Search Results

Search found 18160 results on 727 pages for 'jdk 7 feature complete'.

Page 301/727 | < Previous Page | 297 298 299 300 301 302 303 304 305 306 307 308  | Next Page >

  • C# multiple asynchronous HttpRequest with one callback

    - by aepheus
    I want to make 10 asynchronous http requests at once and only process the results when all have completed and in a single callback function. I also do not want to block any threads using WaitAll (it is my understanding that WaitAll blocks until all are complete). I think I want to make a custom IAsyncResult which will handle multiple calls. Am I on the right track? Are there any good resources or examples out there that describe handling this?

    Read the article

  • SQLite - ON DUPLICATE KEY UPDATE

    - by Alix Axel
    MySQL has something like this: INSERT INTO visits (ip, hits) VALUES ('127.0.0.1', 1) ON DUPLICATE KEY UPDATE hits = hits + 1; As far as I'm know this feature doesn't exist in SQLite, what I want to know is if there is any way to archive the same effect without having to execute two queries. Also, if this is not possible, what do you prefer: SELECT + (INSERT or UPDATE) or UPDATE (+ INSERT if UPDATE fails)

    Read the article

  • Mod rewrite with multiple query strings

    - by Boris
    Hi, I'm a complete n00b when it comes to regular expressions. I need these redirects: (1) www.mysite.com/products.php?id=001&product=Product-Name&source=Source-Name should become -> www.mysite.com/Source-Name/001-Product-Name (2) www.mysite.com/stores.php?id=002&name=Store-Name should become -> www.mysite.com/002-Store-Name Any help much appreciated :)

    Read the article

  • How do I format a String in an email so Outlook will print the line breaks?

    - by MattGrommes
    I'm trying to send an email in Java but when I read the body of the email in Outlook, it's gotten rid of all my linebreaks. I'm putting \n at the ends of the lines but is there something special I need to do other than that? The receivers are always going to be using Outlook. I found a page on microsoft.com that says there's a 'Remove line breaks' "feature" in Outlook so does this mean there's no solution to get around that other than un-checking that setting? Thanks

    Read the article

  • How to search multiple columns in MySQL?

    - by George
    I'm trying to make a search feature that will search multiple columns to find a keyword based match. This query: SELECT title FROM pages LIKE %$query%; works only for searching one column, I noticed separating column names with commas results in an error. So is it possible to search multiple columns in mysql?

    Read the article

  • Tech necessary to build a live video chat site?

    - by tomeaton
    Hi, I'm looking to build a live video chat site. Before writing a project description, hiring a developer, etc., I'm doing a little research on what types of technologies / web development skills are necessary in order to build this type of site. The site will feature live video and audio for users to be able to chat with eachother, a simple profile which they can fill out, and the ability to filter the types of users they are connected with. Your feedback is appreciated. Thanks, Tom

    Read the article

  • Is VisualAssistX's autorenaming reliable?

    - by Stefan Monov
    I'm using the VS addon called VisualAssistX. Using it for C++ only. In particular i'm using the feature "rename this entity projectwide", mainly for class names and function names. My question is: does this use fuzzy heuristics, or does it actually reliably implement C++ semantics so there's no false negatives/false positives? Has it ever renamed something wrong for you?

    Read the article

  • Programming Language Choices for High Integrity Systems

    - by Finbarr
    What programming languages are a good choice for High Integrity Systems? An example of a bad choice is Java as there is a considerable amount of code that is inaccessible to the programmer. I am looking for examples of strongly typed, block structured languages where the programmer is responsible for 100% of the code, and there is as little interference from things like a JVM as possible. Compilers will obviously be an issue. Language must have a complete and unambiguous definition.

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • how to disable ckeditor 3 auto spellchecker ?

    - by Motasem
    Hi there I've installed CKEditor 3.0 ,it work nice , but I want to disable the auto spellchecker I notice when I'm writing some words in the editor it manages to connect to "svc.spellchecker.net" to make spell check do you know any way to stop that feature ? thanks in advance

    Read the article

  • Autohide scrollbars when not scrolling in a ListView

    - by synic
    In the new official Twitter app, the scrollbars in all the ListViews the app uses are hidden unless the user is scrolling through the list. When you start scrolling, the scrollbars appear. When you stop, they fade out with an animation until they are gone completely. I can't seem to find anything in the documentation that indicates this as being a standard feature. Is this something included in the API? If not, anyone know how this might be done?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Is is possible to have grouped GridView without using CollectionViewSource?

    - by Sergey Aldoukhov
    It is just seems to be a little awkward design to tie a feature to a class instead of interface. Has anybody managed to group GridView without CollectionViewSource? Also a bonus question here: why you have to refer to the CollectionViewSource resource through binding: <GridView ItemsSource="{Binding Source={StaticResource groupedData}}" > instead of <GridView ItemsSource="{StaticResource groupedData}" > ??

    Read the article

  • Thinking about introducing PHP/MySQL into a .NET/SQL Server environment. Thoughts?

    - by abszero
    I posted this over at reddit but it didn't gain any momentum. So here is what is going on: our company was recently purchased by another web shop and I was promoted to head of development here in our office. Our office is completely .NET/SQL Server and the company who purchased us is a *nix/PHP/MySQL shop. Now several of our large clients who are on the .NET platform are up for complete rewrites (the sites are from '04 and are running on the 1.x framework.) While reviewing the proposal for one client with my superior I came across a pretty extensive module which would require several hundred man hours to complete and voiced some concern about it in relation to the quote. One of the guys from the PHP group happen to hear this and told me of a module that they (PHP Group) use in Drupal that does exactly what the proposal in front of me was describing and it only took, at most, 8 hours to completely setup / configure. My superior suggested that I take a look at Drupal and the module in question over the weekend but stressed that we should only go that route if it really made sense. So this weekend I spun up a CentOS instance in VirtualBox and started playing around with Drupal. I am still fleshing it out so don't have a solid opinion on it just yet. Anyway I have some questions / fears that I was hoping progit could help me out in! Has anyone had experience doing this and, if so, how did it turn out? I am completely ignorant to what IDE's (if any) are available to for PHP. The last time I worked with PHP it was in Notepad and that was less than intuitive. So is there are more intuitive IDE out there for PHP dev? I don't want to scare my .NET guys. Since the merger all of our new business clients that have had relatively small websites have gone on Drupal with the larger sites going on .NET. My concern is that if they see a large site go onto Drupal that they might start getting anxious and start handing out their resumes. For the foreseeable future there are no plans to liquidate the .NET platform and really we can't just from a support standpoint. What would be the best way to approach this? Any other helpful info? Thanks!

    Read the article

< Previous Page | 297 298 299 300 301 302 303 304 305 306 307 308  | Next Page >