Search Results

Search found 7513 results on 301 pages for 'actual'.

Page 271/301 | < Previous Page | 267 268 269 270 271 272 273 274 275 276 277 278  | Next Page >

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • Chrome extension - Localstorage not working

    - by Bjarki Jonasson
    I'm writing a Chrome extension that uses a content script to modify certain parts of a website. The content script worked fine until I tried to add an options page to my extension. Right now I'm using an options.html file to save user preferences to localstorage, as you can see here: <html> <head><title>Options</title></head> <script type="text/javascript"> function save_options() { var select = document.getElementById("width"); var width = select.children[select.selectedIndex].value; localStorage["site_width"] = width; } function restore_options() { var fwidth = localStorage["site_width"]; if (!fwidth) { return; } var select = document.getElementById("width"); for (var i = 0; i < select.children.length; i++) { var child = select.children[i]; if (child.value == fwidth) { child.selected = "true"; break; } } } </script> <body onload="restore_options()"> Width: <select id="width"> <option value="100%">100%</option> <option value="90%">90%</option> <option value="80%">80%</option> <option value="70%">70%</option> </select> <br> <button onclick="save_options()">Save</button> </body> </html> I also have a background.html file to handle the communication between the content script and the localstorage: <html> <script type="text/javascript"> chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "siteWidth") sendResponse({status: localStorage["site_width"]}); else sendResponse({}); }); </script> </html> Then there's the actual content script that looks like this: var Width; chrome.extension.sendRequest({method: "siteWidth"}, function(response) { width = response.status; }); None of that code actually works. It looks solid enough to me but I'm not a very experienced programmer so I might be wrong. Could someone explain localstorage to me in layman's terms?

    Read the article

  • Help With LINQ: Mixed Joins and Specifying Default Values

    - by Corey O.
    I am trying to figure out how to do a mixed-join in LINQ with specific access to 2 LINQ objects. Here is an example of how the actual TSQL query might look: SELECT * FROM [User] AS [a] INNER JOIN [GroupUser] AS [b] ON [a].[UserID] = [b].[UserID] INNER JOIN [Group] AS [c] ON [b].[GroupID] = [c].[GroupID] LEFT JOIN [GroupEntries] AS [d] ON [a].[GroupID] = [d].[GroupID] WHERE [a].[UserID] = @UserID At the end, basically what I would like is an enumerable object full of GroupEntry objects. What am interested is the last two tables/objects in this query. I will be displaying Groups as a group header, and all of the Entries underneath their group heading. If there are no entries for a group, I still want to see that group as a header without any entries. Here's what I have so far: So from that I'd like to make a function: public void DisplayEntriesByUser(int user_id) { MyDataContext db = new MyDataContext(); IEnumberable<GroupEntries> entries = ( from user in db.Users where user.UserID == user_id join group_user in db.GroupUsers on user.UserID = group_user.UserID into a from join1 in a join group in db.Groups on join1.GroupID equals group.GroupID into b from join2 in b join entry in db.Entries.DefaultIfEmpty() on join2.GroupID equals entry.GroupID select entry ); Group last_group_id = 0; foreach(GroupEntry entry in entries) { if (last_group_id == 0 || entry.GroupID != last_group_id) { last_group_id = entry.GroupID; System.Console.WriteLine("---{0}---", entry.Group.GroupName.ToString().ToUpper()); } if (entry.EntryID) { System.Console.WriteLine(" {0}: {1}", entry.Title, entry.Text); } } } The example above does not work quite as expected. There are 2 problems that I have not been able to solve: I still seem to be getting an INNER JOIN instead of a LEFT JOIN on the last join. I am not getting any empty results, so groups without entries do not appear. I need to figure out a way so that I can fill in the default values for blank sets of entries. That is, if there is a group without an entry, I would like to have a mostly blank entry returned, except that I'd want the EntryID to be null or 0, the GroupID to be that of of the empty group that it represents, and I'd need a handle on the entry.Group object (i.e. it's parent, empty Group object). Any help on this would be greatly appreciated. Note: Table names and real-world representation were derived purely for this example, but their relations simplify what I'm trying to do.

    Read the article

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

  • How to define and work with an array of bits in C?

    - by Eddy
    I want to create a very large array on which I write '0's and '1's. I'm trying to simulate a physical process called random sequential adsorption, where units of length 2, dimers, are deposited onto an n-dimensional lattice at a random location, without overlapping each other. The process stops when there is no more room left on the lattice for depositing more dimers (lattice is jammed). Initially I start with a lattice of zeroes, and the dimers are represented by a pair of '1's. As each dimer is deposited, the site on the left of the dimer is blocked, due to the fact that the dimers cannot overlap. So I simulate this process by depositing a triple of '1's on the lattice. I need to repeat the entire simulation a large number of times and then work out the average coverage %. I've already done this using an array of chars for 1D and 2D lattices. At the moment I'm trying to make the code as efficient as possible, before working on the 3D problem and more complicated generalisations. This is basically what the code looks like in 1D, simplified: int main() { /* Define lattice */ array = (char*)malloc(N * sizeof(char)); total_c = 0; /* Carry out RSA multiple times */ for (i = 0; i < 1000; i++) rand_seq_ads(); /* Calculate average coverage efficiency at jamming */ printf("coverage efficiency = %lf", total_c/1000); return 0; } void rand_seq_ads() { /* Initialise array, initial conditions */ memset(a, 0, N * sizeof(char)); available_sites = N; count = 0; /* While the lattice still has enough room... */ while(available_sites != 0) { /* Generate random site location */ x = rand(); /* Deposit dimer (if site is available) */ if(array[x] == 0) { array[x] = 1; array[x+1] = 1; count += 1; available_sites += -2; } /* Mark site left of dimer as unavailable (if its empty) */ if(array[x-1] == 0) { array[x-1] = 1; available_sites += -1; } } /* Calculate coverage %, and add to total */ c = count/N total_c += c; } For the actual project I'm doing, it involves not just dimers but trimers, quadrimers, and all sorts of shapes and sizes (for 2D and 3D). I was hoping that I would be able to work with individual bits instead of bytes, but I've been reading around and as far as I can tell you can only change 1 byte at a time, so either I need to do some complicated indexing or there is a simpler way to do it? Thanks for your answers

    Read the article

  • use jQuery to get 'true size' of image without removing the class

    - by jon3laze
    I am using Jcrop on an image that is resized with css for uniformity. JS <script type="text/javascript"> $(window).load(function() { //invoke Jcrop API and set options var api = $.Jcrop('#image', { onSelect: storeCoords, trueSize: [w, h] }); api.disable(); //disable until ready to use //enable the Jcrop on crop button click $('#crop').click(function() { api.enable(); }); }); function storeCoords(c) { $('#X').val(c.x); $('#Y').val(c.y); $('#W').val(c.w); $('#H').val(c.h); }; </script> HTML <body> <img src="/path/to/image.jpg" id="image" class="img_class" alt="" /> <br /> <span id="crop" class="button">Crop Photo</span> <span id="#X" class="hidden"></span> <span id="#Y" class="hidden"></span> <span id="#W" class="hidden"></span> <span id="#H" class="hidden"></span> </body> CSS body { font-size: 13px; width: 500px; height: 500px; } .image { width: 200px; height: 300px; } .hidden { display: none; } I need to set the h and w variables to the size of the actual image. I tried using the .clone() manipulator to make a copy of the image and then remove the class from the clone to get the sizing but it sets the variables to zeros. var pic = $('#image').clone(); pic.removeClass('image'); var h = pic.height(); var w = pic.width(); It works if I append the image to an element in the page, but these are larger images and I would prefer not to be loading them as hidden images if there is a better way to do this. Also removing the class, setting the variables, and then re-adding the class was producing sporadic results. I was hoping for something along the lines of: $('#image').removeClass('image', function() { h = $(this).height(); w = $(this).width(); }).addClass('image'); But the removeClass function doesn't work like that :P

    Read the article

  • Implementing a scalable and high-performing web app

    - by Christopher McCann
    I have asked a few questions on here before about various things relating to this but this is more of a consolidation question as I would like to check I have got the gist of everything. I am in the middle of developing a social media web app and although I have a lot of experience coding in Java and in PHP I am trying things a bit different this time. I have modularised each component of the application. So for example one component of the application allows users to private message each other and I have split this off into its own private messaging service. I have also created a user data service the purpose of which is to return data about the user for example their name, address, age etc etc from the database. Their is also another service, the friends service, which will work off the neo4j database to create a social graph. My reason for doing all this is to allow me up to update seperate modules when I need to - so while they mostly all run off MySQL right now I could move one to Cassandra later if I thought it approriate. The actual code of the web app is really just used for the final construction. The modules behind it dont really follow any strict REST or SOAP protocol. Basically each method on our API is turned into a PHP procedural script. This then may make calls to other back-end code which tends to be OO. The web app makes CURL requests to these pages and POSTs data to them or GETs data from them. These pages then return JSON where data is required. I'm still a little mixed up about how I actually identify which user is logged in at that moment. Do I just use sessions for that? Like if we called the get-messages.php script which equates to the getMessages() method for that user - returning all the private messages for that user - how would the back-end code know which user it is as posting the users ID to the script would not be secure. Anyone could do that and get all the messages. So I thought I would use sessions for it. Am I correct on this? Can anyone spot any other problems with what I am doing here? Thanks

    Read the article

  • jquery, manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Looking for an Open Source Project in need of help

    - by hvidgaard
    Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

    Read the article

  • Simple RSA encryption (Java)

    - by jake blue
    This is simply for fun. This will not be used for any actual encryption. I'm only first year comp sci student and love cryptography. This took a long time to get working. At approximately N = 18, it begins breaking down. It won't encrypt messages properly after that point. I'm not sure why. Any insights? I'd also appreciate any links you could provide me to tutorials or interesting reading about Cryptography. import java.math.BigInteger; import java.security.SecureRandom; /** * Cryptography. * * Generates public and private keys used in encryption and * decryption * */ public class RSA { private final static BigInteger one = new BigInteger("1"); private final static SecureRandom random = new SecureRandom(); // prime numbers private BigInteger p; private BigInteger q; // modulus private BigInteger n; // totient private BigInteger t; // public key private BigInteger e; // private key private BigInteger d; private String cipherText; /** * Constructor for objects of class RSA */ public RSA(int N) { p = BigInteger.probablePrime(N/2, random); q = BigInteger.probablePrime(N/2, random); // initialising modulus n = p.multiply(q); // initialising t by euclid's totient function (p-1)(q-1) t = (p.subtract(one)).multiply(q.subtract(one)); // initialising public key ~ 65537 is common public key e = new BigInteger("65537"); } public int generatePrivateKey() { d = e.modInverse(t); return d.intValue(); } public String encrypt(String plainText) { String encrypted = ""; int j = 0; for(int i = 0; i < plainText.length(); i++){ char m = plainText.charAt(i); BigInteger bi1 = BigInteger.valueOf(m); BigInteger bi2 = bi1.modPow(e, n); j = bi2.intValue(); m = (char) j; encrypted += m; } cipherText = encrypted; return encrypted; } public String decrypt() { String decrypted = ""; int j = 0; for(int i = 0; i < cipherText.length(); i++){ char c = cipherText.charAt(i); BigInteger bi1 = BigInteger.valueOf(c); BigInteger bi2 = bi1.modPow(d, n); j = bi2.intValue(); c = (char) j; decrypted += c; } return decrypted; } }

    Read the article

  • java web application best practices

    - by Bruce
    Hi all I'm trying to figure out the optimum way to develop and release a fairly simple web application, and I'm running into several problems. I'll outline the decisions I've made, because somewhere I've clearly gone off the rails.. Hugely grateful for any help! I have what I think is a fairly simple web application. It contains a couple of jsps that reference a couple of java beans, and the usual static html, js, css and images. Decision 1) I wanted to have a clear and clean release procedure, such that I could develop on my local machine and then release reliably to a production machine. I therefore made the decision to package the application into a war file (including all the static resources), to minimize the separate bits and pieces I would need to release. So far so good? Decision 2) I wanted things on my local machine to be as similar as possible to the production environment. So in my html, for example, I may have a reference to a static file such as http://static.foo.com/file . To keep this code working seamlessly on dev and prod, I decided to put static.foo.com in my /etc/hosts when developing locally, so that all the urls work correctly without changing anything. Decision 3) I decided to use eclipse and maven to give me a best practice environment for administering and building my project. So I have a nice tight set up now, except that: Every time I want to change anything in development, like one line in an html file, I have to rebuild the entire project and then wait for tomcat to load the war before I can see if it's what I wanted. So my questions are: 1) Is there a way to connect up eclipse and tomcat so that I don't have to rebuild the war each time? ie tomcat is looking straight at my actual workspace to serve up the static files? 2)I think I'm maybe making things harder by using /etc/hosts to reflect production urls - is there a better way that doesn't involve manually changing over urls (relative urls are fine of course, but where you have many subdomains, say one for static files and one for dynamic, you have to write out the full path, surely?) 3) Is this really best practice?? How do people set things up so that they balance the requirement for an automated, all-encompassing build process on the one hand, and the speed and flexibility to be able to develop javascript and html and css quickly, as quickly as if one just pointed apache at the directory and developed live? What do people find works? Many thanks!

    Read the article

  • how to develop a program to minimize errors in human transcription of hand written surveys

    - by Alex. S.
    I need to develop custom software to do surveys. Questions may be of multiple choice, or free text in a very few cases. I was asked to design a subsystem to check if there is any error in the manual data entry for the multiple choices part. We're trying to speed up the user data entry process and to minimize human input differences between digital forms and the original questionnaires. The surveys are filled with handwritten marks and text by human interviewers, so it's possible to find hard to read marks, or also the user could accidentally select a different value in some question, and we would like to avoid that. The software must include some automatic control to detect possible typing differences. Each answer of the multiple choice questions has the same probability of being selected. This question has two parts: The GUI. The most simple thing I have in mind is to implement the most usable design of the questions display: use of large and readable fonts and space generously the choices. Is there something else? For faster input, I would like to use drop down lists (favoring keyboard over mouse). Given the questions are grouped in sections, I would like to show the answers selected for the questions of that section, but this could slow down the process. Any other ideas? The error checking subsystem. What else can I do to minimize or to check human typos in the multiple choice questions? Is this a solvable problem? is there some statistical methodology to check values that were entered by the users are the same from the hand filled forms? For example, let's suppose the survey has 5 questions, and each has 4 options. Let's say I have n survey forms filled in paper by interviewers, and they're ready to be entered in the software, then how to minimize the accidental differences that can have the manual transcription of the n surveys, without having to double check everything in the 5 questions of the n surveys? My first suggestion is that at the end of the processing of all the hand filled forms, the software could choose some forms randomly to make a double check of the responses in a few instances, but on what criteria can I make this selection? This validation would be enough to cover everything in a significant way? The actual survey is nation level and it has 56 pages with over 200 questions in total, so it will be a lot of hand written pages by many people, and the intention is to reduce the likelihood of errors and to optimize speed in the data entry process. The surveys must filled in paper first, given the complications of taking laptops or handhelds with the interviewers.

    Read the article

  • Stubbing a before_filter with RSpec

    - by TheDelChop
    Guys, I'm having trouble understanding why I can't seem to stub this controller method :load_user, since all of my tests fail if I change the actual implementation of :load_user to not return and instance of @user. Can anybody see why my stub (controller.stub!(:load_user).and_return(@user)) seems to fail to actually get called when RSpec makes a request to the controller? require 'spec_helper' describe TasksController do before(:each) do @user = Factory(:user) sign_in @user @task = Factory(:task) User.stub_chain(:where, :first).and_return(@user) controller.stub!(:load_user).and_return(@user) end #GET Index describe "GET Index" do before(:each) do @tasks = 7.times{Factory(:task, :user = @user)} @user.stub!(:tasks).and_return(@tasks) end it "should should find all of the tasks owned by a user" do @user.should_receive(:tasks).and_return(@tasks) get :index, :user_id = @user.id end it "should assign all of the user's tasks to the view" do get :index, :user_id = @user.id assigns[:tasks].should be(@tasks) end end #GET New describe "GET New" do before(:each) do @user.stub_chain(:tasks, :new).and_return(@task) end it "should return a new Task" do @user.tasks.should_receive(:new).and_return(@task) get :new, :user_id = @user.id end end #POST Create describe "POST Create" do before(:each) do @user.stub_chain(:tasks, :new).and_return(@task) end it "should create a new task" do @user.tasks.should_receive(:new).and_return(@task) post :create, :user_id = @user.id, :task = @task.to_s end it "saves the task" do @task.should_receive(:save) post :create, :user_id = @user.id, :task = @task end context "when the task is saved successfully" do before(:each) do @task.stub!(:save).and_return(true) end it "should set the flash[:notice] message to 'Task Added Successfully'"do post :create, :user_id = @user.id, :task = @task flash[:notice].should == "Task Added Successfully!" end it "should redirect to the user's task page" do post :create, :user_id = @user.id, :task = @task response.should redirect_to(user_tasks_path(@user.id)) end end context "when the task isn't saved successfully" do before(:each) do @task.stub(:save).and_return(false) end it "should return to the 'Create New Task' page do" do post :create, :user_id = @user.id, :task = @task response.should render_template('new') end end end it "should attempt to authenticate and load the user who owns the tasks" do context "when the tasks belong to the currently logged in user" do it "should set the user instance variable to the currently logged in user" do pending end end context "when the tasks belong to another user" do it "should set the flash[:notice] to 'Sorry but you can't view other people's tasks.'" do pending end it "should redirect to the home page" do pending end end end end class TasksController < ApplicationController before_filter :load_user def index @tasks = @user.tasks end def new @task = @user.tasks.new end def create @task = @user.tasks.new if @task.save flash[:notice] = "Task Added Successfully!" redirect_to user_tasks_path(@user.id) else render :action => 'new' end end private def load_user if current_user.id == params[:user_id].to_i @user = User.where(:id => params[:user_id]).first else flash[:notice] = "Sorry but you can't view other people's tasks." redirect_to root_path end end end Can anybody see why my stub doesnt' work? Like I said, my tests only pass if I make sure that load_user works, if not, all my tests fail which makes my think that RSpec isn't using the stub I created. Thanks, Joe

    Read the article

  • dynamically embedding youtube videos with jquery

    - by danwoods
    Hello all, I'm trying to retrieve a listing of a user's youtube videos and embed them in a page using jQuery. My code looks something like this: $(document).ready(function() { //some variables var fl_obj_template = $('<object width="260" height="140">' + '<param name="movie" value=""></param>' + '<param name="allowFullScreen" value="true"></param>' + '<param name="allowscriptaccess" value="always"></param>' + '<embed src="" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="260" height="140"></embed>' + '</object>'); var video_elm_arr = $('.video'); //hide videos until ready $('.video').addClass('hidden'); //pull video data from youtube $.ajax({ url: 'http://gdata.youtube.com/feeds/api/users/username/uploads?alt=json', dataType: 'jsonp', success: function(data) { $.each(data.feed.entry, function(i,item){ //only take the first 7 videos if(i > 6) return; //give the video element a flash object var cur_flash_obj = fl_obj_template; //assign title $(video_elm_arr[i]).find('.video_title').html(item.title.$t); //clean url var video_url = item.media$group.media$content[0].url; var index = video_url.indexOf("?"); if (index > 0) video_url = video_url.substring(0, index); //and asign it to the player's parameters $(cur_flash_obj).find('object param[name="movie"]').attr('value', video_url); $(cur_flash_obj).find('object embed').attr('src', video_url); //alert(cur_flash_obj); //insert flash object in video element $(video_elm_arr[i]).append(cur_flash_obj); //and show $(video_elm_arr[i]).removeClass('hidden'); }); } }); }); (of course with 'username' being the actual username). The video titles appear correctly but no videos show up. What gives? The target html looks like: <div id="top_row_center" class="video_center video"> <p class="video_title"></p> </div>

    Read the article

  • Schema to support dynamic properties

    - by Johan Fredrik Varen
    Hi people. I'm working on an editor that enables its users to create "object" definitions in real-time. A definition can contain zero or more properties. A property has a name a type. Once a definition is created, a user can create an object of that definition and set the property values of that object. So by the click of a mouse-button, the user should ie. be able to create a new definition called "Bicycle", and add the property "Size" of type "Numeric". Then another property called "Name" of type "Text", and then another property called "Price" of type "Numeric". Once that is done, the user should be able to create a couple of "Bicycle" objects and fill in the "Name" and "Price" property values of each bike. Now, I've seen this feature in several software products, so it must be a well-known concept. My problem started when I sat down and tried to come up with a DB schema to support this data structure, because I want the property values to be stored using the appropriate column types. Ie. a numeric property value is stored as, say, an INT in the database, and a textual property value is stored as VARCHAR. First, I need a table that will hold all my object definitions: Table obj_defs id | name | ---------------- 1 | "Bicycle" | 2 | "Book" | Then I need a table for holding what sort of properties each object definition should have: Table prop_defs id | obj_def_id | name | type | ------------------------------------ 1 | 1 | "Size" | ? | 2 | 1 | "Name" | ? | 3 | 1 | "Price" | ? | 4 | 2 | "Title" | ? | 5 | 2 | "Author" | ? | 6 | 2 | "ISBN" | ? | I would also need a table that holds each object: Table objects id | created | updated | ------------------------------ 1 | 2011-05-14 | 2011-06-15 | 2 | 2011-05-14 | 2011-06-15 | 3 | 2011-05-14 | 2011-06-15 | Finally, I need a table that will hold the actual property values of each object, and one solution is for this table to have one column for each possible value type, such as this: Table prop_vals id | prop_def_id | object_id | numeric | textual | boolean | ------------------------------------------------------------ 1 | 1 | 1 | 27 | | | 2 | 2 | 1 | | "Trek" | | 3 | 3 | 1 | 1249 | | | 4 | 1 | 2 | 26 | | | 5 | 2 | 2 | | "GT" | | 6 | 3 | 2 | 159 | | | 7 | 4 | 3 | | "It" | | 8 | 5 | 3 | | "King" | | 9 | 6 | 4 | 9 | | | If I implemented this schema, what would the "type" column of the prop_defs table hold? Integers that each map to a column name, varchars that simply hold the column name? Any other possibilities? Would a stored procedure help me out here in some way? And what would the SQL for fetching the "name" property of object 2 look like?

    Read the article

  • How to measure a canvas that has auto height and width

    - by Wymmeroo
    Hi Folks, I'm a beginner in silverlight so i hope i can get an answer that brings me some more light in the measure process of silverlight. I found an interessting flap out control from silverlight slide control and now I try to use it in my project. So that the slide out is working proper, I have to place the user control on a canvas. The user control then uses for itself the height of its content. I just wanna change that behavior so that the height is set to the available space from the parent canvas. You see the uxBorder where the height is set. How can I measure the actual height and set it to the border? I tried it with Height={Binding ElementName=notificationCanvas, Path=ActualHeight} but this dependency property has no callback, so the actualHeight is never set. What I want to achieve is a usercontrol like the tweetboard per example on Jesse Liberty's blog Sorry for my English writing, I hope you understand my question. <Canvas x:Name="notificationCanvas" Background="Red"> <SlideEffectEx:SimpleSlideControl GripWidth="20" GripTitle="Task" GripHeight="100"> <Border x:Name="uxBorder" BorderThickness="2" CornerRadius="5" BorderBrush="DarkGray" Background="DarkGray" Padding="5" Width="300" Height="700" > <StackPanel> <TextBlock Text="Tasks"></TextBlock> <Button x:Name="btn1" Margin="5" Content="{Binding ElementName=MainBorder, Path=Height}"></Button> <Button x:Name="btn2" Margin="5" Content="Second Button"></Button> <Button x:Name="btn3" Margin="5" Content="Third Button"></Button> <Button x:Name="btn1_Copy" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy1" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy2" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy3" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy4" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy5" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy6" Margin="5" Content="First Button"/> </StackPanel> </Border> </SlideEffectEx:SimpleSlideControl>

    Read the article

  • JAXB doesn't unmarshal list of interfaces

    - by Joker_vD
    It seems JAXB can't read what it writes. Consider the following code: interface IFoo { void jump(); } @XmlRootElement class Bar implements IFoo { @XmlElement public String y; public Bar() { y = ""; } public Bar(String y) { this.y = y; } @Override public void jump() { System.out.println(y); } } @XmlRootElement class Baz implements IFoo { @XmlElement public int x; public Baz() { x = 0; } public Baz(int x) { this.x = x; } @Override public void jump() { System.out.println(x); } } @XmlRootElement public class Holder { private List<IFoo> things; public Holder() { things = new ArrayList<>(); } @XmlElementWrapper @XmlAnyElement public List<IFoo> getThings() { return things; } public void addThing(IFoo thing) { things.add(thing); } } // ... try { JAXBContext context = JAXBContext.newInstance(Holder.class, Bar.class, Baz.class); Holder holder = new Holder(); holder.addThing(new Bar("1")); holder.addThing(new Baz(2)); holder.addThing(new Baz(3)); for (IFoo thing : holder.getThings()) { thing.jump(); } StringWriter s = new StringWriter(); context.createMarshaller().marshal(holder, s); String data = s.toString(); System.out.println(data); StringReader t = new StringReader(data); Holder holder2 = (Holder)context.createUnmarshaller().unmarshal(t); for (IFoo thing : holder2.getThings()) { thing.jump(); } } catch (Exception e) { System.err.println(e.getMessage()); } It's a simplified example, of course. The point is that I have to store two very differently implemented classes, Bar and Baz, in one collection. Well, I observed that they have pretty similar public interface, so I created an interface IFoo and made them two to implement it. Now, I want to have tools to save and load this collection to/from XML. Unfortunately, this code doesn't quite work: the collection is saved, but then it cannot be loaded! The intended output is 1 2 3 some xml 1 2 3 But unfortunately, the actual output is 1 2 3 some xml com.sun.org.apache.xerces.internal.dom.ElementNSImpl cannot be cast to testapplication1.IFoo Apparently, I need to use the annotations in a different way? Or to give up on JAXB and look for something else? I, well, can write "XMLNode toXML()" method for all classes I wan't to (de)marshal, but...

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Killing Mysql processes staying in sleep command.

    - by Shino88
    Hey I am connecting a MYSQL database through hibernate and i seem to have processes that are not being killed after they are finished in the session. I have called flush and close on each session but when i check the server the last processes are still there with a sleep command. This is a new problem which i am having and was not the case yesterday. Is there any way i can ensure the killng of theses processes when i am done with a session. Below is an example of one of my classes. public JSONObject check() { //creates a new session needed to add elements to a database Session session = null; //holds the result of the check in the database JSONObject check = new JSONObject(); try{ //creates a new session needed to add elements to a database SessionFactory sessionFactory = new Configuration().configure().buildSessionFactory(); session = sessionFactory.openSession(); if (justusername){ //query created to select a username from user table String hquery = "Select username from User user Where username = ? "; //query created Query query = session.createQuery(hquery); //sets the username of the query the values JSONObject contents query.setString(0, username); // executes query and adds username string variable String user = (String) query.uniqueResult(); //checks to see if result is found (null if not found) if (user == null) { //adds false to Jobject if not found check.put("indatabase", "false"); } else { check.put("indatabase", "true"); } //adds check to Jobject to say just to check username check.put("justusername", true); } else { //query created to select a username and password from user table String hquery = "Select username from User user Where username = :user and password = :pass "; Query query = session.createQuery(hquery); query.setString("user", username); query.setString("pass", password); String user = (String) query.uniqueResult(); if(user ==null) { check.put("indatabase", false); } else { check.put("indatabase", true); } check.put("justusername", false); } }catch(Exception e){ System.out.println(e.getMessage()); //logg.log(Level.WARNING, " Exception", e.getMessage()); }finally{ // Actual contact insertion will happen at this step session.flush(); session.close(); } //returns Jobject return check; }

    Read the article

  • Stepping into Ruby Meta-Programming: Generating proxy methods for multiple internal methods

    - by mstksg
    Hi all; I've multiply heard Ruby touted for its super spectacular meta-programming capabilities, and I was wondering if anyone could help me get started with this problem. I have a class that works as an "archive" of sorts, with internal methods that process and output data based on an input. However, the items in the archive in the class itself are represented and processed with integers, for performance purposes. The actual items outside of the archive are known by their string representation, which is simply number_representation.to_s(36). Because of this, I have hooked up each internal method with a "proxy method" that converts the input into the integer form that the archive recognizes, runs the internal method, and converts the output (either a single other item, or a collection of them) back into strings. The naming convention is this: internal methods are represented by _method_name; their corresponding proxy method is represented by method_name, with no leading underscore. For example: class Archive ## PROXY METHODS ## ## input: string representation of id's ## output: string representation of id's def do_something_with id result = _do_something_with id.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_pair id_1,id_2 result = _do_something_with_pair id_1.to_i(36), id_2.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_these ids result = _do_something_with_these ids.map { |n| n.to_i(36) } return nil if result == nil return result.to_s(36) end def get_many_from id result = _get_many_from id return nil if result == nil # no sparse arrays returned return result.map { |n| n.to_s(36) } end ## INTERNAL METHODS ## ## input: integer representation of id's ## output: integer representation of id's def _do_something_with id # does something with one integer-represented id, # returning an id represented as an integer end def do_something_with_pair id_1,id_2 # does something with two integer-represented id's, # returning an id represented as an integer end def _do_something_with_these ids # does something with multiple integer ids, # returning an id represented as an integer end def _get_many_from id # does something with one integer-represented id, # returns a collection of id's represented as integers end end There are a couple of reasons why I can't just convert them if id.class == String at the beginning of the internal methods: These internal methods are somewhat computationally-intensive recursive functions, and I don't want the overhead of checking multiple times at every step There is no way, without adding an extra parameter, to tell whether or not to re-convert at the end I want to think of this as an exercise in understanding ruby meta-programming Does anyone have any ideas? edit The solution I'd like would preferably be able to take an array of method names @@PROXY_METHODS = [:do_something_with, :do_something_with_pair, :do_something_with_these, :get_many_from] iterate through them, and in each iteration, put out the proxy method. I'm not sure what would be done with the arguments, but is there a way to test for arguments of a method? If not, then simple duck typing/analogous concept would do as well.

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Trouble passing a string as a SQLite ExecSQL command

    - by Hackbrew
    I keep getting the ERROR: near "PassWord": syntax error when trying to execute the ExecSQL() statement. The command looks good in the output of the text file. In fact, I copied & pasted the command directly into SQLite Database Browser and the commend executed properly. Here's the code that's producing the error: procedure TForm1.Button1Click(Sender: TObject); var i, iFieldSize: integer; sFieldName, sFieldType, sFieldList, sExecSQL: String; names: TStringList; f1: Textfile; begin //Open Source table - Table1 has 8 fields but has only two different field types ftString and Boolean Table1.TableName:= 'PWFile'; Table1.Open; //FDConnection1.ExecSQL('drop table PWFile'); sFieldList := ''; names := TStringList.Create; for i := 0 to Table1.FieldCount - 1 do begin sFieldName := Table1.FieldDefList.FieldDefs[i].Name; sFieldType := GetEnumName(TypeInfo(TFieldType),ord(Table1.FieldDefList.FieldDefs[i].DataType)); iFieldSize := Table1.FieldDefList.FieldDefs[i].Size; if sFieldType = 'ftString' then sFieldType := 'NVARCHAR' + '(' + IntToStr(iFieldSize) + ')'; if sFieldType = 'ftBoolean' then sFieldType := 'INTEGER'; names.Add(sFieldName + ' ' + sFieldType); if sFieldList = '' then sFieldList := sFieldName + ' ' + sFieldType else sFieldList := sFieldList + ', ' + sFieldName + ' ' + sFieldType; end; ListBox1.Items.Add(sFieldList); sExecSQL := 'create table IF NOT EXISTS PWFile (' + sFieldList + ')'; // 08/18/2014 - Entered this to log the SQLite FDConnection1.ExecSQL Command to a file AssignFile(f1, 'C:\Users\Test User\Documents\SQLite_Command.txt'); Rewrite(f1); Writeln(f1, sExecSQL); { insert code here that would require a Flush before closing the file } Flush(f1); { ensures that the text was actually written to file } CloseFile(f1); FDConnection1.ExecSQL(sFieldList); Table1.Close; end; Here's the actual command that gets executed: create table IF NOT EXISTS PWFile (PassWord NVARCHAR(10), PassName NVARCHAR(10), Dept NVARCHAR(10), Active NVARCHAR(1), Admin INTEGER, Shred INTEGER, Reports INTEGER, Maintain INTEGER)

    Read the article

  • How do I make a full screen scrolling messagebox or window?

    - by chobo2
    Hi First let me start of saying I know absolutely nothing about c++ and I am really just more interested in getting this to work then learning c++(I got enough on my plate to learn). So basically I am trying to make a terms of service for my windows mobile 6 professional application but it seems I need to use c++ to do it. After hours of searching I found a solution but it developed for windows mobile standard. So they somehow used c++ to make a message box and on standard devices(ie non touch screen phones) the message box can have like scrolling. For some reason this is not the case with professional devices(touch screen devices). So my message box goes off the page and you can never accept or decline the terms. So your stuck and on the screen forever till you do some sort of soft restart. http://www.mobilepractices.com/2008/10/setupdll-sample-and-walkthrough-terms.html The above link is the tutorial but here is the actual file that seems to display the message. #include "stdafx.h" #include "ce_setup.h" // This is a variable containing the text to be displayed // in the Terms & Conditions dialog TCHAR Message[] = _T("TERMS & CONDITIONS\r\n ") _T("Selecting YES you're accepting our terms & conditions.\r\n") _T("This is just a sample application.\r\n") _T("From http://www.mobilepractices.com\r\n") _T("You can replace this text with your own.\r\n") _T("We're using a setup.dll to show this dialog.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Last line.\r\n") ; // This function will be called when the user // tries to install the cab. According to its return // value the installation continues or is cancelled. // As this could be called more than once // (i.e. if there is not enough space on the target) // we should take care about fFirstCall parameter // to show the dialog only once. codeINSTALL_INIT Install_Init( HWND hwndParent, BOOL fFirstCall, BOOL fPreviouslyInstalled, LPCTSTR pszInstallDir ) { if (!fFirstCall || ::MessageBoxW(0, Message, _T("SplashScreenSample") , MB_YESNO) == IDYES) return codeINSTALL_INIT_CONTINUE; else return codeINSTALL_INIT_CANCEL; } So I want to change this to something that can scroll. Can I use like a panel control since I know what has scroll or something else? Thanks

    Read the article

  • Does CakePHP treat all INT fields as ID's for join tables?

    - by Jonnie
    I am trying to save a User, their Profile, and some tags and my join table that links the profile and the tags keeps getting messed up. The profile model is called Instructor, the tag model is called Subject. The Instructor has a phone number and a zip code and for some reason CakePHP thinks these are the fields it should use when creating entries in my join table. My Join table always comes out as: id | instructor_id | subject_id | 1 | 90210 | 1 | // thinks that the zip code is an instructor_id 2 | 1112223333 | 1 | // thinks that the phone number is an instructor_id 3 | 1 | 1 | // thinks that user_id is an instructor_id 4 | 1 | 1 | // the actual instructor_id, this one's correct 5 | 90210 | 2 | 6 | 1112223333 | 2 | 3 | 1 | 2 | 4 | 1 | 2 | My Models: class Instructor extends AppModel { var $name = 'Instructor'; var $belongsTo = array('User', 'State'); var $hasAndBelongsToMany = array( 'Subject' = array( 'className' = 'Subject', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'instructor_id', 'associationForeignKey' = 'subject_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } class Subject extends AppModel { var $name = 'Subject'; var $hasAndBelongsToMany = array( 'Instructor' = array( 'className' = 'Instructor', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'subject_id', 'associationForeignKey' = 'instructor_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } My Model Associations: User hasOne Instructor Instructor belongsTo User Instructor hasAndBelongsToMany Subject Subject hasAndBelongsToMany Instructor My form data looks like: Array ( [User] = Array ( [username] = MrInstructor [password] = cddb06c93c72f34eb9408610529a34645c29c55d [group_id] = 2 ) [Instructor] = Array ( [name] = Jimmy Bob [email] = [email protected] [phone] = 1112223333 [city] = Beverly Hills [zip_code] = 90210 [states] = 5 [website] = www.jimmybobbaseballschool.com [description] = Jimmy Bob is an instructor. [user_id] = 1 [id] = 1 ) [Subject] = Array ( [name] = hitting, pitching ) ) My function for processing the form looks like: function instructor_register() { $this-set('groups', $this-User-Group-find('list')); $this-set('states', $this-User-Instructor-State-find('list')); if (!empty($this-data)) { // Set the group to Instructor $this-data['User']['group_id'] = 2; // Save the user data $user = $this-User-save($this-data, true, array( 'username', 'password', 'group_id' )); // If the user was saved, save the instructor's info if (!empty($user)) { $this-data['Instructor']['user_id'] = $this-User-id; $instructor = $this-User-Instructor-save($this-data, true, array( 'user_id', 'name', 'email', 'phone', 'city', 'zip_code', 'state_id', 'website', 'description' )); // If the instructor was saved, save the rest if(!empty($instructor)) { $instructorId = $this-User-Instructor-id; $this-data['Instructor']['id'] = $instructorId; // Save each subject seperately $subjects = explode(",", $this-data['Subject']['name']); foreach ($subjects as $_subject) { // Get the correct subject format $_subject = strtolower(trim($_subject)); $this-User-Instructor-Subject-create($this-data); $this-User-Instructor-Subject-set(array( 'name' = $_subject )); $this-User-Instructor-Subject-save(); echo ''; print_r($this-data); echo ''; } } } } }

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

< Previous Page | 267 268 269 270 271 272 273 274 275 276 277 278  | Next Page >