Search Results

Search found 46260 results on 1851 pages for 'google custom search'.

Page 433/1851 | < Previous Page | 429 430 431 432 433 434 435 436 437 438 439 440  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Selenium IDE and custom confirm() function conflict

    - by sakhunzai
    I am using simple modal dialog by Eric Martin. And have defined a function e.g function confirm(message, options) {.... } To customize all confirm dialogs. Its working nicely accross all the browsers.Except when I enable Selenium IDE ,my custom confirm dialog function fails to capture "options" parameters and firefox console echos like this: options is undefined callback=options.callback; Error When Selenium IDE is visible Normal Behaviour When Selenium IDE is closed Please help me sort out this issue so I should able to run selenium tests.

    Read the article

  • Make Apache server available on a LAN via custom ServerName

    - by samwatt
    Hi, is it possible to set up an Apache server on a machine which is part of a LAN, then allow machines on the LAN to access the server via a custom ServerName (instead of Localhost). I want to serve a simple website in an office space using a short ServerName (no ports etc if possible), but I want to make sure this is possible (after originally being certain it was!). THanks in advance.

    Read the article

  • Pop3 to SMTP message custom forwarder in C#

    - by Troy
    I'd like to write a service that periodically checks a POP3 account for new messages and based on custom business logic forwards the messages to an appropriate "To", and possibly changes the "From" as well. I might need to keep some messages on the server until certain conditions are ready for them to be forwarded. I found a sample using Chilkat .NET components that might work: http://www.example-code.com/csharp/pop3_forwarder.asp My question is: Are there any other examples of this in the .NET space using any other components? Thanks!

    Read the article

  • Custom title bar without padding (Android)

    - by Casebash
    So I am using the techniques in this thread to use a custom background for my titlebar. Unfortunately the framework places my layout inside a FrameLayout which has padding and so the image doesn't cover the whole bar, but instead has gray borderes. Is there anyway to remove this padding? I can't just set the padding attributes because I do not create the frame layout.

    Read the article

  • fail2ban custom action to permanent ban IPs from China

    - by John Magnolia
    When a IP address gets banned how can I check if the banned IP address is from China. If yes, then add it to the permanent ban list. I have found this nice guide which write the banned IP to file. Reason: I am getting a lot of brute force attacks from China daily, thankfully fail2ban is helping restrict this although they appear to be getting worse and they are just changing their IP Address. Or even better would be if there was a maintained database of known hacker IP addresses. Example 1 Hi, The IP 60.169.78.77 has just been banned by Fail2Ban after 4 attempts against vsftpd. Here are more information about 60.169.78.77: % [whois.apnic.net node-7] % Whois data copyright terms http://www.apnic.net/db/dbcopyright.html inetnum: 60.166.0.0 - 60.175.255.255 netname: CHINANET-AH descr: CHINANET anhui province network descr: China Telecom descr: A12,Xin-Jie-Kou-Wai Street descr: Beijing 100088 country: CN admin-c: CH93-AP tech-c: JW89-AP mnt-by: APNIC-HM mnt-routes: MAINT-CHINANET-AH mnt-lower: MAINT-CHINANET-AH status: ALLOCATED PORTABLE changed: [email protected] 20040721 source: APNIC person: Chinanet Hostmaster nic-hdl: CH93-AP e-mail: [email protected] address: No.31 ,jingrong street,beijing address: 100032 phone: +86-10-58501724 fax-no: +86-10-58501724 country: CN changed: [email protected] 20070416 mnt-by: MAINT-CHINANET source: APNIC person: Jinneng Wang address: 17/F, Postal Building No.120 Changjiang address: Middle Road, Hefei, Anhui, China country: CN phone: +86-551-2659073 fax-no: +86-551-2659287 e-mail: [email protected] nic-hdl: JW89-AP mnt-by: MAINT-NEW changed: [email protected] 19990818 source: APNIC Regards, Fail2Ban Example 2 Hi, The IP 60.169.78.81 has just been banned by Fail2Ban after 4 attempts against vsftpd. Here are more information about 60.169.78.81: % [whois.apnic.net node-6] % Whois data copyright terms http://www.apnic.net/db/dbcopyright.html inetnum: 60.166.0.0 - 60.175.255.255 netname: CHINANET-AH descr: CHINANET anhui province network descr: China Telecom descr: A12,Xin-Jie-Kou-Wai Street descr: Beijing 100088 country: CN admin-c: CH93-AP tech-c: JW89-AP mnt-by: APNIC-HM mnt-routes: MAINT-CHINANET-AH mnt-lower: MAINT-CHINANET-AH status: ALLOCATED PORTABLE changed: [email protected] 20040721 source: APNIC person: Chinanet Hostmaster nic-hdl: CH93-AP e-mail: [email protected] address: No.31 ,jingrong street,beijing address: 100032 phone: +86-10-58501724 fax-no: +86-10-58501724 country: CN changed: [email protected] 20070416 mnt-by: MAINT-CHINANET source: APNIC person: Jinneng Wang address: 17/F, Postal Building No.120 Changjiang address: Middle Road, Hefei, Anhui, China country: CN phone: +86-551-2659073 fax-no: +86-551-2659287 e-mail: [email protected] nic-hdl: JW89-AP mnt-by: MAINT-NEW changed: [email protected] 19990818 source: APNIC Regards, Fail2Ban Example 3 Hi, The IP 222.133.244.99 has just been banned by Fail2Ban after 4 attempts against vsftpd. Here are more information about 222.133.244.99: % [whois.apnic.net node-6] % Whois data copyright terms http://www.apnic.net/db/dbcopyright.html inetnum: 222.133.244.96 - 222.133.244.127 netname: LCZFFHQ country: CN descr: liaochenggovermentfanghuoqiang admin-c: DS95-AP tech-c: DS95-AP status: ASSIGNED NON-PORTABLE changed: [email protected] 20060122 mnt-by: MAINT-CNCGROUP-SD source: APNIC route: 222.132.0.0/14 descr: CNC Group CHINA169 Shandong Province Network country: CN origin: AS4837 mnt-by: MAINT-CNCGROUP-RR changed: [email protected] 20060118 source: APNIC person: Data Communication Bureau Shandong nic-hdl: DS95-AP e-mail: [email protected] address: No.77 Jingsan Road,Jinan,Shandong,P.R.China phone: +86-531-6052611 fax-no: +86-531-6052414 country: CN changed: [email protected] 20050330 mnt-by: MAINT-CNCGROUP-SD source: APNIC Regards, Fail2Ban

    Read the article

  • Custom flash uploader breaks only on Media Temple

    - by LaserWolf
    I've built a flash uploader to upload files up to 100MB using a php backend. It works wonderfully on our dev server, on a hostgator vps, and on one of our clients' servers running Debian. It will not work on our Media Temple (dv)3.5 and I don't know why. The upload will start but will choke after a few seconds with this flash error message: ioerror: [IOErrorEvent type="ioError" bubbles=false cancelable=false eventPhase=2 text="Error #2038: File I/O Error. URL: http://..._upload.php"] The problem seems to be specific to the asynchronous nature of the flash uploader because if I try a straight php upload it works fine. The php.ini settings are set to allow such a large upload as well. Also, I've thoroughly googled flash, 2038, I/O error, etc but have yet to find anything that helped. Here's the weird part though: We work in Seattle. It won't work from the office. It won't work from home. But, while on the phone with MT's support, they were able to upload a file through our flash uploader just fine. I'm not sure where his office was located but I think it was Atlanta. So the problem also seems specific to physical location. Has anyone run into this sort of problem before?

    Read the article

  • Custom uitoolbar gets partly hidden

    - by Jakub
    I'd like to add a custom UIToolbar to my UIViewController. In Interface Builder I add the uitoolbar at the top of my view, and it looks just fine. However, when I run the app in the Simulator it gets hidden by the default iphone bar (this one with the clock, battery status, etc.). Here you can see how it looks like: Any ideas?

    Read the article

  • C# Custom EventArgs with no constructor?

    - by Motig
    I have a problem; I'm using an external library where one particular event has its own custom eventargs; with no constructor. If I want to throw my own event using these eventargs, how can I? I'll give more detail if asked, but I'm not sure what exactly I should be giving. :)

    Read the article

  • Building a DVR system for use with custom windows application (video analytics)

    - by Michael
    Is there a good PCIe DVR capture card that has at least 4 channels as well as the hardware encoding? It would have to have decent driver support in Windows xp or windows 7. I have looked at various video capture cards as well as an integrated video capture card/motherboard from Huperlabs. But so far I have not found one with a decent review and that has good driver support that I can verify. A really small card would be nice because I am trying to get a fairly small form factor. Huperlabs stuff is pretty awesome but they are slow to get back to me and they bundle their analytics software with the hardware (extra cost for nothing) The dvr is being used for security.

    Read the article

  • Scribe-LinkedIn Search API

    - by Rupeshit
    Hi folks, I want to fetch data from the LinkedIn API for that I am using the Scribe library.All requests are giving me data as expected but when I tried two facet in the url then scribe is not able to get data from LinkedIn API. If I gave this URL : http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0 then it gives me proper result but if I entered this URL: http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0&facet=network,F i.e. URL containing multiple facets then it gives me this output: <?xml version="1.0" encoding="UTF-8" standalone="yes"?> <error> <status>401</status> <timestamp>1292487039516</timestamp> <error-code>0</error-code> <message> [unauthorized].OAU:CiEgwWDkA5BFpNrc0RfGyVuSlOh4tig5kOTZ9q97qcXNrFl7zqk- Ts7DqRGaKDCV|94f13544-9844-41eb-9d53-8fe36535bbc3|*01|*01:1292487039:VseHXaJXM2gerxJyn6kHhIka7zw=</message> </error> Any kind of help to solve this will be appreciated.Thanks.

    Read the article

  • C# equivalent of the C++ custom project Wizard

    - by gbjbaanb
    Hi., I have an existing wizard template created for VC++ from year back, ported to VS2008. It uses the custom wizard jscript/html templating system and DTE object. I've used this successfully for years, but now I want to create an entry for a standard C# project, I see there's no way to customise the C# project settings - the methods are for VC++ only. Is there something closely related to this for C# projects (or do I have to learn yet another way of creating a wizard for .net apps?)

    Read the article

  • SharePoint 2010 Custom WCF Service - Windows and FBA Authentication

    - by e-rock
    I have SharePoint 2010 configured for Claims Based Authentication with both Windows and Forms Based Authentication (FBA) for external users. I also need to develop custom WCF Services. The issue is that I want Windows credentials passed into the WCF Service(s); however, I cannot seem to get the Windows credentials passed into the services. My custom WCF service appears to be using Anonymous authentication (which has to be enabled in IIS in order to display the FBA login screen). The example I have tried to follow is found at http://msdn.microsoft.com/en-us/library/ff521581.aspx. The WCF service gets deployed to _vti_bin (ISAPI folder). Here is the code for the .svc file <%@ ServiceHost Language="C#" Debug="true" Service="MyCompany.CustomerPortal.SharePoint.UI.ISAPI.MyCompany.Services.LibraryManagers.LibraryUploader, $SharePoint.Project.AssemblyFullName$" Factory="Microsoft.SharePoint.Client.Services.MultipleBaseAddressBasicHttpBindingServiceHostFactory, Microsoft.SharePoint.Client.ServerRuntime, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" CodeBehind="LibraryUploader.svc.cs" %> Here is the code behind for the .svc file [ServiceContract] public interface ILibraryUploader { [OperationContract] string SiteName(); } [BasicHttpBindingServiceMetadataExchangeEndpoint] [AspNetCompatibilityRequirements(RequirementsMode = AspNetCompatibilityRequirementsMode.Required)] public class LibraryUploader : ILibraryUploader { //just try to return site title right now… public string SiteName() { WindowsIdentity identity = ServiceSecurityContext.Current.WindowsIdentity; ClaimsIdentity claimsIdentity = new ClaimsIdentity(identity); return SPContext.Current.Web.Title; } } The WCF test client I have just to test it out (WPF app) uses the following code to call the WCF service... private void Button1Click(object sender, RoutedEventArgs e) { BasicHttpBinding binding = new BasicHttpBinding(); binding.Security.Mode = BasicHttpSecurityMode.TransportCredentialOnly; binding.Security.Transport.ClientCredentialType = HttpClientCredentialType.Ntlm; EndpointAddress endpoint = new EndpointAddress( "http://dev.portal.data-image.local/_vti_bin/MyCompany.Services/LibraryManagers/LibraryUploader.svc"); LibraryUploaderClient libraryUploader = new LibraryUploaderClient(binding, endpoint); libraryUploader.ClientCredentials.Windows.AllowedImpersonationLevel = System.Security.Principal.TokenImpersonationLevel.Impersonation; MessageBox.Show(libraryUploader.SiteName()); } I am somewhat inexperienced with IIS security settings/configurations when it comes to Claims and trying to use both Windows and FBA. I am also inexperienced when it comes to WCF configurations for security. I usually develop internal biz apps and let Visual Studio decide what to use because security is rarely a concern.

    Read the article

  • Building optimal custom machine for Sql Server

    - by Chad Grant
    Getting the hardware in the mail any day. Hardware related to my question: x10 15.5k RPM SAS Segate Cheetah's x2 Adaptec 5405 PCIe Raid cards Motherboard has integrated SAS raid. Was thinking I would build 2 RAID 10 arrays one for data and one for logs The remaining 2 drives a RAID 0 for TempDB Will probably throw in a drive for OS. Does putting the Sql Server application / exe's on a raid make a difference and is there any impact of leaving the OS on a relatively slow disk compared to the raid arrays? I have 5/6 DBs combined < 50 gigs. With a relatively good / constant load. Estimating 60-7% reads vs writes. Planning on using log shipping as well if that matters. Any advice or suggestions?

    Read the article

  • Custom reports for Hudson CI

    - by Valera Kolupaev
    Hello. My past CI experience is tightly coupled with CC.Net, but for sake of innovations I want to try Hudson server as CI Server. I wondering, is there a possibility to embed into build report custom reports, by transforming XSLT output of various tools that runs on CI? For example, I have hand-made IIS Log parser, that outputs XML, is it possible to include it's result into build log and fail build on certain condition?

    Read the article

  • Qt creator, insert custom menu at specified place into menu bar

    - by user363778
    Hi, I have created a menu bar and some menus with Qt creator. One of the menus had to be coded to use QActionGroup features. Now it is easy to add my custom menu to the menu bar with: printMenu = menuBar()-addMenu(tr("&Print")); but my menu will be in the last position of the menu bar. How do I add my menu at a specified place? (e.g. the second place right after the File menu) Greetings

    Read the article

  • Display custom file format's metadata in Windows Explorer

    - by Benny Jobigan
    When viewing a jpg or mp3 in Windows Explorer, the bottom pane shows metadata from the media file. Furthermore, for video and picture, the icon is shown as a preview of the media. Is there a way to add this kind of functionality to windows for custom file types that aren't supported by default in windows? Is there a certain sort of plugin or extension that must be written? If so, how is it implemented? Thank you.

    Read the article

  • using moogaloop to embed a custom video player from Vimeo

    - by scullytr
    Anyone have any luck using Vimeo's moogaloop player? I'm wanting to use Vimeo's supposed API functions to create custom buttons to control the Vimeo player on my site. Here's the reference page for moogaloop: http://vimeo.com/api/docs/moogaloop I've been able to get the player to embed using SWFObject, but I can't seem to get the API functions to work (e.g. api_play()). Any help is greatly appreciated. Thanks! -Tim.

    Read the article

  • really weird DNS problem in Ubuntu {after one month, seems like ISP problem}

    - by OmniWired
    Hello everyone. I been having this random dns problem, in Ubuntu 10.04 and in 10.10 it started about 2 weeks ago after (I believe) an update. Basically when I go to a website randomly I get that the website I'm visiting is not available ("Oops! Google Chrome could not connect to ..." & "This webpage is not available."). I tested with Chromium "7.0.515.0 (58587)" and Firefox minefield (4.0ish) and 3.6.9. I did these 4 things already: /etc/default/grub GRUB_CMDLINE_LINUX="ipv6.disable=1" and this: /etc/sysctl.conf net.ipv6.conf.all.disable_ipv6 = 1 net.ipv6.conf.default.disable_ipv6 = 1 net.ipv6.conf.lo.disable_ipv6 = 1 *disabling Chromium DNS pre-fetching *using Google and OpenDNS servers as well as ISP DNS servers. But didn't improve, also no other computers in my network have the same problem. All computer wired to the same router. I'm a software engineer that run out of ideas, please help me. Thanks in advance. UPDATE: some programs (synaptic / firefox update/ vuze(azureus)) say connection refused for the error. Most of the time a second try will fix the "refusal". UPDATE2: I found out with Wireshark, that everytime I have this problem i've got this 192.168.0.10 8.8.8.8 ICMP Destination unreachable (Port unreachable) Confirmed an ISP error. ISP;Speedy Location: Argentina, Buenos Aires (capital Federal) Area.

    Read the article

< Previous Page | 429 430 431 432 433 434 435 436 437 438 439 440  | Next Page >