Search Results

Search found 2423 results on 97 pages for 'human readable'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 37/97 | < Previous Page | 33 34 35 36 37 38 39 40 41 42 43 44  | Next Page >

  • Is it possible to programmatically edit a sound file based on frequency?

    - by K-RAN
    Just wondering if it's possible to go through a flac, mp3, wav, etc file and edit portions, or the entire file by removing sections based on a specific frequency range? So for example, I have a recording of a friend reciting a poem with a few percussion instruments in the background. Could I write a C program that goes through the entire file and cuts out everything except the vocals (human voice frequency ranges from 85-255 Hz, from what I've been reading)? Thanks in advance for any ideas!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Computer generated files - how do they work ?

    - by hory.incpp
    Hello, .... ‹BÿЃÀ‰D$Ç„$  ....... that's what happens when you open (notepad) such a file that I'm talking about How do algorithms decode that information and when does a program use/generate it ? Does some notepad-like application exist that open such files and transform them to readable code/data ? Any more information which will clarify about these files will be very helpful. Thank you for your time, P.S I'm not talking strictly about .exe files

    Read the article

  • Command line CSV viewer?

    - by Benjamin Oakes
    Anyone know of a command-line CSV viewer for Linux/OS X? I'm thinking of something like less but that spaces out the columns in a more readable way. (I'd be fine with opening it with OpenOffice Calc or Excel, but that's way too overpowered for just looking at the data like I need to.) Having horizontal and vertical scrolling would be great.

    Read the article

  • Where to put common setUp-code for differen testclasses?

    - by Benedikt
    I have several different test classes that require that certain objects are created before those tests can be run. Now I'm wondering if I should put the object initialization code into a separate helper class or superclass. Doing so would surely reduce the amount of duplicate code in my test classes but it would also make them less readable. Is there a guideline or pattern how to deal with common setUp-code for unit tests?

    Read the article

  • Captcha replacement

    - by portoalet
    Hi, I stumbled upon http://www.kettletime.com.au/chance where the user needs to drag and drop a box with a number into another box to prove that he is human. How do you implement this? Any free library to do this? Thanks

    Read the article

  • get pure text form odt file in console

    - by naugtur
    I am looking for a small linux tool that would be able to extract text from odt file. It just needs to be human-readable and it can have problems with complicated objects etc. It's almost a duplicate of this question but I need it to be small and have no dependencies on OpenOffice or X server I remember having a 1MB MS-DOS program that could render .doc files quite readibly (with some weird markup getting through from time to time), so i expect it to be possible in the linux world too ;)

    Read the article

  • As a PHP developer thinking of making Perl a secondary strong suit, what do I need to know?

    - by Hexagon Theory
    I consider myself quite fluent in PHP and am rather familiar with nearly all of the important aspects and uses, as well as its pratfalls. This in mind, I think the major problem in taking on Perl is going to be with the syntax. Aside from this (a minor hindrance, really, as I'm rather sold on the fact that Perl's is far more readable), what are some key differences you think I should make myself aware of prior to taking on the language?

    Read the article

  • gcc c++ command line error-message parser

    - by Autopulated
    Are there any programs for parsing and displaying in a nice format the c++ error messages generated by gcc. I'm really looking for something like less that I can pipe my errors into that will collapse the template parameter lists by default, maybe with some nice highlighting so that my errors are actually readable. (Yes, it's boost's fault I have such incomprehensible errors, in case you were wondering)

    Read the article

  • Calculate rolling / moving average in c or c++

    - by Biohazard
    I know this is achievable with boost as per: Using boost::accumulators, how can I reset a rolling window size, does it keep extra history? But I really would like to avoid using boost. I have googled and not found any suitable or readable examples. Basically I want to track the moving average of an ongoing stream of a stream of floating point numbers using the most recent 1000 numbers as a data sample. What is the easiest way to achieve this?

    Read the article

  • warcraft3 packet infromation [closed]

    - by ajay009ajay
    Hello All, I have made a program which is fetching data from server to and game to server. I want to keep these record in my file. But my problem is this is not in good format that i can read easily. I am reading all data as "Byte" (from java). Can anybody explain header or data info of packet. so I can read it in human manner Huh thanks.

    Read the article

  • .NET timezone information

    - by dotnetrocks
    What is the standard format for datetime with timezone in a C# ASP.NET application? Updated to clarify: In ASP.NET I need to check a datetime from a Domino database against a .NET DateTime. The client is asking what would be the best format in which he should provide the datetime with the timezone. Meaning which format is most easily readable by .NET?

    Read the article

  • Parsing EXIF's "ExposureTime" using PHP

    - by MarkL
    Re, One photo with exposure being 1/640 has the EXIF field of "ExposureTime" eq. "15625/10000000". I am not sure why some photos display this value in a readable format (e.g., "1/100"), but I need to convert this "15625" back to "1/640". How? :) Thanks.

    Read the article

  • Multi language CMS?

    - by Adam
    Is there any CMS such as expression engine or wordpress that allows a user to click a button and convert all the text to another language (it would have to be human generated otherwise it has too many mistakes probably). I'd like to know if there are any good solutions out there that work for real world use, in like business company websites.

    Read the article

  • Android Assets No Value Read?

    - by BahaiResearch.com
    AssetManager assets = myContext.getAssets(); String[] files = assets.list("MyFolder"); InputStream myInput = assets.open("MyFolder/" + files[0]); int i = myInput.read(); in this case 'i' is -1 meaning nothing read. Why would nothing be there if the file is there, the variable 'files' has the file as well. Do I need to do anything to the file I put into the Assets folder in get it to be readable?

    Read the article

  • Any way to add tabbed forms in django administration site ?

    - by tomjerry
    When using Django "out-of-the-box" administration forms, the "change form" pages can be rather long for complex models (with a lot of fields). I would like to use tabs in the "change form", so things can be more readable (group fields by tabs...) Instead of doing it all by myself, by modifiying the 'change_form.html' admin template, I was wondering whether somebody has already done that and would like to share the code, or whether an existing Django-plugin already exist. Thanks in advance for you answer

    Read the article

  • Mixed declarations and code in open source projects?

    - by Eduardo
    Why is still C99 mixed declarations and code not used in open source C projects like the Linux kernel or GNOME? I really like mixed declarations and code since it makes the code more readable and prevents hard to see bugs by restricting the scope of the variables to the narrowest possible. This is recommended by Google for C++. For example, Linux requires at least GCC 3.2 and GCC 3.1 has support for C99 mixed declarations and code

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 33 34 35 36 37 38 39 40 41 42 43 44  | Next Page >