in windows 8?

  - by Chesnokov Yuriy

  I have Chrome associated with .xlsx file on windows 8.1 machine In Control Panel\Programs\Default Programs\Set Associations it is not possible to remove association only to change it to another program. In Control Panel\Programs\Default Programs\Set Default Programs\Set Program Associations , .xlsx is not present in Chrome. I removed all keys from HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Explorer\FileExts\.xlsx Still Chrome remains associated with that extension in Control Panel\Programs\Default Programs\Set Associations, Windows Explorer shows the Chrome icon with the .xlsx file.

  Read the article

• dmidecode showing more ram slots than available?

  - by Jestep

  I have some failing RAM in a server and I ran dmidecode to figure out what tyoe of RAM I needed to replace it with. The server has 6 RAM slots, 4 of which are in use. When I run dmidecode this is what I get. dmidecode 2.10 SMBIOS 2.4 present. Handle 0x001F, DMI type 17, 27 bytes Memory Device Array Handle: 0x001E Error Information Handle: No Error Total Width: 72 bits Data Width: 64 bits Size: 2048 MB Form Factor: DIMM Set: 1 Locator: JXXX Bank Locator: DIMM 00 Type: DDR2 Type Detail: Synchronous Speed: 667 MHz Manufacturer: Not Specified Serial Number: Not Specified Asset Tag: Not Specified Part Number: Not Specified Handle 0x0020, DMI type 17, 27 bytes Memory Device Array Handle: 0x001E Error Information Handle: No Error Total Width: 72 bits Data Width: 64 bits Size: 2048 MB Form Factor: DIMM Set: 1 Locator: JXXX Bank Locator: DIMM 01 Type: DDR2 Type Detail: Synchronous Speed: 667 MHz Manufacturer: Not Specified Serial Number: Not Specified Asset Tag: Not Specified Part Number: Not Specified Handle 0x0021, DMI type 17, 27 bytes Memory Device Array Handle: 0x001E Error Information Handle: No Error Total Width: Unknown Data Width: Unknown Size: No Module Installed Form Factor: DIMM Set: 1 Locator: JXXX Bank Locator: DIMM 02 Type: DDR2 Type Detail: Synchronous Speed: 667 MHz Manufacturer: Not Specified Serial Number: Not Specified Asset Tag: Not Specified Part Number: Not Specified Handle 0x0022, DMI type 17, 27 bytes Memory Device Array Handle: 0x001E Error Information Handle: No Error Total Width: Unknown Data Width: Unknown Size: No Module Installed Form Factor: DIMM Set: 1 Locator: JXXX Bank Locator: DIMM 03 Type: DDR2 Type Detail: Synchronous Speed: 667 MHz Manufacturer: Not Specified Serial Number: Not Specified Asset Tag: Not Specified Part Number: Not Specified Handle 0x0023, DMI type 17, 27 bytes Memory Device Array Handle: 0x001E Error Information Handle: No Error Total Width: 72 bits Data Width: 64 bits Size: 2048 MB Form Factor: DIMM Set: 1 Locator: JXXX Bank Locator: DIMM 10 Type: DDR2 Type Detail: Synchronous Speed: 667 MHz Manufacturer: Not Specified Serial Number: Not Specified Asset Tag: Not Specified Part Number: Not Specified Handle 0x0024, DMI type 17, 27 bytes Memory Device Array Handle: 0x001E Error Information Handle: No Error Total Width: 72 bits Data Width: 64 bits Size: 2048 MB Form Factor: DIMM Set: 1 Locator: JXXX Bank Locator: DIMM 11 Type: DDR2 Type Detail: Synchronous Speed: 667 MHz Manufacturer: Not Specified Serial Number: Not Specified Asset Tag: Not Specified Part Number: Not Specified Handle 0x0025, DMI type 17, 27 bytes Memory Device Array Handle: 0x001E Error Information Handle: No Error Total Width: Unknown Data Width: Unknown Size: No Module Installed Form Factor: DIMM Set: 1 Locator: JXXX Bank Locator: DIMM 12 Type: DDR2 Type Detail: Synchronous Speed: 667 MHz Manufacturer: Not Specified Serial Number: Not Specified Asset Tag: Not Specified Part Number: Not Specified Handle 0x0026, DMI type 17, 27 bytes Memory Device Array Handle: 0x001E Error Information Handle: No Error Total Width: Unknown Data Width: Unknown Size: No Module Installed Form Factor: DIMM Set: 1 Locator: JXXX Bank Locator: DIMM 13 Type: DDR2 Type Detail: Synchronous Speed: 667 MHz Manufacturer: Not Specified Serial Number: Not Specified Asset Tag: Not Specified Part Number: Not Specified Does anyone know why it would show 8 slots, with 4 empty instead of 6 slots with 2 empty? Also, but my records and by other tools, the server has 16Gb and not 8Gb in it currently. grep MemTotal /proc/meminfo MemTotal: 16435808 kB The board is a Tyan S5372-LC, running CentOS 5.4 x64. Also, my error log is showing errors in bank 6. Is there any way to determine which slot bank 6 is in via: dmidecode?

  Read the article

• Exchange 2007 Standard Edition

  - by Phrontiste

  We Have : Exchange 2007 Standard Edition IBM System X3650 2 x Intel Xeon 5430 2.66 GHz Version 8.1 Build 240.6 Mailbox, Hub Transport, Client Access Role Installed on One Box Total Number of Mailboxes : 110 - 130 6 Physical Disks Disk 0,1 (68 GB) = Raid-1, OS Partition ( C: Partition) Disk 2,3 (279GB) = Raid-1, Exchange Database (First and Second Storage Groups) ( D: Partition ) Disk 4,5 (68 GB) = Raid-1, Exchange Transaction Logs ( E: Partition ) Setup: Storage Groups : D:\First Storage group\Mailbox database.edb Storage Groups : D:\Second Storage Group\Public Folder Database.edb Transaction Logs : E Partition Problem 1: On our D Partition (Mailbox Database Partition), total size is 279 GB, free space remaining is 64.7 GB, when I select the first storage group and second storage group folders and right click properties they report a size of 165 GB. Mailbox database reports a size of 157GB when right clicked Properties. where as the size displayed in the folder is 164,893,456 KB So, we are missing around 50-54 GB, there is nothing else on these drives, no page file, nothing at all. The partition housing the Transaction logs is reporting the sizes accurately. Any suggestions / fixes on the above ? Problem 2: As you may have already read in Problem 1, the size of the mailbox database is 157GB or 164GB reported; which is not recommended, a) What would you suggest we should do to divide mailboxes in storage groups on this same server ? b) How would we move mailboxes into different storage groups ? c) This is the information store size ? (Am I right in thinking that this is not recommended) d) Having multiple storage groups with one Mailbox DB in each, would that reduce the size of the Information Store? e) Any suggestions / how-to reduce the size of information store ? We didn't install this, we have inherited this - what other recommendations you can make in order to keep ourselves better prepared for any server disaster? We are backing up with Yosemite Backup on RD1000 (320GB) at the moment, which is backing up successfully, flushing the logs daily. We haven't done a test restore YET. I have tried to provide as much info as possible, please let me know if you need further info. Also, we haven't yet faced any problems in mailflow, access speeds, everything is working fine, we have two to five people accessing OWA or Outlook via vpn only. Thanks for your time to read the above - will look forward to your expert suggestions.

  Read the article

• how to strip string from url using rewrite rule

  - by Alaa Alomari

  sometimes my drupal site add extra string to image url which causes the image to be broken. the url is http://mysite.com/sites/default/files/imagecache/list_image_page/%252Fsites/default/files/img.jpg what is the needed rewrite rule to strip the bolded (%252F) part in the above link ie. to be: http://mysite.com/sites/default/files/imagecache/list_image_page/sites/default/files/img.jpg I have tried this, but didn't work RewriteCond %{QUERY_STRING} ^(.*)\%252Fsites(.*)$ RewriteRule %{REQUEST_URI} %1sites%2

  Read the article

• Daemon process exiting when shell closes

  - by Pace

  I have a script which starts a daemon process and then sleeps for 20 seconds. If I run the script on SLES11 SP1 or RHEL6 then after the script exits the process is still running. If I run the script on SLES11 SP3 or RHEL6.3 then after the script exits the process is no longer running. The process continues to run for the entire 20 second sleep and is killed when the process exits. The script is run via expect so the script's entire shell exits with the process. Obviously if this wasn't a daemon it was starting I wouldn't be surprised. Also, I suspect the problem isn't the OS version as much as it is the difference in the way we've setup the newer servers (no idea what those differences are though, the older servers were set up years ago). During the 20 seconds the process runs if I do a ps I get the following: root 4699 1 0 15:14 pts/2 00:00:00 sudo -u openmq /opt/PacketPortal/openmq/default/bin/imqbrokerd -bgnd -autorestart -silent -port 7676 -Dimq.service.activelist=admin,ssljms -D openmq 4701 4699 0 15:14 pts/2 00:00:00 /bin/sh /opt/PacketPortal/openmq/default/bin/imqbrokerd -bgnd -autorestart -silent -port 7676 -Dimq.service.activelist=admin,ssljms -Dimq.ssl The fact that the parent process of 4699 is 1 seems to suggest to me that the process has been correctly daemonized. However, after the expect script exits both 4699 and 4701 are killed. What could be causing this? UPDATE I've printed the same output on the servers that work. During the 20 second sleep I get: openmq 18652 1 0 15:44 pts/1 00:00:00 /bin/sh /opt/PacketPortal/openmq/default/bin/imqbrokerd -bgnd -autorestart -silent -port 7676 -Dimq.service.activelist=admin,ssljms -Dimq.ssljms.tls.port=7680 openmq 18686 18652 8 15:44 pts/1 00:00:02 /usr/java/latest/bin/java -cp /opt/PacketPortal/openmq/default/bin/../lib/imqbroker.jar:/opt/PacketPortal/openmq/default/bin/../lib/imqutil.jar:/opt/PacketPortal/ope After the 20 second sleep I get: openmq 18652 1 0 15:44 ? 00:00:00 /bin/sh /opt/PacketPortal/openmq/default/bin/imqbrokerd -bgnd -autorestart -silent -port 7676 -Dimq.service.activelist=admin,ssljms -Dimq.ssljms.tls.port=7680 openmq 18686 18652 5 15:44 ? 00:00:02 /usr/java/latest/bin/java -cp /opt/PacketPortal/openmq/default/bin/../lib/imqbroker.jar:/opt/PacketPortal/openmq/default/bin/../lib/imqutil.jar:/opt/PacketPortal/ope After the script exits it disconnects the controlling terminal. I wonder why it doesn't do that on the newer servers. UPDATE Here is the section of the script that actually launches OpenMQ. The -bgnd flag is what is supposed to daemonize it. sudo -u openmq $IMQ_HOME/bin/$EXECUTABLE -bgnd $BROKER_OPTIONS $ARGS > /dev/null 2>&1 &

  Read the article

• Cannot install grub to RAID1 (md0)

  - by Andrew Answer

  I have a RAID1 array on my Ubuntu 12.04 LTS and my /sda HDD has been replaced several days ago. I use this commands to replace: # go to superuser sudo bash # see RAID state mdadm -Q -D /dev/md0 # State should be "clean, degraded" # remove broken disk from RAID mdadm /dev/md0 --fail /dev/sda1 mdadm /dev/md0 --remove /dev/sda1 # see partitions fdisk -l # shutdown computer shutdown now # physically replace old disk by new # start system again # see partitions fdisk -l # copy partitions from sdb to sda sfdisk -d /dev/sdb | sfdisk /dev/sda # recreate id for sda sfdisk --change-id /dev/sda 1 fd # add sda1 to RAID mdadm /dev/md0 --add /dev/sda1 # see RAID state mdadm -Q -D /dev/md0 # State should be "clean, degraded, recovering" # to see status you can use cat /proc/mdstat This is the my mdadm output after sync: /dev/md0: Version : 0.90 Creation Time : Wed Feb 17 16:18:25 2010 Raid Level : raid1 Array Size : 470455360 (448.66 GiB 481.75 GB) Used Dev Size : 470455360 (448.66 GiB 481.75 GB) Raid Devices : 2 Total Devices : 2 Preferred Minor : 0 Persistence : Superblock is persistent Update Time : Thu Nov 1 15:19:31 2012 State : clean Active Devices : 2 Working Devices : 2 Failed Devices : 0 Spare Devices : 0 UUID : 92e6ff4e:ed3ab4bf:fee5eb6c:d9b9cb11 Events : 0.11049560 Number Major Minor RaidDevice State 0 8 1 0 active sync /dev/sda1 1 8 17 1 active sync /dev/sdb1 After bebuilding completion "fdisk -l" says what I have not valid partition table /dev/md0. This is my fdisk -l output: Disk /dev/sda: 500.1 GB, 500107862016 bytes 255 heads, 63 sectors/track, 60801 cylinders, total 976773168 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x00057d19 Device Boot Start End Blocks Id System /dev/sda1 * 63 940910984 470455461 fd Linux raid autodetect /dev/sda2 940910985 976768064 17928540 5 Extended /dev/sda5 940911048 976768064 17928508+ 82 Linux swap / Solaris Disk /dev/sdb: 500.1 GB, 500107862016 bytes 255 heads, 63 sectors/track, 60801 cylinders, total 976773168 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x000667ca Device Boot Start End Blocks Id System /dev/sdb1 * 63 940910984 470455461 fd Linux raid autodetect /dev/sdb2 940910985 976768064 17928540 5 Extended /dev/sdb5 940911048 976768064 17928508+ 82 Linux swap / Solaris Disk /dev/md0: 481.7 GB, 481746288640 bytes 2 heads, 4 sectors/track, 117613840 cylinders, total 940910720 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x00000000 Disk /dev/md0 doesn't contain a valid partition table This is my grub install output: root@answe:~# grub-install /dev/sda /usr/sbin/grub-setup: warn: Attempting to install GRUB to a disk with multiple partition labels or both partition label and filesystem. This is not supported yet.. /usr/sbin/grub-setup: error: embedding is not possible, but this is required for cross-disk install. root@answe:~# grub-install /dev/sdb Installation finished. No error reported. So 1) "update-grub" find only /sda and /sdb Linux, not /md0 2) "dpkg-reconfigure grub-pc" says "GRUB failed to install the following devices /dev/md0" I cannot load my system except from /sdb1 and /sda1, but in DEGRADED mode... Anybody can resolve this issue? I have big headache with this.

  Read the article

• windows xp mode for windows 7 - save text input language settings

  - by Gero

  When I change the 'default language' in 'text services and input languages' in windows xp mode from EN-US to DE-DE the settings are reverted with the next logoff / reboot - EN-US is the default language again. Is there a way around this behaviour? I'm using the default 'XPMUser' in windows xp mode. I also checked 'turn off advanced text services' and disabled the language bar and windows xp remembers these settings - just not the default language..

  Read the article

< Previous Page | 262 263 264 265 266 267 268 269 270 271 272 273  | Next Page >