Search Results

Search found 46260 results on 1851 pages for 'google custom search'.

Page 432/1851 | < Previous Page | 428 429 430 431 432 433 434 435 436 437 438 439  | Next Page >

  • adding custom header with classic asp

    - by zurna
    I was wondering if its possible to add custom header with classic asp. In other words, I am looking for classic asp equivalent of .net's Response.AddHeader(). i.e. HttpContext.Response.AddHeader("customheadertruefalse","1");

    Read the article

  • Custom Tags and cfimport

    - by cf_PhillipSenn
    Do Custom Tags work with mappings? I'm trying not to have to address the CustomTags folder as a relative address. I've tried: <cfset this.mappings["/CT"] = Expandpath("/myProjects/Project1/CustomTags")> inside of Application.cfc and then <cfimport prefix="tag" taglib="/CT"> inside of my page, but it doesn't. It says: Cannot import the tag library specified by /CT. The following error was encountered: C:\Inetpub\wwwroot\CT. Ensure that you have specified a valid tag library.

    Read the article

  • search data from FileReader in Java

    - by maya
    hi I'm new in java how to read and search data from file (txt) and then display the data in TextArea or Jtable. for example I have file txt contains data and I need to display this data in textarea after I clicked a button, I have used FileReader , and t1 t2 tp are attributes in the file import java.io.FileReader; import java.io.IOException; String t1,t2,tp; Ffile f1= new Ffile(); FileReader fin = new FileReader("test2.txt"); Scanner src = new Scanner(fin); while (src.hasNext()) { t1 = src.next(); textarea.setText(t1); t2 = src.next(); textarea.setText(t2); tp = src.next(); textarea.setText(tp); f1.insert(t1,t2,tp); } fin.close(); also I have used the inputstream DataInputStream dis = null; String dbRecord = null; try { File f = new File("text2.text"); FileInputStream fis = new FileInputStream(f); BufferedInputStream bis = new BufferedInputStream(fis); dis = new DataInputStream while ( (dbRecord = dis.readLine()) != null) { StringTokenizer st = new StringTokenizer(dbRecord, ":"); String t1 = st.nextToken(); String t2 = st.nextToken(); String tp = st.nextToken(); textarea.setText(textarea.getText()+t1); textarea.setText(textarea.getText()+t2); textarea.setText(textarea.getText()+tp); } } catch (IOException e) { // catch io errors from FileInputStream or readLine() System.out.println("Uh oh, got an IOException error: " + e.getMessage()); } finally { } but both of them don't work ,so please any one help me I want to know how to read data and also search it from file and i need to display the data in textarea . thanks in advance

    Read the article

  • Custom initrd init script: how to create /dev/initctl

    - by Posco Grubb
    I have a virtual machine (VMM is Xen 3.3) equipped with two IDE HDD's (/dev/hda and /dev/hdb). The root file system is in /dev/hda1, where Scientific Linux 5.4 is installed. /dev/hdb contains an empty ext2 file system. I want to protect the root file system from writes by the VM by using aufs (AnotherUnionFS) to layer a writable file system on top of the root file system. The changes to / will be written to the file system located on /dev/hdb. (Furthermore, outside the VM, the file backing the /dev/hda will also be set to read-only permissions, so the VMM should also prevent the VM from modifying at that level.) (The purpose of this setup: be able to corrupt a virtual machine using software-implemented fault injection but preserve the file system image in order to quickly reboot the VM to a fault-free state.) How do I get an initrd init script to do the necessary mounts to create the union file system? I've tried 2 approaches: I've tried modifying the nash script that mkinitrd creates, but I don't know what setuproot and switchroot do and how to make them use my aufs as the new root. Apparently, nobody else here knows either. (EDIT: I take that back.) I've tried building a LiveCD (using linux-live-6.3.0) and then modifying the Bash /linuxrc script from the generated initrd, and I got the mounts correct, but the final /sbin/init complains about /dev/initctl. Specifically, my /linuxrc mounts the aufs at /union. The last few lines of /linuxrc effectively do the following: cd /union mkdir -p mnt/live pivot_root . mnt/live exec sbin/chroot . sbin/init </dev/console >/dev/console 2>&1 When init starts, it outputs something like init: /dev/initctl: No such file or directory. What is supposed to create this FIFO? I found no such filename in the original linuxrc and liblinuxlive scripts. I tried creating it via "mkfifo /dev/initctl", but then init complained about a timeout opening or writing to the FIFO. Would appreciate any help or pointers. Thanks.

    Read the article

  • Adding custom perfomance counters in ASP.Net for service calls

    - by Nithin
    Hi All, I have to show the time taken for a service call in Perfmon from my ASP.Net application. For this, I have added a stopwatch which starts at the service call start and stops at service call stop. Now I have a custom counter which user AverageTimer32 to log the stopwatch values to Perfmon. My question is, how can I show the service names on the Perfmon graph. I am using windows XP (I know windows server perfmon has some fancy stuff).

    Read the article

  • HP-UX - custom rsync path

    - by stack_zen
    Hi. There are a range of HP-UX 11.11 hosts I'm unable to install rsync (I'm limited to a non-privileged user) I've extracted both rsync binary and libpopt.sl, libiconv.sl, libintl.sl from the depots into one of that user's directories: /home/zenith/rsync/ Problem is, I can't get my RH Linux box communicating with it: rsync -e --rsync-path=/home/zenith/rsync/rsync --compress=9 -pgtov --filter=+rs_/'*.log' --exclude='*' [email protected]:/home/zenith/service/logs/ /u01/rsync_depot/service/192.102.14.18/ /usr/lib/dld.sl: Can't find path for shared library: libintl.sl /usr/lib/dld.sl: No such file or directory sh: 1644 Abort(coredump) I've added to the remote host .profile export SHLIB_PATH=/usr/lib:/home/zenith/rsync export PATH=$PATH:/home/zenith/rsync but still, no libintl.sl is found. How can I initialize the correct env variable/ get this to work?

    Read the article

  • ClassCastException when casting custom View subclass

    - by Jens Jacob
    Hi I've run into an early problem with developing for android. I've made my own custom View (which works well). In the beginning i just added it to the layout programmatically, but i figured i could try putting it into the XML layout instead (for consistency). So what i got is this: main.xml: [...] <sailmeter.gui.CompassView android:id="@+id/compassview1" android:layout_width="wrap_content" android:layout_height="wrap_content" android:layout_below="@id/widget55" android:background="@color/white" /> [...] CompassView.java: public class CompassView extends View { } SailMeter.java (activity class): public class SailMeter extends Activity implements PropertyChangeListener { public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); compassview = (CompassView) findViewById(R.id.compassview1); [...] } } (Theres obviously more, but you get the point) Now, this is the stacktrace: 05-23 16:32:01.991: ERROR/AndroidRuntime(10742): Uncaught handler: thread main exiting due to uncaught exception 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): java.lang.RuntimeException: Unable to start activity ComponentInfo{sailmeter.gui/sailmeter.gui.SailMeter}: java.lang.ClassCastException: android.view.View 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2596) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:2621) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at android.app.ActivityThread.access$2200(ActivityThread.java:126) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:1932) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at android.os.Handler.dispatchMessage(Handler.java:99) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at android.os.Looper.loop(Looper.java:123) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at android.app.ActivityThread.main(ActivityThread.java:4595) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at java.lang.reflect.Method.invokeNative(Native Method) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at java.lang.reflect.Method.invoke(Method.java:521) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at dalvik.system.NativeStart.main(Native Method) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): Caused by: java.lang.ClassCastException: android.view.View 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at sailmeter.gui.SailMeter.onCreate(SailMeter.java:51) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2544) 05-23 16:32:02.051: ERROR/AndroidRuntime(10742): ... 11 more Why cant i cast my custom view? I need it to be that type since it has a few extra methods in it that i want to access. Should i restructure it and have another class handle the logic, and then just having the view being a view? Thanks for any help.

    Read the article

  • How do I add custom buttons to Formtastic?

    - by jklina
    I'm using the Formtastic Rails gem in my app and its been great, but I would really like to add a second button, other than the bundled "commit" button that redirects back. I can't seem to find any information on how to add a custom button. Any information would be greatly appreciated!

    Read the article

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • Help Email Account Management among multiple users

    - by CogitoErgoSum
    So I preface this with saying this may belong in IT Security, not too sure feel free to move. Currently we have an email account [email protected] - hosted via google apps (as is all our email). We had an incident where we had to terminate an employee. This employee however had the password for this account as we have 20-30 people utilizing it at any given point to manage customer emails etc. Thinking on this I feel there must be a better way to manage access. With Google you can associate upto 10 email accounts to another the problem is we have more like 20-30 people going. We were evaluating tools such as SalesForce and Assistly where people have their own login credentials and then the system contains the appropriate smtp information for the [email protected] email address to send emails from it rather than a users personal account. Aside from those options does anyone have any other thoughts? One suggestion floated was moving everyone to desktop clients and saving the PW info there so they could only login from their physical workstation but we may have situations where we'd like employees to work remotely. Does anyone have experience with this sort of system where ~20-30 people are responding from one email box and how to manage security and access?

    Read the article

  • Starting/Stopping Custom PHP Chat Server Linux Service (CentOS)

    - by chad
    I have been trying all night to get this service working properly. I created this script from a template and am very new to bash coding. I wrote a fully functioning chat server in php which runs endlessly, but now want to make it a dedicated service. I want to do this so that it starts on server boot and boots back up if possible when there are any down-times with the server. The issue is that I need this thing to run in a detached screen so that I can monitor packet data or send server commands via SSH when need-be. The main problem that i'm having is that it needs to have its own PID when it starts so that I can stop/restart it when needed. I am the type who grinds on coding until I figure it out, but this is so new to me that it seems the learning curve here is very steep and frustrating. Below is my code if anybody can please help me with this one, i've gotten so tired I can't even concentrate any more :( #!/bin/sh # # chatserver # # chkconfig: 345 20 90 # description: chatServer Linux Service Daemon \ # for general server handling ### BEGIN INIT INFO # Provides: chatserver # Required-Start: $local_fs $network $named $syslog # Required-Stop: $local_fs $syslog # Default-Start: 3 4 5 # Default-Stop: 0 1 2 6 # Short-Description: This service maintains the chatServer # Description: chatServer Linux Service Daemon # for general server handling ### END INIT INFO # Source function library. . /etc/rc.d/init.d/functions exec="screen php -q /var/www/html/chatServer.php" prog="chatserver" config="/etc/sysconfig/$prog" pidfile="/var/run/chatserver.pid" [ -e /etc/sysconfig/$prog ] && . /etc/sysconfig/$prog lockfile=/var/lock/subsys/$prog start() { #$exec || exit 5 echo -n $"Starting $prog: " daemon $exec --name=$exec --pidfile=$pidfile retval=$? echo [ $retval -eq 0 ] && touch $lockfile return $retval } stop() { echo -n $"Stopping $prog: " killproc -p $pidfile rm -f $pidfile retval=$? echo [ $retval -eq 0 ] && rm -f $lockfile return $retval } restart() { stop start } reload() { restart } force_reload() { restart } rh_status() { # run checks to determine if the service is running or use generic status status $prog } rh_status_q() { rh_status >/dev/null 2>&1 } case "$1" in start) rh_status_q && exit 0 $1 ;; stop) rh_status_q || exit 0 $1 ;; restart) $1 ;; reload) rh_status_q || exit 7 $1 ;; force-reload) force_reload ;; status) rh_status ;; condrestart|try-restart) rh_status_q || exit 0 restart ;; *) echo $"Usage: $0 {start|stop|status|restart|condrestart|try-restart|reload|force-reload}" exit 2 esac exit $?

    Read the article

  • WPF 4, ListView and ListCollectionView custom sorting

    - by JustABill
    I'm trying to use a custom sort with a ListView, as described in this blog entry. I'm doing ListCollectionView view = (ListCollectionView)CollectionViewSource.GetDefaultView(TheList.ItemsSource); as recommended there and in several other places, but for some reason I'm getting "Unable to cast object of type 'MS.Internal.Data.EnumerableCollectionView' to type 'System.Windows.Data.ListCollectionView'." (TheList is of type ListView). What could be causing this?

    Read the article

  • JSP Custom Tag Library vs JSP2 Tag Files

    - by Vinayak.B
    Can anybody gimme the idea about the JSP custom tag library and the JSP 2 Tag files.. Are this two are alternatives to use....??? If there is any comparision(or merits and demerits) among this please do specify.. And which one of this is better to work with.. I m waiting for the kind suggestions.. Regards, Vinayak

    Read the article

  • Excel 2007 Conditional Formatting is not properly using custom formula provided

    - by Charles
    In Excel 2007, I want to conditionally color a row if it is odd numbered and then vary the coloring depending on if a specific cell (in column E) in that row contains a number (green) or empty(red). E.g. if E15 has a value of 2 and E13 has no entry, I would expect row 15 to be green and row 13 to be red. My two formulas are: To color red: =IF((MOD(ROW(),2) = 1),NOT(ISNUMBER(INDIRECT("$E$"&ROW()))), FALSE) To color green: =IF((MOD(ROW(),2) = 1),ISNUMBER(INDIRECT("E"&ROW())), FALSE) If I paste these formulas into cells on the worksheet I get the expected values. For row 15 the "red" equation is false and the "green" equation is true. For Row 13 the "red" equation is true and the "green equation is false. However if I use these formulas in the conditional formating use formula feature, all of my rows are red, any thoughts?

    Read the article

  • asp.net mvc session and custom MembershipProvider

    - by niao
    Greetings, in my ASP.NET MVC application I've created a custom MembershipProvider. It works fine, however when user is successfully logged, I would like to create an Operator object and make it possible to access this object on every controller and view. I was thinking about session to do this but when session expires this object is null but user that had been logged using MembershipProvider is still logged in. Is there any way I can store my Operator object in MembershipProvider and access it on every controller and view I need?

    Read the article

  • multiple keys and values with google-collections

    - by flash3000
    Hello, I would like use google-collection in order to save the following file in a Hash with multiple keys and values Key1_1, Key2_1, Key3_1, data1_1, 0, 0 Key1_2, Key2_2, Key3_2, data1_2, 0, 0 Key1_3, Key2_3, Key3_3, data1_3, 0, 0 Key1_4, Key2_4, Key3_4, data1_4, 0, 0 The first three columns are the different keys and the last two integer are the two different values. I have already prepare a code which spilt the lines in chunks. import java.io.BufferedReader; import java.io.FileNotFoundException; import java.io.FileReader; import java.io.IOException; public class HashMapKey { public static void main(String[] args) throws FileNotFoundException, IOException { String inputFile = "inputData.txt"; BufferedReader br = new BufferedReader(new FileReader(inputFile)); String strLine; while ((strLine = br.readLine()) != null) { String[] line = strLine.replaceAll(" ", "").trim().split(","); for (int i = 0; i < line.length; i++) { System.out.print("[" + line[i] + "]"); } System.out.println(); } } } Unfortunately, I do not know how to save these information in google-collection? Thank you in advance. Best regards,

    Read the article

  • Custom command for '\begin{environment}...\end{environment}'

    - by user328369
    To enter a bit of dialogue using the screenplay package, I have to use \begin{dialogue}{Johnny} Some dialogue. \end{dialogue} \begin{dialogue}{Jane} I see. \end{dialogue} It gets a bit tedious after a while. Is it possible to specify a custom command so that I can use something like \dialogue{Johnny} Some dialogue. \dialogue{Jane} I see. instead?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 428 429 430 431 432 433 434 435 436 437 438 439  | Next Page >