Search Results

Search found 11197 results on 448 pages for 'related'.

Page 339/448 | < Previous Page | 335 336 337 338 339 340 341 342 343 344 345 346  | Next Page >

• Project setup for an ADO.NET/WCF DataService

  - by Slauma

  I'd like to implement a ADO.NET/WCF DataService and I am wondering what's the best way to setup a project in VS2008 SP1 for this purpose. Currently I have an ASP.NET web application project (not of "WebSite" project type). The data access layer is an Entity model (EF version 1) with SQL Server database. I have the Entity Model in a separate DLL project and the web application project references to this assembly for all data accesses. The ADO.NET/WCF DataService needs to communicate with the Entity model/database as well. It has to be hosted on the same web server (IIS 7.5) together with the web application. Since the DataService is not directly related to that specific web application (though it will provide and modify data from/in the same database the web application uses as well) my basic idea was to separate the DataService in its own new project (which also references the Entity Model DLL). Now I have seen that there is no project type "ADO.NET/WCF DataService" in VS2008 SP1. It seems only possible to add a DataService as an element to other existing projects, for instance Web Application projects. Why isn't there a separate DataService project type? Does this mean now that I have to add the DataService as an element to my Web Application project? Or shall I create a new Web Application project and add a DataService to it? (I could delete the pregenerated default.aspx since I do not need any web pages in this project.) What's the best way? Thank you for suggestions in advance!

  Read the article

• Is possible to reuse subqueries?

  - by Gothmog

  Hello, I'm having some problems trying to perform a query. I have two tables, one with elements information, and another one with records related with the elements of the first table. The idea is to get in the same row the element information plus several records information. Structure could be explain like this: table [ id, name ] [1, '1'], [2, '2'] table2 [ id, type, value ] [1, 1, '2009-12-02'] [1, 2, '2010-01-03'] [1, 4, '2010-01-03'] [2, 1, '2010-01-02'] [2, 2, '2010-01-02'] [2, 2, '2010-01-03'] [2, 3, '2010-01-07'] [2, 4, '2010-01-07'] And this is want I would like to achieve: result [id, name, Column1, Column2, Column3, Column4] [1, '1', '2009-12-02', '2010-01-03', , '2010-01-03'] [2, '2', '2010-01-02', '2010-01-02', '2010-01-07', '2010-01-07'] The following query gets the proper result, but it seems to me extremely inefficient, having to iterate table2 for each column. Would be possible in anyway to do a subquery and reuse it? SELECT a.id, a.name, (select min(value) from table2 t where t.id = subquery.id and t.type = 1 group by t.type) as Column1, (select min(value) from table2 t where t.id = subquery.id and t.type = 2 group by t.type) as Column2, (select min(value) from table2 t where t.id = subquery.id and t.type = 3 group by t.type) as Column3, (select min(value) from table2 t where t.id = subquery.id and t.type = 4 group by t.type) as Column4 FROM (SELECT distinct id FROM table2 t WHERE (t.type in (1, 2, 3, 4)) AND t.value between '2010-01-01' and '2010-01-07') as subquery LEFT JOIN table a ON a.id = subquery.id

  Read the article

• Why do people hate SQL cursors so much?

  - by Steven A. Lowe

  I can understand wanting to avoid having to use a cursor due to the overhead and inconvenience, but it looks like there's some serious cursor-phobia-mania going on where people are going to great lengths to avoid having to use one for example, one question asked how to do something obviously trivial with a cursor and the accepted answer proposed using a common table expression (CTE) recursive query with a recursive custom function, even though this limits the number of rows that could be processed to 32 (due to recursive call limit in sql server). This strikes me as a terrible solution for system longevity, not to mention a tremendous effort just to avoid using a simple cursor. what is the reason for this level of insane hatred? has some 'noted authority' issued a fatwa against cursors? does some unspeakable evil lurk in the heart of cursors that corrupts the morals of the children or something? wiki question, more interested in the answer than the rep thanks in advance! Related Info: http://stackoverflow.com/questions/37029/sql-server-fast-forward-cursors EDIT: let me be more precise: I understand that cursors should not be used instead of normal relational operations, that is a no-brainer. What I don't understand is people going waaaaay out of their way to avoid cursors like they have cooties or something, even when a cursor is a simpler and/or more efficient solution. It's the irrational hatred that baffles me, not the obvious technical efficiencies.

  Read the article

• How do you efficiently implement a document similarity search system?

  - by Björn Lindqvist

  How do you implement a "similar items" system for items described by a set of tags? In my database, I have three tables, Article, ArticleTag and Tag. Each Article is related to a number of Tags via a many-to-many relationship. For each Article i want to find the five most similar articles to implement a "if you like this article you will like these too" system. I am familiar with Cosine similarity and using that algorithm works very well. But it is way to slow. For each article, I need to iterate over all articles, calculate the cosine similarity for the article pair and then select the five articles with the highest similarity rating. With 200k articles and 30k tags, it takes me half a minute to calculate the similar articles for a single article. So I need another algorithm that produces roughly as good results as cosine similarity but that can be run in realtime and which does not require me to iterate over the whole document corpus each time. Maybe someone can suggest an off-the-shelf solution for this? Most of the search engines I looked at does not enable document similarity searching.

  Read the article

• How to use XPath to filter elements by TextContent? get parent by axis?

  - by Michael Mao

  Hi all: I've found a similar question on SO, however, that seems not exactly what I wanna achieve: Say, this is a sample XML file: <root> <item> <id isInStock="true">10001</id> <category>Loose Balloon</category> </item> <item> <id isInStock="true">10001</id> <category>Bouquet Balloon</category> </item> <item> <id isInStock="true">10001</id> <category>Loose Balloon</category> </item> </root> If I wanna get a "filtered" subset of the item elements from this XML, how could I use an XPath expression to directly address that? XPathExpression expr = xpath.compile("/root/item/category/text()"); I now know this would evaluate to be the collection of all the TextContent from the categories, however, that means I have to use a collection to store the values, then iterate, then go back to grab other related info such as the item id again. Another question is : how could I refer to the parent node properly? Say, this xpath expression would get me the collection of all the id nodes, right? But what I want is the collection of item nodes: XPathExpression expr = xpath.compile("/root/item/id[@isInStock='true']"); I know I should use the "parent" axis to refer to that, but I just cannot make it right... Is there a better way of doing this sort of thing? Learning the w3cschools tutorials now... Sorry I am new to XPath in Java, and thanks a lot in advance.

  Read the article

• Weak event handler model for use with lambdas

  - by Benjol

  OK, so this is more of an answer than a question, but after asking this question, and pulling together the various bits from Dustin Campbell, Egor, and also one last tip from the 'IObservable/Rx/Reactive framework', I think I've worked out a workable solution for this particular problem. It may be completely superseded by IObservable/Rx/Reactive framework, but only experience will show that. I've deliberately created a new question, to give me space to explain how I got to this solution, as it may not be immediately obvious. There are many related questions, most telling you you can't use inline lambdas if you want to be able to detach them later: Weak events in .Net? Unhooking events with lambdas in C# Can using lambdas as event handlers cause a memory leak? How to unsubscribe from an event which uses a lambda expression? Unsubscribe anonymous method in C# And it is true that if YOU want to be able to detach them later, you need to keep a reference to your lambda. However, if you just want the event handler to detach itself when your subscriber falls out of scope, this answer is for you.

  Read the article

• Web user expectations

  - by Ash

  When designing a good Web GUI what expectations can we expect from an end user? I've come up with the following, but I wonder if there are any others which can suggest.. If I click on a hyperlink it will take me to another page/part of this page If I tick/untick a checkbox it might alter the page state (enable/disable elements) If I click on a button I expect it to do something to data. If I click on a button I expect something to happen immediately (either to the current page, or for me to be taken to another page) If I have clicked on a hyperlink and it has taken me to another page, I expect to be able to use the Back button to get back to the previous page in a state similar to that which I left it in If I change something in a form, I can change it back to its previous value if necessary Unless I click on the 'Submit' button nothing should happen to my data. If I bookmark/favourite a page then it should show the same related data each time I visit it If text is underlined and looks like a link, it should be a link and act as one The reasoning behind this question is more a 'UI from hell' one. For example I have come across pages which checking a tickbox next to a record will delete it, straight away, via ajax. To me that just seems wrong, a checkbox is a toggle - something which a delete operation definitely isn't!

  Read the article

• python: how to design a container with elements that must reference their container

  - by Luke404

  (the title is admittedly not that great. Please forgive my English, this is the best I could think of) I'm writing a python script that will manage email domains and their accounts, and I'm also a newby at OOP design. My two (related?) issues are: the Domain class must do special work to add and remove accounts, like adding/removing them to the underlying implementation how to manage operations on accounts that must go through their container To solve the former issue I'd add a factory method to the Domain class that'll build an Account instance in that domain, and a 'remove' (anti-factory?) method to handle deletions. For the latter this seems to me "anti-oop" since what would logically be an operation on an Account (eg, change password) must always reference the containing Domain. Seems to me that I must add to the Account a reference back to the Domain and use that to get data (like the domain name) or call methods on the Domain class. Code example (element uses data from the container) that manages an underlying Vpopmail system: class Account: def __init__(self, name, password, domain): self.name = name self.password = password self.domain = domain def set_password(self, password): os.system('vpasswd %s@%s %s' % (self.name, self.domain.name, password) self.password = password class Domain: def __init__(self, domain_name): self.name = domain_name self.accounts = {} def create_account(self, name, password): os.system('vadduser %s@%s %s' % (name, self.name, password)) account = Account(name, password, self) self.accounts[name] = account def delete_account(self, name): os.system('vdeluser %s@%s' % (name, self.name)) del self.accounts[name] another option would be for Account.set_password to call a Domain method that would do the actual work - sounds equally ugly to me. Also note the duplication of data (account name also as dict key), it sounds logical (account names are "primary key" inside a domain) but accounts need to know their own name.

  Read the article

• Check if the internet cannot be accessed in Python

  - by Sridhar Ratnakumar

  I have an app that makes a HTTP GET request to a particular URL on the internet. But when the network is down (say, no public wifi - or my ISP is down, or some such thing), I get the following traceback at urllib.urlopen: 70, in get u = urllib2.urlopen(req) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 126, in urlopen return _opener.open(url, data, timeout) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 391, in open response = self._open(req, data) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 409, in _open '_open', req) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 369, in _call_chain result = func(*args) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 1161, in http_open return self.do_open(httplib.HTTPConnection, req) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 1136, in do_open raise URLError(err) URLError: <urlopen error [Errno 8] nodename nor servname provided, or not known> I want to print a friendly error to the user telling him that his network maybe down instead of this unfriendly "nodename nor servname provided" error message. Sure I can catch URLError, but that would catch every url error, not just the one related to network downtime. I am not a purist, so even an error message like "The server example.com cannot be reached; either the server is indeed having problems or your network connection is down" would be nice. How do I go about selectively catching such errors? (For a start, if DNS resolution fails at urllib.urlopen, that can be reasonably assumed as network inaccessibility? If so, how do I "catch" it in the except block?)

  Read the article

• Amazon S3 and swfaddress

  - by justinbach

  I recently migrated a large AS3 site (lots of swfs, lots of flvs) to Amazon S3. Pretty much everything but HTML and JS files is being stored/served from Amazon, and it's working well. The only problem I'm having is that I built the site using SWFaddress (actually, via the Gaia framework which uses SWFaddress), and for some reason, SWFaddress is no longer updating the address bar correctly as users navigate from page to page. In other words, the URL persistently remains http://www.mysite.com, not http://www.mysite.com/#/section as would be the case were SWFaddress functioning correctly (and as it was functioning prior to the migration). Stranger yet, if I go to (e.g.) http://www.mysite.com/#/section directly, the deeplinking functions as you'd expect--I arrive directly at the correct section. However, navigating away from that section doesn't have any effect on the address bar, despite the fact that it should be dynamically updated. I've got a crossdomain.xml file set up on the site that allows access from all domains, so that's not the issue, and I don't know what else might be. Any ideas would be greatly appreciated! P.S. I integrated S3 by putting pretty much the entire site in an S3 bucket and then just changing the initial swfobject embed to point to the S3 instance of main.swf, passing in the S3 path as the "base" param to the embedded swf so that all dynamically loaded assets and swfs would also be sourced from s3. Dunno if that's related to the troubles I'm having.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

  - by Deepak Konidena

  Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

  Read the article

• Rendering LaTeX on third-party websites

  - by A. Rex

  There are some sites on the web that render LaTeX into some more readable form, such as Wikipedia, some Wordpress blogs, and MathOverflow. They may use images, MathML, jsMath, or something like that. There are other sites on the web where LaTeX appears inline and is not rendered, such as the arXiv, various math forums, or my email. In fact, it is quite common to see an arXiv paper's abstract with raw LaTeX in it, e.g. this paper. Is there a plugin available for Firefox, or would it be possible to write one, that renders LaTeX within pages that do not provide a rendering mechanism themselves? Some notes: It may be impossible to render some of the code, because authors often copy-paste code directly from their source TeX files, which may contain things like "\cite{foo}" or undefined commands. These should be left alone. This question is a repost of a question from MathOverflow that was closed for not being related to math. I program a lot, but Javascript is not my specialty, so comments along the lines of "look at this library" are not particularly helpful to me (but may be to others).

  Read the article

• Graph navigation problem

  - by affan

  I have graph of components and relation between them. User open graph and want to navigate through the graph base on his choice. He start with root node and click expand button which reveal new component that is related to current component. The problem is with when use decide to collapse a node. I have to choose a sub-tree to hide and at same time leave graph in consistent state so that there is no expanded node with missing relation to another node in graph. Now in case of cyclic/loop between component i have difficult of choosing sub-tree. For simplicity i choose the order in which they were expanded. So if a A expand into B and C collapse A will hide the nodes and edge that it has created. Now consider flowing scenario. [-] mean expanded state and [+] mean not yet expanded. A is expanded to reveal B and C. And then B is expanded to reveal D. C is expanded which create a link between C and exiting node D and also create node E. Now user decide to collapse B. Since by order of expansion D is child of B it will collapse and hide D. This leave graph in inconsistent state as C is expanded with edge to D but D is not anymore there if i remove CD edge it will still be inconsistent. If i collapse C. And E is again a cyclic link e.g to B will produce the same problem. /-----B[-]-----\ A[-] D[+] \-----C[-]-----/ \ E[+] So guys any idea how can i solve this problem. User need to navigate through graph and should be able to collapse but i am stuck with problem of cyclic nodes in which case any of node in loop if collapse will leave graph in inconsistent state.

  Read the article

• how to get cartesian products between database and local sequences in linq?

  - by JD

  I saw this similar question here but can't figure out how to use Contains in Cartesian product desired result situation: http://stackoverflow.com/questions/1712105/linq-to-sql-exception-local-sequence-cannot-be-used-in-linq-to-sql-implementatio Let's say I have following: var a = new [] { 1, 4, 7 }; var b = new [] { 2, 5, 8 }; var test = from i in a from j in b select new { A = i, B = j, AB = string.Format("{0:00}a{1:00}b", i, j), }; foreach (var t in test) Console.Write("{0}, ", t.AB); This works great and I get a dump like so (note, I want the cartesian product): 01a02b, 01a05b, 01a08b, 04a02b, 04a05b, 04a08b, 07a02b, 07a05b, 07a08b, Now what I really want is to take this and cartesian product it again against an ID from a database table I have. But, as soon as I add in one more from clause that instead of referencing objects, references SQL table, I get an error. So, altering above to something like so where db is defined as a new DataContext (i.e., class deriving from System.Data.Linq.DataContext): var a = new [] { 1, 4, 7 }; var b = new [] { 2, 5, 8 }; var test = from symbol in db.Symbols from i in a from j in b select new { A = i, B = j, AB = string.Format("{0}{1:00}a{2:00}b", symbol.ID, i, j), }; foreach (var t in test) Console.Write("{0}, ", t.AB); The error I get is following: Local sequence cannot be used in LINQ to SQL implementations of query operators except the Contains operator Its related to not using Contains apparently but I'm unsure how Contains would be used when I don't really want to constrict the results - I want the Cartesian product for my situation. Any ideas of how to use Contains above and still yield the Cartesian product when joining database and local sequences?

  Read the article

• WTK emulator bluetooth connection problem

  - by Gokhan B.

  Hi! I'm developing a J2ME program with eclipse / WTK 2.5.2 and having problem with connecting two emulators using bluetooth. There is one server and one .client running on two different emulators. The problem is client program cannot discover any bluetooth device. Here is the server and client codes: public Server() { try { LocalDevice local = LocalDevice.getLocalDevice(); local.setDiscoverable(DiscoveryAgent.GIAC); server = (StreamConnectionNotifier) Connector.open("btspp://localhost:" + UUID_STRING + ";name=" + SERVICE_NAME); Util.Log("EchoServer() Server connector open!"); } catch (Exception e) {} } after calling Connector.open, I get following warning in console, which i believe is related: Warning: Unregistered device: unspecified and client code that searches for devices: public SearchForDevices(String uuid, String nm) { UUIDStr = uuid; srchServiceName = nm; try { LocalDevice local = LocalDevice.getLocalDevice(); agent = local.getDiscoveryAgent(); deviceList = new Vector(); agent.startInquiry(DiscoveryAgent.GIAC, this); // non-blocking } catch (Exception e) {} } system never calls deviceDiscovered, but calls inquiryCompleted() with INQUIRY_COMPLETED paramter, so I suppose client program runs fine. Bluetooth is enabled at emulator settings.. any ideas ?

  Read the article

• Async file uploads in Firefox reset on any DOM change

  - by Vibhu

  I'm pretty sure this is a Firefox or flash-related bug, but I just want to check if anyone has ran into this problem or knows how to fix it. Basically, we have a multi-file upload widget for our highly dynamic web app (think Gmail). We've tried both uploadify for jQuery, and YUI uploader. We've also tried taking those out of our app interface and putting them in an iFrame. What happens is that in the event of any DOM manipulation, even if the uploader is in an iFrame, be it a tab change (in our web app) that covers the iframe temporarily, or a block, etc., the uploader will stop its current upload. In the case of YUI uploader, it fires the "contentReady" event again. This ONLY happens in Firefox. IE and Chrome are fine. In case you are wondering, we really don't have any custom needs here. Just need to have multi-upload file support, and we need to give people free reign to tab around in our interface while an upload is in progress. It seems like Yahoo! and Gmail have both solved this problem. How? What are we doing wrong?

  Read the article

• viewstack causing error 1065 variable not defined issue?

  - by jason

  I've got an flex application where I have a left side TREE control and a viewstack on the right and when someone selects the tree it loads the named viewstack based on the hidden node value of the XML of the tree. But it's throwing a error 1065 variable not defined on a viewstack which worked on the last browser refresh/reload. It's not related to a particular viewstack from what I can tell it just seems to throw the error on certain render events. I've tried to use creationpolicy="all" on the viewstack but it seems to not be of any help. public function treeChanged(event:Event):void { selectedNode=Tree(event.target).selectedItem as XML; //trace(selectedNode.@hidden); //Alert.show([email protected]() + " *"); if([email protected]() == '' || [email protected]() == null){ //Alert.show("NULL !"); return; } mainviewstack.selectedChild = Container(mainviewstack.getChildByName([email protected]())); //Container(mainviewstack.getChildByName(selectedNode.@hidden)); If I add in an alert box before the getchildbyname option the viewstack has time to render and everything works fine, so it leads me to believe the app is not giving it enough time to load the viewstack?

  Read the article

• django: can't adapt error when importing data from postgres database

  - by Oleg Tarasenko

  Hi, I'm having strange error with installing fixture from dumped data. I am using psycopg2, and django1.1.1 silver:probsbox oleg$ python manage.py loaddata /Users/oleg/probs.json Installing json fixture '/Users/oleg/probs' from '/Users/oleg/probs'. Problem installing fixture '/Users/oleg/probs.json': Traceback (most recent call last): File "/opt/local/lib/python2.5/site-packages/django/core/management/commands/loaddata.py", line 153, in handle obj.save() File "/opt/local/lib/python2.5/site-packages/django/core/serializers/base.py", line 163, in save models.Model.save_base(self.object, raw=True) File "/opt/local/lib/python2.5/site-packages/django/db/models/base.py", line 495, in save_base result = manager._insert(values, return_id=update_pk) File "/opt/local/lib/python2.5/site-packages/django/db/models/manager.py", line 177, in _insert return insert_query(self.model, values, **kwargs) File "/opt/local/lib/python2.5/site-packages/django/db/models/query.py", line 1087, in insert_query return query.execute_sql(return_id) File "/opt/local/lib/python2.5/site-packages/django/db/models/sql/subqueries.py", line 320, in execute_sql cursor = super(InsertQuery, self).execute_sql(None) File "/opt/local/lib/python2.5/site-packages/django/db/models/sql/query.py", line 2369, in execute_sql cursor.execute(sql, params) File "/opt/local/lib/python2.5/site-packages/django/db/backends/util.py", line 19, in execute return self.cursor.execute(sql, params) ProgrammingError: can't adapt First I've checked similar issues on internet. This one seemed to be very related: http://code.djangoproject.com/ticket/5996, as my data has many non ASCII symbols But actually I've checked my django installation and it's ok there Could you advice what is wrong

  Read the article

• osCommerce custom PHP page

  - by Afrosimon

  Hello! One of my client has an old osCommerce website and while working on it I have to implement what I would call "custom php page", i.e. a page which query a MySQL table, not related to osCommerce, and list the result. I'm not sure of the version, this trick I have seen a lot didn't gave me any result : http://www.clubosc.com/how-to-know-what-version-of-oscommerce-you-are-using.html . And I'm having a hard time doing this seemingly simple task, since osCommerce doesn't allow any php code in the page creation, and I didn't find any module giving me this possibility (not that it is easy to search in this mess : http://addons.oscommerce.com/). At this point I figured it would be easier to just hack'n slash through the code and come up with a custom page : I copied the index.php (the entry point in the application) : <?php require('includes/application_top.php'); if(!$smarty->is_cached($sContentPage, $sCachingGroup)) { //we switch on the content recognition require('includes/pages/' . $sContentClass . '.php'); } $smarty->display($sContentPage, $sCachingGroup); require(DIR_WS_INCLUDES . 'application_bottom.php'); ?> Here I gave a specific value to $sContentClass (with or without the if makes no difference) and customize the corresponding PHP file so it show my custom content but also initialize the same variable than those other PHP file in the pages/ folder. But alas, all of this curious and dubious code simply return me the home page. So here I am, is there an osCommerce Guru around here, or would anyone has a better idea (oh and I also posted on the osCommerce forum, but I'm still waiting for a response...)? Thanks a lot in advance.

  Read the article

• JVM segmentation faults due to "Invalid memory access of location"

  - by Dan

  I have a small project written in Scala 2.9.2 with unit tests written using ScalaTest. I use SBT for compiling and running my tests. Running sbt test on my project makes the JVM segfault regularly, but just compiling and running my project from SBT works fine. Here is the exact error message: Invalid memory access of location 0x8 rip=0x10959f3c9 [1] 11925 segmentation fault sbt I cannot locate a core dump anywhere, but would be happy to provide it if it can be obtained. Running java -version results in this: java version "1.6.0_37" Java(TM) SE Runtime Environment (build 1.6.0_37-b06-434-11M3909) Java HotSpot(TM) 64-Bit Server VM (build 20.12-b01-434, mixed mode) But I've also got Java 7 installed (though I was never able to actually run a Java program with it, afaik). Another issue that may be related: some of my test cases contain titles including parentheses like ( and ). SBT or ScalaTest (not sure) will consequently insert square parens in the middle of the output. For example, a test case with the name (..)..(..) might suddenly look like (..[)..](..). Any help resolving these issues is much appreciated :-) EDIT: I installed the Java 7 JDK, so now java -version shows the right thing: java version "1.7.0_07" Java(TM) SE Runtime Environment (build 1.7.0_07-b10) Java HotSpot(TM) 64-Bit Server VM (build 23.3-b01, mixed mode) This also means that I now get a more detailed segfault error and a core dump: # # A fatal error has been detected by the Java Runtime Environment: # # SIGSEGV (0xb) at pc=0x000000010a71a3e3, pid=16830, tid=19459 # # JRE version: 7.0_07-b10 # Java VM: Java HotSpot(TM) 64-Bit Server VM (23.3-b01 mixed mode bsd-amd64 compressed oops) # Problematic frame: # V [libjvm.dylib+0x3cd3e3] And the dump.

  Read the article

• Instantiating class with custom allocator in shared memory

  - by recipriversexclusion

  I'm pulling my hair due to the following problem: I am following the example given in boost.interprocess documentation to instantiate a fixed-size ring buffer buffer class that I wrote in shared memory. The skeleton constructor for my class is: template<typename ItemType, class Allocator > SharedMemoryBuffer<ItemType, Allocator>::SharedMemoryBuffer( unsigned long capacity ){ m_capacity = capacity; // Create the buffer nodes. m_start_ptr = this->allocator->allocate(); // allocate first buffer node BufferNode* ptr = m_start_ptr; for( int i = 0 ; i < this->capacity()-1; i++ ) { BufferNode* p = this->allocator->allocate(); // allocate a buffer node } } My first question: Does this sort of allocation guarantee that the buffer nodes are allocated in contiguous memory locations, i.e. when I try to access the n'th node from address m_start_ptr + n*sizeof(BufferNode) in my Read() method would it work? If not, what's a better way to keep the nodes, creating a linked list? My test harness is the following: // Define an STL compatible allocator of ints that allocates from the managed_shared_memory. // This allocator will allow placing containers in the segment typedef allocator<int, managed_shared_memory::segment_manager> ShmemAllocator; //Alias a vector that uses the previous STL-like allocator so that allocates //its values from the segment typedef SharedMemoryBuffer<int, ShmemAllocator> MyBuf; int main(int argc, char *argv[]) { shared_memory_object::remove("MySharedMemory"); //Create a new segment with given name and size managed_shared_memory segment(create_only, "MySharedMemory", 65536); //Initialize shared memory STL-compatible allocator const ShmemAllocator alloc_inst (segment.get_segment_manager()); //Construct a buffer named "MyBuffer" in shared memory with argument alloc_inst MyBuf *pBuf = segment.construct<MyBuf>("MyBuffer")(100, alloc_inst); } This gives me all kinds of compilation errors related to templates for the last statement. What am I doing wrong?

  Read the article

• TeamCity and pending Git merge branch commit keeps build with failed tests

  - by Vladimir

  We use TeamCity for continuous integration and Git for source control. Generally it works pretty well - convenient, modern and good us quick feedback when tests fails. There is a strange behavior related to Git merge specifics. Here are steps of the case: First developer pulls from master repo. Second developer pulls from master repo. First developer makes commit A locally. Second developer makes commit B locally; Second developer pushes commit B. First developer want to push commit A but unable because he have to pull commit B first. First developer pull's from remote reposity. First developer pushes commit A and generated merge branch commit. The history of commits in master repo is following: B second developer A first developer merge branch first developer. Now let's assume that Second Developer fixed some failing tests in his commit B. What TeamCity will do is following: Commit B arrives - TeamCity makes build #1 with all tests passed Commit A arrives - TeamCity makes build #2 (without commit B) test bar becomes Red! TeamCity thought that Pending "Merge Branch" commit doesn't contain any changes (any new files) - but it actually does contain the merge of commit B, so the TeamCity don't want to make new build here and make tests green. Here are two problems: 1. In our case we have failed tests returning back in second commit (commit A) 2. TeamCity don't want to make a new build and make tests back green. Does anybody know how to fix both of this problems. I consider some reasonable general approach.

  Read the article

• C# CreateElement method - how to add an child element with xmlns=""

  - by NealWalters

  How can I get the following code to add the element with "xmlns=''"? using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Xml; namespace ConsoleApplication1 { class Program { static void Main(string[] args) { string strXML = "<myroot>" + " <group3 xmlns='myGroup3SerializerStyle'>" + " <firstname xmlns=''>Neal3</firstname>" + " </group3>" + "</myroot>"; XmlDocument xmlDoc = new XmlDocument(); xmlDoc.LoadXml(strXML); XmlElement elem = xmlDoc.CreateElement(null, "lastname", null); elem.InnerText = "New-Value"; string strXPath = "/myroot/*[local-name()='group3' and namespace-uri()='myGroup3SerializerStyle']/firstname"; XmlNode insertPoint = xmlDoc.SelectSingleNode(strXPath); insertPoint.AppendChild(elem); string resultOuter = xmlDoc.OuterXml; Console.WriteLine("\n resultOuter=" + resultOuter); Console.ReadLine(); } } } My current output: resultOuter=<myroot><group3 xmlns="myGroup3SerializerStyle"><firstname xmlns="" >Neal3<lastname>New-Value</lastname></firstname></group3></myroot> The desired output: resultOuter=<myroot><group3 xmlns="myGroup3SerializerStyle"><firstname xmlns="" >Neal3<lastname xmlns="">New-Value</lastname></firstname></group3></myroot> For background, see related posts: http://www.stylusstudio.com/ssdn/default.asp?fid=23 (today) http://stackoverflow.com/questions/2410620/net-xmlserializer-to-element-formdefaultunqualified-xml (March 9, thought I fixed it, but bit me again today!)

  Read the article

• wix The directory is in the user profile but is not listed in the RemoveFile table

  - by Venkat S. Rao

  I have the following configuration to delete and copy a file from WIX. <Directory Id='TARGETDIR' Name='SourceDir'> ... <Directory Id="AppDataFolder" Name="AppDataFolder"> <Directory Id="GleasonAppData" Name="Gleason" > <Directory Id="GleasonStudioAppData" Name="GleasonStudio"> <Directory Id="DatabaseAppData" Name ="Database"> <Directory Id="UserSandboxesAppData" Name="UserSandboxes" /> </Directory> </Directory> </Directory> </Directory> </Directory> <DirectoryRef Id="UserSandboxesAppData"> <Component Id="comp_deleteBackup" Guid="1f159f49-3029-4f46-b194-e42aabd40844"> <RemoveFile Id="RemoveBackup" Directory="UserSandboxesAppData" Name="DevelopmentBackUp.FDB" On="install" /> <RegistryKey Root="HKCU" Key="Software\Gleason\Database\RemoveBackup"> <RegistryValue Value="Removed" Type="string" KeyPath="yes" /> </RegistryKey> </Component> <Component Id="comp_createBackup" Guid="557badef-6d77-4c4e-aa5f-8d88cb5ef735"> <CopyFile Id="DBBackup" DestinationDirectory="UserSandboxesAppData" DestinationName="DevelopmentBackUp.FDB" SourceDirectory="UserSandboxesAppData" SourceName="Development.FDB" /> <RegistryKey Root="HKCU" Key="Software\Gleason\Database\CopyBackup"> <RegistryValue Value="Copied" Type="string" KeyPath="yes" /> </RegistryKey> </Component> </DirectoryRef> I get 4 errors related to ICE64--The directory 'xxx' is in the user profile but is not listed in the RemoveFile table. xxx={UserSandboxesAppData, DatabaseAppData, GleasonStudioAppData, GleasonAppData} Someone else had a very similar problem here: Directory xx is in the user profile but is not listed in the RemoveFile table. . But that solution did not help me. What do I need to change? Thank You, Venkat Rao

  Read the article

< Previous Page | 335 336 337 338 339 340 341 342 343 344 345 346  | Next Page >