Search Results

Search found 24037 results on 962 pages for 'every'.

Page 332/962 | < Previous Page | 328 329 330 331 332 333 334 335 336 337 338 339  | Next Page >

  • How to design a command line program reusable for a future development of a GUI?

    - by systempuntoout
    What are some best practices to keep in mind when developing a script program that could be integrated with a GUI, probably by somebody else, in the future? Possible scenario: i develop a fancy python CLI program that scrapes every unicorn images from the web i decide to publish it on github a unicorn fan programmer decides to take the sources and build a GUI on them. he\she gives up because my code is not reusable How do i avoid step four and let unicorn fan programmer build his\her GUI without hassle?

    Read the article

  • the best approaches for logging localization using c++

    - by erin c
    I am working on a multinational project where target audience for logs might be from two nationalities. Therefore it is becoming important to log in more than one language , I am thinking about writing to 2 different log folders based on language every time I am logging something, but I am also wondering if there's some out of the box functionality that is coming along with logging frameworks like log4cpp?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Mod_rewrite Help !

    - by lixon
    RewriteEngine on Rewriterule ^(.*).htm $1.php This works fine when i try to access every php page But how could i make it RewriteRule ^/somepage $ /somepage.php (its not working ) if the page is about.php the url should be about/ (directory type) Please help me . Thanks in advance!

    Read the article

  • Stopping Backtracking

    - by John Retallack
    Is there any way in C/C++ to stop a backtracking algorithm after finding the first solution without exiting the program. I want my function to immediately exit the function,not to quit every level of recurrsion one by one stating return.

    Read the article

  • Instantiate defined object with Linq Query

    - by Heinz
    I know that you can instantiate anonymous types with Linq but I am looking to instantiate an object I have already defined. Every time I do, all the properties are returned with their defaults (null, 0, etc.) Is there a way to make this work? I've tried something like this: ServiceDepartment[] serviceDepartments = (from d in departments orderby d.department_name select new ServiceDepartment { DepartmentID = d.department_id, DepartmentName = d.department_name }).ToArray();

    Read the article

  • sql server 2008 takes alot of memory?

    - by Ahmed Said
    I making stress test on my database which is hosted on sqlserver 2008 64bit running on 64bit machine 10 GB of RAM. I have 400 threads each thread query the database for every second but the query time does not take time as the sql profiler says that, but after 18 hours sql takes 7.2 GB RAM and 7.2 on virtual memroy. Does is this normal behavior? and how can I adjust sql to clean up not in use memory?

    Read the article

  • OpenGL ES functions not accepting values originating outside of it's view

    - by Josh Elsasser
    I've been unable to figure this out on my own. I currently have an Open GLES setup where a view controller both updates a game world (with a dt), fetches the data I need to render, passes it off to an EAGLView through two structures (built of Apple's ES1Renderer), and draws the scene. Whenever a value originates outside of the Open GL view, it can't be used to either translate objects using glTranslatef, or set up the scene using glOrthof. If I assign a new value to something, it will work - even if it is the exact same number. The two structures I have each contain a variety of floating-point numbers and booleans, along with two arrays. I can log the values from within my renderer - they make it there - but I receive errors from OpenGL if I try to do anything with them. No crashes result, but the glOrthof call doesn't work if I don't set the camera values to anything different. Code used to set up scene: [EAGLContext setCurrentContext:context]; glBindFramebufferOES(GL_FRAMEBUFFER_OES, viewFramebuffer); //clears the color buffer bit glClear(GL_COLOR_BUFFER_BIT); glMatrixMode(GL_PROJECTION); //sets up the scene w/ ortho projection glViewport(0, 0, 320, 480); glLoadIdentity(); glOrthof(320, 0, dynamicData.cam_x2, dynamicData.cam_x1, 1.0, -1.0); glClearColor(1.0, 1.0, 1.0, 1.0); /*error checking code here*/ "dynamicData" (which is replaced every frame) is created within my game simulation. From within my controller, I call a method (w/in my simulation) that returns it, and pass the result on to the EAGLView, which passes it on to the renderer. I haven't been able to come up with a better solution for this - suggestions in this regard would be greatly appreciated as well. Also, this function doesn't work as well (values originate in the same place): glTranslatef(dynamicData.ship_x, dynamicData.ship_y, 0.0); Thanks in advance. Additional Definitions: Structure (declared in a separate header): typedef struct { float ship_x, ship_y; float cam_x1, cam_x2; } dynamicRenderData; Render data getter (and builder) (every frame) - (dynamicData)getDynRenderData { //d_rd is an ivar, zeroed on initialization d_rd.ship_x = mainShip.position.x; d_rd.ship_y = mainShip.position.y; d_rd.cam_x1 = d_rd.ship_x - 30.0f; d_rd.cam_x2 = d_rd.cam_x1 + 480.0f; return d_rd; } Zeroed at start. (d_rd.ship_x = 0;, etc…) Setting up the view. Prototype (GLView): - (void)draw: (dynamicRenderData)dynamicData Prototype (Renderer): - (void)drawView: (dynamicRenderData)dynamicData How it's called w/in the controller: //controller [glview draw: [world getDynRenderData]]; //glview (within draw) [renderer drawView: dynamicData];

    Read the article

  • how to display specific dates in KCalander

    - by yakub_moriss
    hi ,All i want to use KCalander (which is Open Source on www.code.google.com) in my project but i want to allow select only one date from awailable dates (means every monday of limited time period/dates awailable for reservations) what am i want to display only that dates/day in KCalander. is that possible with the use of UIDatePicker controller. which one is easy sollution ? waiting for your reply... Thanks in advance... Yakub Moriss

    Read the article

  • Keeping DB Table sorted using multi-field formula (Microsoft SQL Server)

    - by user298167
    I have a JOB table, with two interesting columns: Creation Date Importance (high - 3, medium 2, low - 1). A JOB record's priority calculated like this: Priority = Importance * (time passed since creation) The problem is, every time I would like to pick 200 jobs with highest priority, and I don't want to resort the table. Is there a way to keep rows sorted? I was also thinking about having three tables one for High, Medium and Low and then sort those by Creation Date.

    Read the article

  • Downloading all files from an FTP Server

    - by Navarr
    I need to download everything from an FTP server to hosting on a different server. I have shell access only to the server I'm downloading the files to. How, using the Linux FTP comnand, can I download every file, creating the directories needed for them in the process?

    Read the article

  • AWK Shift empty column to left (to start position)

    - by Filip Zembol
    INPUT: fofo jojo tst fojo jofo sts rhr hrhh dodo jojo hoho jojo zozo roro vovo OUTPUT: fofo jojo tst fojo jofo sts rhr hrhh dodo jojo hoho jojo zozo roro popo NOTE: Please help me, I need to shift all rows, which have first column empty. Every fields are tab delimited. In this file some rows start from first column, but some rows start from second or third column. Thank you

    Read the article

  • Add LINQ Auto-Generated Value Marker [Column(IsDbGenerated=true)] in Buddy Class

    - by Alex
    Hello, is it possible to decorate a field of a LINQ generated class with [Column(IsDbGenerated=true)] using a buddy class (which is linked to the LINQ class via [MetadataType(typeof(BuddyMetadata))]) ? My goal is to be able to clear and repopulate the LINQ ORM designer without having to set the "Auto Generate Value" property manually every time to re-establish the fact that certain columns are autogenerated. Thanks!

    Read the article

  • Check for column name in a SqlDataReader object

    - by Michael Kniskern
    How do I check to see if a column exists in a SqlDataReader object? In my data access layer, I have create a method that builds the same object for multiple stored procedures calls. One of the stored procedures has an additional column that is not used by the other stored procedures. I want to modified the method to accommodate for every scenario. My application is written in C#.

    Read the article

< Previous Page | 328 329 330 331 332 333 334 335 336 337 338 339  | Next Page >