Search Results

Search found 47335 results on 1894 pages for 'find'.

Page 277/1894 | < Previous Page | 273 274 275 276 277 278 279 280 281 282 283 284  | Next Page >

• josso newbie setup problems - can't use tomcat's manager page

  - by opensas

  I'm trying to setup josso on an apache tomcat server running on windows. I've installed Apache Tomcat/6.0.26 fro zip file to c:\tomcat then installed josso following the documentation at http://www.josso.org/confluence/display/JOSSO1/Quick+Start started tomcat with c:\tomcat\bin\startup.bat, and noticed the following warnings ADVERTENCIA: [SetPropertiesRule]{Server/Service/Engine/Realm} Setting property ' debug' to '1' did not find a matching property. 21/03/2010 15:55:03 org.apache.tomcat.util.digester.SetPropertiesRule begin ADVERTENCIA: [SetPropertiesRule]{Server/Service/Engine/Host/Valve} Setting prope rty 'appName' to 'josso' did not find a matching property. ... ADVERTENCIA: Unable to find required classes (javax.activation.DataHandler and j avax.mail.internet.MimeMultipart). Attachment support is disabled. ... ADVERTENCIA: Bean with key 'josso:type=SSOAuditManager' has been registered as a n MBean but has no exposed attributes or operations ... but then everything seems to work fine, the problem is I can no longer access http://localhost:8080/manager/html using user tomcat /tomcat, as configured in \conf\tomcat-users.xml (before installing josso it worked) I tried with tomcat/tomcatpwd as defined in \lib\josso-credentials.xml and even added tomcat and the manager role to \lib\josso-users.xml, with no luck... Is anybody having the same problem? how can I access tomcat's manager page? Thanks a lot saludos sas This is my config: C:\tomcat\bincatalina version Using CATALINA_BASE: "C:\tomcat" Using CATALINA_HOME: "C:\tomcat" Using CATALINA_TMPDIR: "C:\tomcat\temp" Using JRE_HOME: "c:\java" Using CLASSPATH: "C:\tomcat\bin\bootstrap.jar" Server version: Apache Tomcat/6.0.26 Server built: March 9 2010 1805 Server number: 6.0.26.0 OS Name: Windows XP OS Version: 5.1 Architecture: x86 JVM Version: 1.5.0_22-b03 JVM Vendor: Sun Microsystems Inc ps: moreover, when shutting down, I get a couple of error like this GRAVE: A web application appears to have started a thread named [JOSSOAssertionM onitor] but has failed to stop it. This is very likely to create a memory leak. 21/03/2010 15:57:06 org.apache.catalina.loader.WebappClassLoader clearReferences Threads and then tomcat's shutdown freezes at 21/03/2010 15:57:07 org.apache.coyote.ajp.AjpAprProtocol destroy INFO: Parando Coyote AJP/1.3 en ajp-8009 ps: sorry for this lengthy question...

  Read the article

• Add incremental numbers at the end of a string in a loop in Javascript.

  - by Kyle Sevenoaks

  This Javascript is part of a Foreach loop. var stickytooltip={ tooltipoffsets: [20, -30], //additional x and y offset from mouse cursor for tooltips fadeinspeed: 200, //duration of fade effect in milliseconds rightclickstick: false, //sticky tooltip when user right clicks over the triggering element (apart from pressing "s" key) ? stickybordercolors: ["#0a5692", "#0a5692"], //border color of tooltip depending on sticky state stickynotice: ["Press \"s\"", "or right click", "to sticky box"], //customize tooltip status message stickynotice2: "Click outside this box to hide it", //customize tooltip status message //***** NO NEED TO EDIT BEYOND HERE isdocked: false, positiontooltip:function($, $tooltip, e){ var x=e.pageX+this.tooltipoffsets[0], y=e.pageY+this.tooltipoffsets[1] var tipw=$tooltip.outerWidth(), tiph=$tooltip.outerHeight(), x=(x+tipw>$(document).scrollLeft()+$(window).width())? x-tipw-(stickytooltip.tooltipoffsets[0]*2) : x y=(y+tiph>$(document).scrollTop()+$(window).height())? $(document).scrollTop()+$(window).height()-tiph-10 : y $tooltip.css({left:x, top:y}) }, showbox:function($, $tooltip, e){ $tooltip.fadeIn(this.fadeinspeed) this.positiontooltip($, $tooltip, e) }, hidebox:function($, $tooltip){ if (!this.isdocked){ $tooltip.stop(false, true).hide() $tooltip.css({borderColor:'black'}).find('.stickystatus:eq(0)').css({background:this.stickybordercolors[0]}).html(this.stickynotice) } }, docktooltip:function($, $tooltip, e){ this.isdocked=true $tooltip.css({borderColor:'darkred'}).find('.stickystatus:eq(0)').css({background:this.stickybordercolors[1]}).html(this.stickynotice) }, init:function(targetselector, tipid){ jQuery(document).ready(function($){ var $targets=$(targetselector) var $tooltip=$('#'+tipid).appendTo(document.body) if ($targets.length==0) return var $alltips=$tooltip.find('div.atip') if (!stickytooltip.rightclickstick) stickytooltip.stickynotice[1]='' stickytooltip.stickynotice=stickytooltip.stickynotice.join(' ') stickytooltip.hidebox($, $tooltip) $targets.bind('mouseenter', function(e){ $alltips.hide().filter('#'+$(this).attr('data-tooltip')).show() stickytooltip.showbox($, $tooltip, e) }) $targets.bind('mouseleave', function(e){ stickytooltip.hidebox($, $tooltip) }) $targets.bind('mousemove', function(e){ if (!stickytooltip.isdocked){ stickytooltip.positiontooltip($, $tooltip, e) } }) $tooltip.bind("mouseenter", function(){ stickytooltip.hidebox($, $tooltip) }) $tooltip.bind("click", function(e){ e.stopPropagation() }) $(this).bind("click", function(e){ if (e.button==0){ stickytooltip.isdocked=false stickytooltip.hidebox($, $tooltip) } }) $(this).bind("contextmenu", function(e){ if (stickytooltip.rightclickstick && $(e.target).parents().andSelf().filter(targetselector).length==1){ //if oncontextmenu over a target element stickytooltip.docktooltip($, $tooltip, e) return false } }) $(this).bind('keypress', function(e){ var keyunicode=e.charCode || e.keyCode if (keyunicode==115){ //if "s" key was pressed stickytooltip.docktooltip($, $tooltip, e) } }) }) //end dom ready } } //stickytooltip.init("targetElementSelector", "tooltipcontainer") stickytooltip.init("*[data-tooltip]", "mystickytooltip") I need to just add some code to the end of "mystickytooltip" to add 1, 2, 3, 4 each time it loops. My JS-foo is nonexistant, please help :)

  Read the article

• Design patter to keep track UITableView rows correspondance to underlying data in constant time.

  - by DenNukem

  When my model changes I want to animate changes in UITableView by inserting/deleting rows. For that I need to know the ordinal of the given row (so I can construct NSIndexPath), which I find hard to do in better-than-linear time. For example, consider that I have a list of addressbook entries which are manualy sorted by the user, i.e. there is no ordering "key" that represents the sort order. There is also a corresponding UITableView that shows one row per addressbook entry. When UITableView queries the datasource I query the NSMUtableArray populated with my entries and return required data in constant time for each row. However, if there is a change in underlying model I am getting a notification "Joe Smith, id#123 has been removed". Now I have a dilemma. A naive approach would be to scan the array, determine the index at which Joe Smith is and then ask UITableView to remove that precise row from the view, also removing it form the array. However, the scan will take linear time to finish. Now I could have an NSDictionary which allows me to find Joe Smith in constant time, but that doesn't do me a lot of good because I still need to find his ordinal index within the array in order to instruct UITableView to remove that row, which is again a linear search. I could further decide to store each object's ordinal inside the object itself to make it constant, but it will become outdated after first such update as all subsequent index values will have changed due to removal of an object. So what is the correct design pattern to accurately reflect model changes in the UITableView in costant (or at least logarithmic) time?

  Read the article

• Advice moving from Eclipse to xCode

  - by Gloin the Dark

  To xCode xPerts: I have been doing Java in Eclipse for about 9 years now and I have really gotten used to the power of the refactoring tools. There are a few operations I do all the time. I am looking for equivalents in xCode since it has better support for objective-c than eclipse. (I'm not at my Mac as I write this. So some of this is from memory. I am still very new to xCode.) 1 "rename". It seems that the xCode equivalent for variables is "edit all in scope". Does this work for files/classes/methods too? 2 "extract local variable" select an expression it creates a local var initialized to that expression. It even creates a usable name for the variable. 3 "extract method" select some code and it will create a method with that code and appropriate parameters/return value. 4 "inline" (variable or method) opposite of extract, inlines all or just the selected occurrence of the selected var or method. 5 "find next" occurrence of selected text. In eclipse I can select some text and hit ctrl-k to go to the next occurrence of that in the file. likewise shift-ctrl-k finds backwards. IIRC the xCode "find next" ignores the selection and only uses what is in the find box. 6 "change method signature" This would be very useful with ocjective-c's named parameter messaging syntax. This is great for adding parameters to a method. 7 "pull-up/push-down" for moving methods up or down the class hierarchy. 8 "move" for moving elements around to other classes etc. Those are the ones that I use all of the time. I have estimated that these tools cut my coding time in half. Are any of these supported in xCode? Thanks in advance for any advice.

  Read the article

• WPF UI Automation - AutomationElement.FindFirst fails when there are lots of elements

  - by Orion Edwards

  We've got some automated UI tests for our WPF app (.NET 4); these test use the UI Automation API's. We call AutomationElement.FindFirst to find a target element, and then interact with it. Example (pseudocode): var nameEquals = new PropertyCondition(AutomationElement.NameProperty, "OurAppWindow"); var appWindow = DesktopWindow.FindFirst(TreeScope.Children, nameEquals); // this succeeds var idEquals = new PropertyCondition(AutomationElement.AutomationIdProperty, "ControlId"); var someItem = appWindow.FindFirst(TreeScope.Descendants, idEquals); // this suceeds sometimes, and fails sometimes! The problem is, the appWindow.FindFirst will sometimes fail and return null, even when the element is present. I've written a helper function which walks the UI automation tree manually and prints it out, and the element with the correct ID is present in all cases. It seems to be related to how many other items are also being displayed in the window. If there are no other items then it always succeeds, but when there are many other complex UI elements being displayed alongside it, then the find fails. I can't find any documented element limit mentioned for any of the automation API's - is there some way around this? I'm thinking I might have to write my own implemententation of FindFirst which does the tree walk manually itself... As far as I can tell this should work, because my tree-printer utility function does exactly that, and it's ok, but it seems like this would be unnecessary and slow :-( Any help would be greatly appreciated

  Read the article

• Most efficient way of creating tree from adjacency list

  - by Jeff Meatball Yang

  I have an adjacency list of objects (rows loaded from SQL database with the key and it's parent key) that I need to use to build an unordered tree. It's guaranteed to not have cycles. This is taking wayyy too long (processed only ~3K out of 870K nodes in about 5 minutes). Running on my workstation Core 2 Duo with plenty of RAM. Any ideas on how to make this faster? public class StampHierarchy { private StampNode _root; private SortedList<int, StampNode> _keyNodeIndex; // takes a list of nodes and builds a tree // starting at _root private void BuildHierarchy(List<StampNode> nodes) { Stack<StampNode> processor = new Stack<StampNode>(); _keyNodeIndex = new SortedList<int, StampNode>(nodes.Count); // find the root _root = nodes.Find(n => n.Parent == 0); // find children... processor.Push(_root); while (processor.Count != 0) { StampNode current = processor.Pop(); // keep a direct link to the node via the key _keyNodeIndex.Add(current.Key, current); // add children current.Children.AddRange(nodes.Where(n => n.Parent == current.Key)); // queue the children foreach (StampNode child in current.Children) { processor.Push(child); nodes.Remove(child); // thought this might help the Where above } } } } public class StampNode { // properties: int Key, int Parent, string Name, List<StampNode> Children }

  Read the article

• Python equivalent of IDL's stop and .reset

  - by Jamie

  Hi there, I'm relatively new to python but have a bit of experience using IDL. I was wondering if anyone knows if there are equivalent commands in python for IDL's stop and .reset commands. If I'm running some IDL script I wrote that I put a stop command in, essentially what it does is stop the script there and give me access to the command line in the middle of the script. So I have access to all the functions and variables that I defined before the stop command, which I find really useful for debugging. The .reset command I find extremely useful too. What it does is reset the the IDL environment (clears all variables, functions, etc.). It's as if I closed that session and opened a new one, but without having to exit and restart IDL. I find that if I'm trying to debug a script I wrote it's useful sometimes to start from scratch and not have to reset IDL (or python now). It would be useful also in python to be able to un-import any modules I had previously imported. Any help with these issues would be greatly appreciated. Cheers Related Python Drop into REPL Is it possible to go into ipython from code?

  Read the article

• Issues in Convergence of Sequential minimal optimization for SVM

  - by Amol Joshi

  I have been working on Support Vector Machine for about 2 months now. I have coded SVM myself and for the optimization problem of SVM, I have used Sequential Minimal Optimization(SMO) by Mr. John Platt. Right now I am in the phase where I am going to grid search to find optimal C value for my dataset. ( Please find details of my project application and dataset details here http://stackoverflow.com/questions/2284059/svm-classification-minimum-number-of-input-sets-for-each-class) I have successfully checked my custom implemented SVM`s accuracy for C values ranging from 2^0 to 2^6. But now I am having some issues regarding the convergence of the SMO for C 128. Like I have tried to find the alpha values for C=128 and it is taking long time before it actually converges and successfully gives alpha values. Time taken for the SMO to converge is about 5 hours for C=100. This huge I think ( because SMO is supposed to be fast. ) though I`m getting good accuracy? I am screwed right not because I can not test the accuracy for higher values of C. I am actually displaying number of alphas changed in every pass of SMO and getting 10, 13, 8... alphas changing continuously. The KKT conditions assures convergence so what is so weird happening here? Please note that my implementation is working fine for C<=100 with good accuracy though the execution time is long. Please give me inputs on this issue. Thank You and Cheers.

  Read the article

• jQuery cycle plugin customizing

  - by spirax

  I'm using the jQuery Cycle plugin to start a slidshow of images when hovering over the initial image. This works fine. What I want after that is to have the slideshow stop when hovered off, and have a manual slideshow (next/prev buttons) start. This currently works, but the slideshow starts from the beginning each time it's initialized. I want it to begin at the current image that's loaded. I was playing around with getting the image's index from the DOM (as it's the only one with display:block) and using the option 'startingSlide' to resume it, but my index keeps returning as -1. jQuery('#home-menu li').hover(function() { setImages(jQuery(this).attr('title'), jQuery(this).find('.subtitle').text()); jQuery('#main .blog #projects .gallery .slideshow').cycle( { fx: 'scrollHorz', easing: 'easeOutBounce', speed: 2000, delay: 0 }); }, function() { // Before loading the images for the clickable slideshow, find the current image in the DOM array to use as the starting position slideshowStart = jQuery('.gallery .slideshow img:visible').index(this); console.log('Index: ' + slideshowStart); setImages(jQuery(this).attr('title'), jQuery(this).find('.subtitle').text()); jQuery('#main .blog #projects .gallery .slideshow').cycle('stop').cycle( { fx: 'scrollHorz', easing: 'easeOutBounce', startingSlide: slideshowStart, speed: 2000, timeout: 0, next: "#main .blog #projects .gallery span.span2", prev: "#main .blog #projects .gallery span.span1" }); }); setImages() just loads images into the DOM based on what li is being hovered over. Nothing special there. I want the image to be resumed when hovered over and hovered off. I've left out the resume part for hover on for the moment while I was trying to get it working - In case you were wondering.

  Read the article

• sample java code for approximate string matching or boyer-moore extended for approximate string matc

  - by Dolphin

  Hi I need to find 1.mismatch(incorrectly played notes), 2.insertion(additional played), & 3.deletion (missed notes), in a music piece (e.g. note pitches [string values] stored in a table) against a reference music piece. This is either possible through exact string matching algorithms or dynamic programming/ approximate string matching algos. However I realised that approximate string matching is more appropriate for my problem due to identifying mismatch, insertion, deletion of notes. Or an extended version of Boyer-moore to support approx. string matching. Is there any link for sample java code I can try out approximate string matching? I find complex explanations and equations - but I hope I could do well with some sample code and simple explanations. Or can I find any sample java code on boyer-moore extended for approx. string matching? I understand the boyer-moore concept, but having troubles with adjusting it to support approx. string matching (i.e. to support mismatch, insertion, deletion). Also what is the most efficient approx. string matching algorithm (like boyer-moore in exact string matching algo)? Greatly appreciate any insight/ suggestions. Many thanks in advance

  Read the article

• IRC Server configuration possibilities

  - by Katai

  I need to know a couple of things, concerning IRC servers that I couldnt directly find out over google (or werent clear enough for me to be sure if it actually works) I'm working at a larger community site, and wanted to deliver an in-page chat. Since it would be a nice feature to let people access it from outside too, over their own clients, I tought implementing an IRC Server would be the best solution (probably dedicated, I'll have to teach myself a couple of things for that) I plan to include a Web-based IRC client over an APE Client / Server. The problem is, I want to strip down the user rights, to disallow many functionalities that IRC would offer: Change of nicknames: The user logs in over the Page login, and I'll automatically create an IRC auth for this user with that password. So basically, he would connect to the IRC client over a button. And after connecting, he shouldnt be able to change his nickname at all Creating channels: I want the possibility to create channels, but not from 'normal' users. Basically, I would prefer to set up basic channels that are public, and if a user really creates an own channel, that one should be private and via invitation (is that possible?) Private conversations: private conversations should be filtered out from the allaround IRC client, into separate 'in-browser-windows' that I create over JS. I guess I just have to filter the stuff coming from IRC - or is there a better solution to that? Only 'registered' users have access: Like I said, if someone registers on the page, I would like to create an IRC 'account' for him. Users that arent registered on the page, cant access the IRC server at all (or get thrown out). Mainly to avoid spammers or bots from outside. Is this stuff solvable over IRC? I've read some FAQ's and Instructions for IRC OP's and servers, but I couldnt find a clear answer - it seems that everyone can do pretty much everything - I would like to configure it in a way that user possibilities are more cut down. Basically, giving users the possibility to chat, but not more. So the Question basically is, how possible / solvable this issues are allaround, or if I have to find other solutions for this.

  Read the article

• VB.Net Custom Object Master-Detail Data Binding

  - by clawson

  Since beginning to use VB.Net some years ago I have become slowly familiar with using the data binding features of .Net, however I often find my self bewildered by it's behavior and instead of discover the correct way it should work I find some dirty work around to suit my needs and continue on. Needless to say my problems continue to arise. I am using Custom Objects as the Data Sources for by controls and often entire forms. I find it frustrating to separate business logic and the graphical interface. (That could be a new question entirely.) So for a lot of objects I generate a form which has the DataBindingSource for the object. When I create each from using the New Constructor I explicitly pass to it the object to which it should be bound, and then set this passed object as the DataSource of the BindingSource. (That's a mouthful!) Now the Master object (say, bound to each form) often contains a List of objects which I like to have displayed in a DataGridView. I (sometimes) create and modify these child objects in their own form (again creating a databind the same way as the master form) but when I add them to the List in the master object the DataGridView won't update with the new items. So my question really has a few layers: How can I easily/efficiently/correctly update this DataGridView with the list of Detail objects when I add them to the list of the Master object. Is this approach to DataBinding good/viable. What's the best way to separate business logic from graphical interface. Thanks for the help!

  Read the article

• Reference for proper handling of PID file on Unix

  - by bignose

  Where can I find a well-respected reference that details the proper handling of PID files on Unix? On Unix operating systems, it is common practice to “lock” a program (often a daemon) by use of a special lock file: the PID file. This is a file in a predictable location, often ‘/var/run/foo.pid’. The program is supposed to check when it starts up whether the PID file exists and, if the file does exist, exit with an error. So it's a kind of advisory, collaborative locking mechanism. The file contains a single line of text, being the numeric process ID (hence the name “PID file”) of the process that currently holds the lock; this allows an easy way to automate sending a signal to the process that holds the lock. What I can't find is a good reference on expected or “best practice” behaviour for handling PID files. There are various nuances: how to actually lock the file (don't bother? use the kernel? what about platform incompatibilities?), handling stale locks (silently delete them? when to check?), when exactly to acquire and release the lock, and so forth. Where can I find a respected, most-authoritative reference (ideally on the level of W. Richard Stevens) for this small topic?

  Read the article

• rails search nested set (categories and sub categories)

  - by bob

  Hello, I am using the http://github.com/collectiveidea/awesome_nested_set awesome nested set plugin and currently, if I choose a sub category as my category_id for an item, I can not search by its parent. Category.parent Category.Child I choose Category.child as the category that my item is in. So now my item has category_id of 4 stored in it. If I go to a page in my rails application, lets say teh Category page and I am on the Category.parent's page, I want to show products that have category_id's of all the descendants as well. So ideally i want to have a find method that can take into account the descendants. You can get the descendants of a root by calling root.descendants (a built in plugin method). How would I go about making it so I can query a find that gets the descendants of a root instead of what its doing now which is binging up nothing unless the product had a specific category_id of the Category.parent. I hope I am being clear here. I either need to figure out a way to create a find method or named_scope that can query and return an array of objects that have id's corresponding tot he descendants of a root OR if I have any other options, what are they? I thought about creating a field in my products table like parent_id which can keep track of the parent so i can then create two named scopes one finding the parent stuff and one finding the child stuff and chaining them. I know I can create a named scope for each child and chain them together for multiple children but this seems a very tedious process and also, if you add more children, you would need to specify more named scopes.

  Read the article

• Optimizing code using PIL

  - by freakazo

  Firstly sorry for the long piece of code pasted below. This is my first time actually having to worry about performance of an application so I haven't really ever worried about performance. This piece of code pretty much searches for an image inside another image, it takes 30 seconds to run on my computer, converting the images to greyscale and other changes shaved of 15 seconds, I need another 15 shaved off. I did read a bunch of pages and looked at examples but I couldn't find the same problems in my code. So any help would be greatly appreciated. From the looks of it (cProfile) 25 seconds is spent within the Image module, and only 5 seconds in my code. from PIL import Image import os, ImageGrab, pdb, time, win32api, win32con import cProfile def GetImage(name): name = name + '.bmp' try: print(os.path.join(os.getcwd(),"Images",name)) image = Image.open(os.path.join(os.getcwd(),"Images",name)) except: print('error opening image;', name) return image def Find(name): image = GetImage(name) imagebbox = image.getbbox() screen = ImageGrab.grab() #screen = Image.open(os.path.join(os.getcwd(),"Images","Untitled.bmp")) YLimit = screen.getbbox()[3] - imagebbox[3] XLimit = screen.getbbox()[2] - imagebbox[2] image = image.convert("L") Screen = screen.convert("L") Screen.load() image.load() #print(XLimit, YLimit) Found = False image = image.getdata() for y in range(0,YLimit): for x in range(0,XLimit): BoxCoordinates = x, y, x+imagebbox[2], y+imagebbox[3] ScreenGrab = screen.crop(BoxCoordinates) ScreenGrab = ScreenGrab.getdata() if image == ScreenGrab: Found = True #print("woop") return x,y if Found == False: return "Not Found" cProfile.run('print(Find("Login"))')

  Read the article

• Some general C questions.

  - by b-gen-jack-o-neill

  Hello. I am trying to fully understand the process pro writing code in some language to execution by OS. In my case, the language would be C and the OS would be Windows. So far, I read many different articles, but I am not sure, whether I understand the process right, and I would like to ask you if you know some good articles on some subjects I couldn´t find. So, what I think I know about C (and basically other languages): C compiler itself handles only data types, basic math operations, pointers operations, and work with functions. By work with functions I mean how to pass argument to it, and how to get output from function. During compilation, function call is replaced by passing arguments to stack, and than if function is not inline, its call is replaced by some symbol for linker. Linker than find the function definition, and replace the symbol to jump adress to that function (and of course than jump back to program). If the above is generally true and I get it right, where to final .exe file actually linker saves the functions? After the main() function? And what creates the .exe header? Compiler or Linker? Now, additional capabilities of C, today known as C standart library is set of functions and the declarations of them, that other programmers wrote to extend and simplify use of C language. But these functions like printf() were (or could be?) written in different language, or assembler. And there comes my next question, can be, for example printf() function be written in pure C without use of assembler? I know this is quite big question, but I just mostly want to know, wheather I am right or not. And trust me, I read a lots of articles on the web, and I would not ask you, If I could find these infromation together on one place, in one article. Insted I must piece by piece gather informations, so I am not sure if I am right. Thanks.

  Read the article

• Why won't .attr('checked','checked') set?

  - by Jason

  I have the following snippet of code (I'm using jQuery 1.4.2): $.post('/Ads/GetAdStatsRow/', { 'ad_id': id }, function(result) { $('#edit_ads_form tbody').prepend(result); $(result).find('td.select-ad input').attr('checked','checked').click(); }); Assume that the post works correctly and returns a correct pre-built <tr> with some <td>s. Here's the weirdness: the $(result).find() line finds the correct input (which is a checkbox, as it's the only input in the cell) and runs the chained click() function correctly, but it REFUSES to set the box as checked, which I need to happen. Here's a crazy twist, too... when I get super specific and change the $(result).find() line to this (the id of the checkbox): $('#ad_' + id).click(); It checks the box, but doesn't run the click() function! If I set it to $('#ad_' + id).attr('checked','checked').click(); it runs the click function as though the box were checked, but the box remains unchecked, and if I do $('#ad_' + id).click().attr('checked','checked'); it does nothing at all. What in the world could be the matter with this? I'm running out of hair.... Thanks!

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• What is best strategy to handle exceptions & errors in Rails?

  - by Nick Gorbikoff

  Hello. I was wondering if people would share their best practices / strategies on handling exceptions & errors. Now I'm not asking when to throw an exception ( it has been throroughly answered here: SO: When to throw and Exception) . And I'm not using this for my application flow - but there are legitimate exceptions that happen all the time. For example the most popular one would be ActiveRecordNotFound. What would be the best way to handle it? The DRY way? Right now I'm doing a lot of checking within my controller so if Post.find(5) returns Nil - I check for that and throw a flash message. However while this is very granular - it's a bit cumbersome in a sense that I need to check for exceptions like that in every controller, while most of them are essentially the same and have to do with record not found or related records not found - such as either Post.find(5) not found or if you are trying to display comments related to post that doesn't exist, that would throw an exception (something like Post.find(5).comments[0].created_at) I know you can do something like this in ApplicationController and overwrite it later in a particular controller/method to get more granular support, however would that be a proper way to do it? class ApplicationController < ActionController::Base rescue_from ActiveRecord::RecordInvalid do |exception| render :action => (exception.record.new_record? ? :new : :edit) end end

  Read the article

• VPython in Eclipse - thinks it has the wrong architecture type.

  - by Duncan Tait

  Evening, So I've recently installed VPython on my MacBook (OS X, Snow Leopard) - and it works absolutely fine in IDLE and from the command line (interactive mode). However, eclipse has issues. Firstly it couldn't find it (which is a bit of an issue actually with all these 'easy install' python modules - when they don't tell you where they actually install to!) but I searched it out in the depths of Library\Frameworks... and added that to the System PYTHONPATH listbox in Eclipse. Now it can find it, but it says the following: Traceback (most recent call last): File "/Users/duncantait/dev/workspace/Network_Simulation/src/Basic/Net_Sim1.py", line 15, in <module> import visual File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/__init__.py", line 59, in <module> import cvisual ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so: mach-o, but wrong architecture I am guessing that VPython might not be built for a 64-bit architecture (Intel), but the fact remains that it works in both IDLE and command prompt... So there must be a way to configure Eclipse to run it right? (Wishful thinking). Thanks for any help! Duncan

  Read the article

• How to test a DAO with JPA implementation ?

  - by smallufo

  Hi I came from the Spring camp , I don't want to use Spring , and am migrating to JavaEE6 , But I have problem testing DAO + JPA , here is my simplified sample : public interface PersonDao { public Person get(long id); } This is a very basic DAO , because I came from Spring , I believe DAO still have it value , so I decided to add a DAO layer . public class PersonDaoImpl implements PersonDao , Serializable { @PersistenceContext(unitName = "test", type = PersistenceContextType.EXTENDED) EntityManager entityManager ; public PersonDaoImpl() { } @Override public Person get(long id) { return entityManager .find(Person.class , id); } } This is a JPA-implemented DAO , I hope the EE container or the test container able to inject the EntityManager. public class PersonDaoImplTest extends TestCase { @Inject protected PersonDao personDao; @Override protected void setUp() throws Exception { //personDao = new PersonDaoImpl(); } public void testGet() { System.out.println("personDao = " + personDao); // NULL ! Person p = personDao.get(1L); System.out.println("p = " + p); } } This is my test file . OK , here comes the problem : Because JUnit doesn't understand @javax.inject.Inject , the PersonDao will not be able to injected , the test will fail. How do I find a test framework that able to inject the EntityManager to the PersonDaoImpl , and @Inject the PersonDaoImpl to the PersonDao of TestCase ? I tried unitils.org , but cannot find a sample like this , it just directly inject the EntityManagerFactory to the TestCast , not what I want ...

  Read the article

• Setting up DrJava to work through Friedman / Felleisen "A Little Java"

  - by JDelage

  All, I'm going through the Friedman & Felleisen book "A Little Java, A Few Patterns". I'm trying to type the examples in DrJava, but I'm getting some errors. I'm a beginner, so I might be making rookie mistakes. Here is what I have set-up: public class ALittleJava { //ABSTRACT CLASS POINT abstract class Point { abstract int distanceToO(); } class CartesianPt extends Point { int x; int y; int distanceToO(){ return((int)Math.sqrt(x*x+y*y)); } CartesianPt(int _x, int _y) { x=_x; y=_y; } } class ManhattanPt extends Point { int x; int y; int distanceToO(){ return(x+y); } ManhattanPt(int _x, int _y){ x=_x; y=_y; } } } And on the main's side: public class Main{ public static void main (String [] args){ Point y = new ManhattanPt(2,8); System.out.println(y.distanceToO()); } } The compiler cannot find the symbols Point and ManhattanPt in the program. If I precede each by ALittleJava., I get another error in the main, i.e., an enclosing instance that contains ALittleJava.ManhattanPt is required I've tried to find ressources on the 'net, but the book must have a pretty confidential following and I couldn't find much. Thank you all. JDelage

  Read the article

• Three.js: texture to datatexture

  - by Alessandro Pezzato

  I'm trying to implement a delayed webcam viewer in javascript, using Three.js for WebGL capabilities. I need to store frames grabbed from webcam, so they can be shown after some time (some milliseconds to some seconds). I'm able to do this without Three.js, using canvas and getImageData(). You can find an example on jsfidle. I'm trying to find a way to do this without canvas, but using Three.js Texture or DataTexture object. Here an example of what I'm trying. The problem is that I cannot find how to copy the image from a Texture (image is of type HTMLVideoElement) to another. In rotateFrames() function the older frame should be lost and newer should replace, like in a FIFO. But the line frames[i].image = frames[i + 1].image; is just copying the reference, not the texture data. I guess DataTexture should do this, but I'm not able to get a DataTexture out of a Texture or HTMLVideoElement. Any idea?

  Read the article

• Algorithms for finding a numerical record in a list of ordered numbers

  - by Ankur

  I have a list of incomplete ordered numbers. I want to find a particular number with as few steps as possible. Are there any improvements on this algorithm, I assume you can count the set size without difficulty - it will be stored and updated every time a new item is added. Your object is to get your cursor over the value x The first number (smallest) is s, and the last number (greatest) is g. Take the midpoint m1 of the set: calculate is x < m1, If yes then s <= x < m1 If no then m1 < x <= g If m1 = x then you're done. Keep repeating till you find x. Basically dividing the set into two parts with each iteration till you hit x. The purpose is to retrieve a numerical id from a very large table to then find the associated other records. I would imagine this is the most trivial kind of indexing available, are there improvements?

  Read the article

• How to get Firebug to tell me what error jquery's .load() is returning?

  - by Edward Tanguay

  I'm trying to find out what data/error jquery's .load() method is returning in the following code (the #content element is blank so I assume there is some kind of error). Where do I find in Firebug what content or error .load() is returning? How can I use console.log to find out at least what content is being returned? <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <script type="text/javascript" src="http://www.google.com/jsapi"></script> <script type="text/javascript"> google.load("jquery", "1.3.2"); google.setOnLoadCallback(function() { $('#loadButton').click(loadDataFromExernalWebsite); }); function loadDataFromExernalWebsite() { console.log("test"); $('#content').load('http://www.tanguay.info/web/getdata/index.php?url=http://www.tanguay.info/knowsite/data.txt', function() { alert('Load was performed.'); }); } </script> </head> <body> <p>Click the button to load content:</p> <p id="content"></p> <input id="loadButton" type="button" value="load content"/> </body> </html>

  Read the article

< Previous Page | 273 274 275 276 277 278 279 280 281 282 283 284  | Next Page >