Search Results

Search found 13534 results on 542 pages for 'python 2 4'.

Page 376/542 | < Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • Does urllib2.urlopen() actually fetch the page?

    - by beagleguy
    hi all, I was condering when I use urllib2.urlopen() does it just to header reads or does it actually bring back the entire webpage? IE does the HTML page actually get fetch on the urlopen call or the read() call? handle = urllib2.urlopen(url) html = handle.read() The reason I ask is for this workflow... I have a list of urls (some of them with short url services) I only want to read the webpage if I haven't seen that url before I need to call urlopen() and use geturl() to get the final page that link goes to (after the 302 redirects) so I know if I've crawled it yet or not. I don't want to incur the overhead of having to grab the html if I've already parsed that page. thanks!

    Read the article

  • Efficient way to store tuples in the datastore

    - by Drew Sears
    If I have a pair of floats, is it any more efficient (computationally or storage-wise) to store them as a GeoPtProperty than it would be pickle the tuple and store it as a BlobProperty? If GeoPt is doing something more clever to keep multiple values in a single property, can it be leveraged for arbitrary data? Can I store the tuple ("Johnny", 5) in a single entity property in a similarly efficient manner?

    Read the article

  • Good looking programs that use wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • Assigning a material in Blender with a script

    - by Narcolapser
    Question: How do you assign a material with a script to an object in blender? Info: I have this script to import a proprietary model type of mine that is basically a star map with object consisting of a single vertex. in order to make them look like stars and be visible they are all going to have a halo material assigned to them. I'm figuring out how to make this material and give it the values just fine, but I can't seem to get it to assign. I tried the most obvious thing which was: objectName.setMaterial(materialName) but that did nothing. and when i would take an object that had a material and call the getMaterial function on it, it would return nothing. there is something I'm missing here, can some one shed some light on it? Thanks. ~TA

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • How to display multiple images?

    - by misterwebz
    I'm trying to get multiple image paths from my database in order to display them, but it currently doesn't work. Here's what i'm using: def get_image(self, userid, id): image = meta.Session.query(Image).filter_by(userid=userid) permanent_file = open(image[id].image_path, 'rb') if not os.path.exists(image.image_path): return 'No such file' data = permanent_file.read() permanent_file.close() response.content_type = guess_type(image.image_path)[0] or 'text/plain' return data I'm getting an error regarding this part: image[id].image_path What i want is for Pylons to display several jpg files on 1 page. Any idea how i could achieve this?

    Read the article

  • MUD (game) design concept question about timed events.

    - by mudder
    I'm trying my hand at building a MUD (multiplayer interactive-fiction game) I'm in the design/conceptualizing phase and I've run into a problem that I can't come up with a solution for. I'm hoping some more experienced programmers will have some advice. Here's the problem as best I can explain it. When the player decides to perform an action he sends a command to the server. the server then processes the command, determines whether or not the action can be performed, and either does it or responds with a reason as to why it could not be done. One reason that an action might fail is that the player is busy doing something else. For instance, if a player is mid-fight and has just swung a massive broadsword, it might take 3 seconds before he can repeat this action. If the player attempts to swing again to soon, the game will respond indicating that he must wait x seconds before doing that. Now, this I can probably design without much trouble. The problem I'm having is how I can replicate this behavior from AI creatures. All of the events that are being performed by the server ON ITS OWN, aka not as an immediate reaction to something a player has done, will have to be time sensitive. Some evil monster has cast a spell on you but must wait 30 seconds before doing it again... I think I'll probably be adding all these events to some kind of event queue, but how can I make that event queue time sensitive?

    Read the article

  • How can I merge two lists and sort them working in 'linear' time?

    - by Sergio Tapia
    I have this, and it works: # E. Given two lists sorted in increasing order, create and return a merged # list of all the elements in sorted order. You may modify the passed in lists. # Ideally, the solution should work in "linear" time, making a single # pass of both lists. def linear_merge(list1, list2): finalList = [] for item in list1: finalList.append(item) for item in list2: finalList.append(item) finalList.sort() return finalList # +++your code here+++ return But, I'd really like to learn this stuff well. :) What does 'linear' time mean?

    Read the article

  • Django save method

    - by Marijus
    So I have a model with a FileField for excel spreadsheet. What I need to do this add another column in this spreadsheet, in each row let user pick from a drop-down list then save it and display it in html. All the picking and uploading will happen through the admin interface. So I have figured out way how to display a spreadsheet in html, however I have no idea how to write this save method. I could really use some hints and tips..

    Read the article

  • Sending message from one server to another in Twisted

    - by Casey Patton
    I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

    Read the article

  • Can you change/redirect a django form's function by passing in your own function?

    - by Derek
    I'm dealing with django-paypal and want to change the button src images. So I went the the conf.py file in the source and edited the src destination. However, I really want to leave the source alone, and I noticed that the class PayPalPaymentsForm(forms.Form): has def get_image(self): return { (True, self.SUBSCRIBE): SUBSCRIPTION_SANDBOX_IMAGE, (True, self.BUY): SANDBOX_IMAGE, (True, self.DONATE): DONATION_SANDBOX_IMAGE, (False, self.SUBSCRIBE): SUBSCRIPTION_IMAGE, (False, self.BUY): IMAGE, (False, self.DONATE): DONATION_IMAGE, }[TEST, self.button_type] which handles all the image src destinations. Since changing this def in the source is worse than changing conf, I was wondering if there was a way to pass in customized defs you make like passing in initial arguments in forms? This way no source code is changed, and I can customize the get_image def as much as I need. passing in def something like this? def get_image(self): .... .... paypal = { 'amount': 10, 'item_name': 'test1', 'item_number': 'test1_slug', # PayPal wants a unique invoice ID 'invoice': str(uuid.uuid4()), } form = PayPalPaymentsForm(initial=paypal, get_image) Thanks!

    Read the article

  • ahow can I resolve Django Error: str' object has no attribute 'autoescape'?

    - by Angelbit
    Hi have tried to create a inclusion tag on Django but don't work and return str' object has no attribute 'autoescape' this is the code of custom tag: from django import template from quotes.models import Quotes register = template.Library() def show_quote(): quote = Quotes.objects.values('quote', 'author').get(id=0) return {'quote': quote['quote']} register.inclusion_tag('quotes.html')(show_quote) EDIT: Quote class from django.db import models class Quotes(models.Model): quote = models.CharField(max_length=255) author = models.CharField(max_length=100) class Meta: db_table = 'quotes' quotes.html <blockquote id="quotes">{{ quote }}</blockquote>

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • django link format words joined with hypens

    - by soField
    href="http://www.torontolife.com/daily/daily-dish/restauranto/2010/03/10/best-new-restaurants-2010-james-chatto-names-five-honourable-mentions/"Best new restaurants 2010: honourable mentions is django has built in mechanism to format links above i mean words joined with hypens how can achieve this ?

    Read the article

  • Regex and unicode

    - by dbr
    I have a script that parses the filenames of TV episodes (show.name.s01e02.avi for example), grabs the episode name (from the www.thetvdb.com API) and automatically renames them into something nicer (Show Name - [01x02].avi) The script works fine, that is until you try and use it on files that have Unicode show-names (something I never really thought about, since all the files I have are English, so mostly pretty-much all fall within [a-zA-Z0-9'\-]) How can I allow the regular expressions to match accented characters and the likes? Currently the regex's config section looks like.. config['valid_filename_chars'] = """0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ!@£$%^&*()_+=-[]{}"'.,<>`~? """ config['valid_filename_chars_regex'] = re.escape(config['valid_filename_chars']) config['name_parse'] = [ # foo_[s01]_[e01] re.compile('''^([%s]+?)[ \._\-]\[[Ss]([0-9]+?)\]_\[[Ee]([0-9]+?)\]?[^\\/]*$'''% (config['valid_filename_chars_regex'])), # foo.1x09* re.compile('''^([%s]+?)[ \._\-]\[?([0-9]+)x([0-9]+)[^\\/]*$''' % (config['valid_filename_chars_regex'])), # foo.s01.e01, foo.s01_e01 re.compile('''^([%s]+?)[ \._\-][Ss]([0-9]+)[\.\- ]?[Ee]([0-9]+)[^\\/]*$''' % (config['valid_filename_chars_regex'])), # foo.103* re.compile('''^([%s]+)[ \._\-]([0-9]{1})([0-9]{2})[\._ -][^\\/]*$''' % (config['valid_filename_chars_regex'])), # foo.0103* re.compile('''^([%s]+)[ \._\-]([0-9]{2})([0-9]{2,3})[\._ -][^\\/]*$''' % (config['valid_filename_chars_regex'])), ]

    Read the article

  • Problem with Django styling

    - by Brob
    Hi new to django but I'm having issues with the styling of pages. my settings.py contains MEDIA_ROOT = '' MEDIA_URL = '' TEMPLATE_DIRS = ( os.path.join(os.path.dirname(__file__), 'templates'), ) please can someone help me shed some light on what I need to do to get the styles working in my templates Thanks

    Read the article

  • compare two following values in numpy array

    - by Billy Mitchell
    What is the best way to touch two following values in an numpy array? example: npdata = np.array([13,15,20,25]) for i in range( len(npdata) ): print npdata[i] - npdata[i+1] this looks really messed up and additionally needs exception code for the last iteration of the loop. any ideas? Thanks!

    Read the article

  • Inlines in Django Admin

    - by Oli
    I have two models, Order and UserProfile. Each Order has a ForeignKey to UserProfile, to associate it with that user. On the django admin page for each Order, I'd like to display the UserProfile associated with it, for easy processing of information. I have tried inlines: class UserInline(admin.TabularInline): model = UserProfile class ValuationRequestAdmin(admin.ModelAdmin): list_display = ('address1', 'address2', 'town', 'date_added') list_filter = ('town', 'date_added') ordering = ('-date_updated',) inlines = [ UserInline, ] But it complains that UserProfile "has no ForeignKey to" Order - which it doesn't, it's the other way around. Is there a way to do what I want?

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

< Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >