Search Results

Search found 18160 results on 727 pages for 'jdk 7 feature complete'.

Page 297/727 | < Previous Page | 293 294 295 296 297 298 299 300 301 302 303 304  | Next Page >

  • How to initiate a remote SVN update on server

    - by Bryan
    I'm using SVN for a project, and for easy deployments to the server we're just using another SVN enlistment there. So I've been using Remote Desktop to log onto the server and then trigger an update (we use Tortoise SVN). Is there an existing tool (or SVN feature) that would allow me to trigger this update without logging on to the server and doing it manually?

    Read the article

  • Vim: open files of the matches on the lines given by Grep?

    - by HH
    I want to get automatically to the positions of the results in Vim after grepping, on command line. Is there such feature? Files to open in Vim on the lines given by grep: % grep --colour -n checkWordInFile * SearchToUser.java:170: public boolean checkWordInFile(String word, File file) { SearchToUser.java~:17: public boolean checkWordInFile(String word, File file) { SearchToUser.java~:41: if(checkWordInFile(word, f))

    Read the article

  • rails backgroundjob running jobs in parallel?

    - by Damir Horvat
    I'm very happy with By so far, only I have this one issue: When one process takes 1 or 2 hours to complete, all other jobs in the queue seem to wait for that one job to finish. Worse still is when uploading to a server which time's out regularly. My question: is Bj running jobs in parallel or one after another? Thank you, Damir

    Read the article

  • java GC periodically enters into several full GC cycles

    - by Peter
    Environment: sun JDK 1.6.0_16 vm settings: -XX:+DisableExplicitGC -XX:+UseConcMarkSweepGC -Xms1024 -Xmx1024M -XX:MaxNewSize=448m -XX:NewSize=448m -XX:SurvivorRatio=4(6 also checked) -XX:MaxPermSize=128M OS: windows server 2003 processor: 4 cores of INTEL XEON 5130, 2000 Hz my application description: high intensity of concurrent(java 5 concurrency used) operations completed each time by commit to oracle. it's about 20-30 threads run non stop, doing tasks. application runs in JBOSS web container. My GC starts work normally, I see a lot of small GCs and all that time CPU shows good load, like all 4 cores loaded to 40-50%, CPU graph is stable. Then , after 1 min of good work, CPU starts drop to 0% on 2 cores from 4, it's graph becomes unstable, goes up and down("teeth"). I see, that my threads work slower(I have monitoring), I see that GC starts produce a lot of FULL GC during that time and next 4-5 minutes this situation remains as is, then for short period of time, like 1 minute, it gets back to normal situation, but shortly after that all bad thing repeats. Question: Why I have so frequent full GC??? How to prevent that? I played with SurvivorRatio - does not help. I noticed, that application behaves normally until first FULL GC occurs, while I have enough memory. Then it runs badly. my GC LOG: starts good then long period of FULL GCs(many of them) 1027.861: [GC 942200K-623526K(991232K), 0.0887588 secs] 1029.333: [GC 803279K(991232K), 0.0927470 secs] 1030.551: [GC 967485K-625549K(991232K), 0.0823024 secs] 1030.634: [GC 625957K(991232K), 0.0763656 secs] 1033.126: [GC 969613K-632963K(991232K), 0.0850611 secs] 1033.281: [GC 649899K(991232K), 0.0378358 secs] 1035.910: [GC 813948K(991232K), 0.3540375 secs] 1037.994: [GC 967729K-637198K(991232K), 0.0826042 secs] 1038.435: [GC 710309K(991232K), 0.1370703 secs] 1039.665: [GC 980494K-972462K(991232K), 0.6398589 secs] 1040.306: [Full GC 972462K-619643K(991232K), 3.7780597 secs] 1044.093: [GC 620103K(991232K), 0.0695221 secs] 1047.870: [Full GC 991231K-626514K(991232K), 3.8732457 secs] 1053.739: [GC 942140K(991232K), 0.5410483 secs] 1056.343: [Full GC 991232K-634157K(991232K), 3.9071443 secs] 1061.257: [GC 786274K(991232K), 0.3106603 secs] 1065.229: [Full GC 991232K-641617K(991232K), 3.9565638 secs] 1071.192: [GC 945999K(991232K), 0.5401515 secs] 1073.793: [Full GC 991231K-648045K(991232K), 3.9627814 secs] 1079.754: [GC 936641K(991232K), 0.5321197 secs]

    Read the article

  • Showing tokens in UITextField

    - by Miraaj
    Hi all, I want to get tokens appearance in UITextField as we have in NSTokenField ie. as soon as user enters some name in UITextField it gets enclosed within a token. We have this control in to-cc fields in mail in iPhone / iPod and I want to get similar feature in my application. Can anyone suggest me some solution for it?? Thanks, Miraaj

    Read the article

  • Where can I find a good software implementation plan template?

    - by Corpsekicker
    This is not "programming" related as much as it is "software engineering" related. I am required to produce an implementation for additional functionality to a complete system. All I am armed with is knowledge of the existing architecture and a functional spec with visual requirements, user stories and use cases. Is there a standardised way to go about this? I suck at documentation.

    Read the article

  • Why is Perl commonly used as CGI scripts?

    - by Michael Vasquez
    I plan to add a better search feature to my site, so I thought that I would write it in C and use the CGI as a means to access it. But it seems that Perl is the most popular language when it comes to CGI-based stuff. Why is that? Wouldn't it be faster programmed in C or machine code? What advantages, if any, are there to writing it in a scripting language? Thanks.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • C#: How would you only draw certain ListView Items while in Virtual Mode?

    - by Jonathan Richter
    C#: How would you only draw certain ListView Items while in Virtual Mode? I am trying to create a filter-like feature to use in listview so that if the user selects an imageindex from 0-5, it will loop through the listview items and only make it so that the items in question with the correct image index will be displayed and the other items will be hidden. How would I go upon creating such a routine?

    Read the article

  • Storing dynamic fields in Django forms

    - by hekevintran
    Django's form library has a feature of form sets that allow you to process dynamically added forms. For example you would use form sets if your application has a list of bookmarks you could use form sets to process multiple forms that each represent a bookmark. What about if you want to dynamically add a field to a form? An example would be a survey creation page where you can dynamically add an unlimited number of questions. How do you handle this in Django?

    Read the article

  • jquery hide certain form elements untill a certain textfield has been populated?

    - by Rubytastic
    I have a long signup form and would like to hide a few fields and only show them when a certain input field is populated with text, if the user types some text in this field the other form fields will show. I have looked at hide and show divs but have some trouble getting form elements hide and show them on a certain trigger ( populating a form with text ) anyone can point me in the right direction on how to implement such feature in query ? thx in advanche!

    Read the article

  • Webrat select_date selector failure.

    - by sharas
    Code in steps file: select_date user.date_of_birth, :from => "Date of birth" Selector fail When I register with valid user credentials # features/step_definitions/authentication_steps.rb:2 Could not find field: "user_date_of_birth_1i_1i" (Webrat::NotFoundError) ./features/step_definitions/authentication_steps.rb:9:in `/^I register with valid user credentials$/' features/authentication.feature:6:in `When I register with valid user credentials' HTML output seems to be normal: <select name="user[date_of_birth(1i)]" id="user_date_of_birth_1i"> Is it bug, or I am doing something wrong

    Read the article

  • WPF windows locked when calling webservice. Even when run asynchronously

    - by SumGuy
    Hi there. I'm having a big problem when calling a web service from my WPF application. The application/window locks until the process has completed. I've attempted to run this asynchronously but the problem still persists. Currently, the web service call I'm making can last 45-60 seconds. It runs a process on the server to fetch a big chunk of data. As it take a little while I wanted to have a progress bar moving indeterminately for the user to see that the application hasn't stalled or anything (you know how impatatient they get). So: private void btnSelect_Click(object sender, RoutedEventArgs e) { wDrawingList = new WindowDrawingList(systemManager); AsyncMethodHandler caller = default(AsyncMethodHandler); caller = new AsyncMethodHandler(setupDrawingList); // open new thread with callback method caller.BeginInvoke((Guid)((Button)sender).Tag, MyAsyncCallback, null); } Click a button and the app will create the form that the async stuff will be posted to and set up the async stuff calling the async method. public bool setupDrawingList(Guid ID) { if (systemManager.set(ID)) { wDrawingList.Dispatcher.Invoke(DispatcherPriority.Background, new Action(() => { wDrawingList.ShowForm(); Hide(); })); return true; } return false; } This is the async method. The showForm method contains the calls to setup the new form including the monster web service call public void MyAsyncCallback(IAsyncResult ar) { // Because you passed your original delegate in the asyncState parameter of the Begin call, you can get it back here to complete the call. MethodDelegate dlgt = (MethodDelegate)ar.AsyncState; // Complete the call. bool output = dlgt.EndInvoke(ar); try { // Retrieve the delegate. AsyncResult result = (AsyncResult)ar; AsyncMethodHandler caller = (AsyncMethodHandler)result.AsyncDelegate; // Because this method is running from secondary thread it can never access ui objects because they are created // on the primary thread. // Call EndInvoke to retrieve the results. bool returnValue = caller.EndInvoke(ar); // Still on secondary thread, must update ui on primary thread UpdateUI(returnValue == true ? "Success" : "Failed"); } catch (Exception ex) { string exMessage = null; exMessage = "Error: " + ex.Message; UpdateUI(exMessage); } } public void UpdateUI(string outputValue) { // Get back to primary thread to update ui UpdateUIHandler uiHandler = new UpdateUIHandler(UpdateUIIndicators); string results = outputValue; // Run new thread off Dispatched (primary thread) this.Dispatcher.Invoke(System.Windows.Threading.DispatcherPriority.Normal, uiHandler, results); } public void UpdateUIIndicators(string outputValue) { // update user interface controls from primary UI thread sbi3.Content = "Processing Completed."; } Any help or theories are appreciated. I'm at a loss. Thanks in advance

    Read the article

  • Create a overlay screen while a game/program is running?

    - by Dodi300
    Hello. Does anyone know how I can create a screen overflow while a program is running? Mainly while a game is running. If anyone has used xFire or Steam, these use this feature. I've created a winform which starts the game/program and then minimizes. Could the overflow be created in the same winform? Thanks for the help! :)

    Read the article

  • Best approach to make Page Flip animation on iPhone (like magazine)

    - by 2Fast4YouBR
    Hi all, What would be the besta approach to make one oage flip like a real magazine, like I put the finger in the corner of the screen then flip the page... Like this video: http://www.youtube.com/watch?v=dy4Y9j7COgg&feature=related Is it a sequence of images ? all images are in one view or Imageview ? Or there is another way to do it using the some stuff of the SDK? is this effect exisits or we have to develop ? cheers

    Read the article

  • rails, activerecord callbacks not saving

    - by Joseph Silvashy
    I have a model with a callback that runs after_update: after_update :set_state protected def set_state if self.valid? self.state = 'complete' else self.state = 'in_progress' end end But it doesn't actually save those values, why not? Regardless of if the model is valid or not it won't even write anything, even if i remove the if self.valid? condition, I can't seem to save the state. Um, this might sound dumb, do I need to run save on it?

    Read the article

  • How to send IM message like Skype in Android ?

    - by mob-king
    I have to build a feature in my application which allows user to send a skype message. For this I have installed skype lite client for Android (although offically the download has been currently withdrawn from Skype). Now how to initiate the activity from my application OR simply send the chat message without bringing it front, assuming I have skype installed in Android & also signed in already. Any help ? Thanks.

    Read the article

  • GIT <> SVN interchangeable patch-files

    - by pagid
    Hi, I maintain a subproject which is running on the project's SVN server. I personally prefer to work with Git - the problem is that the entire community uses SVN, expects RFCs with a SVN compatible patch-file and people are familiar with SVN and send bugfixes agains that SVN repository too. Therefore my only problem is to create patch files which are compatible with Git and SVN at the same time. Is there some kind of smart shell-script or even a buildin feature I'm not aware of? Cheers

    Read the article

  • php download file slows

    - by hobbywebsite
    OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

    Read the article

  • How to assign Application Icon that will display in Task bar?

    - by viky
    I am working on a Wpf desktop application, whenever i run my application it shows me a window and associated tab in the task bar(Normal windows feature). My problem is that the tab is using window's icon for unknown file-type, I tried with Icon property of Window, Icon gets assigned but still problem is when I run application, task bar Tab initially displays window's icon for unknown file-type and when window-load completes it changes to the Icon assigned. I want Icon there from beginning. Any help?

    Read the article

  • Consuming and Provide webservice to client

    - by Jason
    Hi, I got a requirement to implement a website in java which will utilize another web service. Here is the scenario I am providing the product compare results to client and assume i am using amazon and other web services. Initially client invoke our web service and then we fetch results from merchants. I don't want complete solution just look for consuming and create web service in java example. I searched on google but couldn't found relevant example. I prefer if example is using eclipse :) Thanks

    Read the article

  • Rails wiki highlight/strikethrough version differences between article versions

    - by mark
    Hi I'm wondering how to implement highlighting of changes to user edited articles on a wiki style rails project. Since articles may be fairly lengthy I'd ideally like strikethrough and highlighting, similar to github and wikipedia for example. Despite searching around the net I've not really come up with much, apart from instiki which is a complete wiki application. Thanks in advance for any advice.

    Read the article

< Previous Page | 293 294 295 296 297 298 299 300 301 302 303 304  | Next Page >