Search Results

Search found 15704 results on 629 pages for 'block world'.

Page 468/629 | < Previous Page | 464 465 466 467 468 469 470 471 472 473 474 475  | Next Page >

• Time drift in Cloud Server - need to mainpulate GRUB config

  - by Aditya Advani

  We are hosting a VPS on a popular host and are experiencing a regular time drift of several minutes a day forward (approx 7). Linux Kernel: 2.6.18-164.11.1.el5 GNU/Linux Distro: CentOS release 5.4 (Final) We reached out to our hosting provider and their support advised us " This is a known issue with Cloud Servers. To fix this you will need to add one line to your grub config located at: /boot/grub/menu.lst The line you need to add is: noapic nolapic divider=10 nolapic_timer This should correct this issue. You will need to restart after this is added in. " Because I am wary of manipulating grub, mostly I'm terrified that our server may fail to restart - I ask you guys, the pro *nix admins - where exactly in this file does the recommended insertion below: # line from 1&1 for time syncing issue (Case 5163) noapic nolapic divider=10 nolapic_timer go? Please specify where exactly, and whether the order of commands is or is not important. Why is the block below "title CentOS ..." indented? If someone could give me an overview of how this works or point me to a resource that's easy to follow, that's what I'm looking for immediately, a light overview or basic understanding of what I;m doing. If GRUB and bootloaders are a deep dark treasure trove of kernel hacking or something, that's great well-recommended in-depth resources are also very welcome. This is my current /boot/grub/menu.lst # grub.conf generated by anaconda # # Note that you do not have to rerun grub after making changes to this file #boot=/dev/sda # serial --unit=0 --speed=57600 terminal --timeout=5 serial console timeout=5 title CentOS (2.6.18-164.11.1.el5) root (hd0,0) kernel /boot/vmlinuz-2.6.18-164.11.1.el5 ro root=/dev/hda1 console=tty0 console=tty initrd /boot/initrd-2.6.18-164.11.1.el5.img MOST IMPORTANT: I need to know where in the file above it is appropriate to paste the suggested line so I can confidently restart my VPS after manipulating GRUB config

  Read the article

• authbind, privbind or iptables REDIRECT (port 80 to 8080)?

  - by chris_l

  Hi, I'd like to run Glassfish v3 as a non-privileged user on Linux (Debian), but make it available on port 80. I'm currently doing this with iptables: iptables -t nat -I PREROUTING -p tcp -d x.x.x.x --dport 80 -j REDIRECT --to-port 8080 This works, but I wonder: If this has any significant performance impact compared to binding directly to port 80 If I could make a similar setup also work for HTTPS (or if that must run on 443) If there's a way to avoid other users from binding to port 8080 (in case my server crashes) - maybe block that port permanently to other users somehow? ...or if I should use authbind/privbind instead? Problem: I couldn't make it work with authbind or privbind so far. For authbind, I edited asadmin's last line to: exec authbind --deep "$JAVA" -Djava.net.preferIPv4Stack=true -jar ... For privbind: exec privbind -u glassfish "$JAVA" -Djava.net.preferIPv4Stack=true -jar ... (Only) with these settings, I can successfully perform a create-domain --domainport 80. This proves, that authbind and privbind actually work (the authbind version of the script is called by the glassfish user; the privbind version is called by root of course). However, in both cases I get the following exception, when starting the domain (start-domain): [#|2010-03-20T13:25:21.925+0100|SEVERE|glassfishv3.0|javax.enterprise.system.core.com.sun.enterprise.v3.server|_ThreadID=11;_ThreadName=FelixStartLevel;|Shutting down v3 due to startup exception : Permission denied: 80=com.sun.enterprise.v3.services.impl.monitor.MonitorableSelectorHandler@1fc25e5|#] I haven't found a solution for that yet (after searching the web, it seems, that this isn't so easy?) But maybe, the solution with iptables is good enough - what do you think? Thanks, Chris

  Read the article

• When using procmail with maildir, it returns error with code I found

  - by bradlis7

  I'm not an expert at procmail, but I have this code: DROPPRIVS=yes DEFAULT=$HOME/Maildir/ :0 * ? /usr/bin/test -d $DEFAULT || /bin/mkdir $DEFAULT { } :0 E { # Bail out if directory could not be created EXITCODE=127 HOST=bail.out } MAILDIR=$HOME/Maildir/ But, when the directory already exists, sometimes it will send a return email with this error: 554 5.3.0 unknown mailer error 127. The email still gets delivered, mind you, but it sends back an error code. I fixed this temporarily by commenting out the EXITCODE and HOST lines, but I'd like to know if there is a better solution. I found this block of code in multiple places across the net, but couldn't really find why this error was coming back to me. It seems to happen when I send an email to a local user, sometimes the user has a .forward file to send it on to other users, sometimes not, but the result has been the same. I also tried removing DROPPRIVS, just in case it was messing up the forwarding, but it did not seem to affect it. Is the line starting with * ? /usr/bin/test a problem? The * signifies a regex, but the ? makes it return an integer value, correct? What is the integer being matched against? Or is it just comparing the integer return value? Thanks for the help.

  Read the article

• Is it possible to be a Linux professional studying on your own?

  - by Marc Jr

  I read economics at university(nothing to see with linux, isn't it? :P). I have some basic knowledge about booting process, Linux Kernel compiling from source and stuff like that. But of course I have still much to learn sometimes some errors appears and "voila" I am lost. I had: Ubuntu, Fedora, OpenSuse, Arch.. using Gentoo now. I'd like to know what you linux users, professionals, administrators... would think it is the best way to learn linux in a professional way. Is it worth studying it and passing the LPIC test enough to work in the linux world? or do I need going to IT uni? I've heard LFS is a good way of learning about linux, is that real? I've been thinking about getting to LFS learn about more deeply about the linux process and learning scripts. It is possible to do this way? if anyone has a tip or a good way of doing, maybe someone did it. Any tip is very welcome. Words from a person in love with linux. :D The best, Marc

  Read the article

• How to get the permissions right for /dev/raw1394

  - by Mark0978

  I recently upgraded one of my ubuntu machines to Karmic and I'm having trouble getting the permissions of /dev/raw1394 set to 0666. They only thing this machine is used for is recording audio from a firepod which uses /dev/raw1394 via jackd and there are no other FireWire devices connected, so security around this device is not really an issue. If I run as root, everything works as expected, but I have some folks that run the recorder that I don't want to have root access. However, I can't figure out which lines setup the perms I've tied this: /etc/udev/permissions.d/raw1394.rules:raw1394:root:root:0666 And I have this setup (default install) /lib/udev/rules.d/75-persistent-net-generator.rules:SUBSYSTEMS=="ieee1394", ENV{COMMENT}="Firewire device $attr{host_id})" /lib/udev/rules.d/75-cd-aliases-generator.rules:# the "path" of usb/ieee1394 devices changes frequently, use "id" /lib/udev/rules.d/75-cd-aliases-generator.rules:ACTION=="add", SUBSYSTEM=="block", SUBSYSTEMS=="usb|ieee1394", ENV{ID_CDROM}=="?*", ENV{GENERATED}!="?*", \ /lib/udev/rules.d/60-persistent-storage-tape.rules:KERNEL=="st*[0-9]|nst*[0-9]", ATTRS{ieee1394_id}=="?*", ENV{ID_SERIAL}="$attr{ieee1394_id}", ENV{ID_BUS}="ieee1394" /lib/udev/rules.d/50-udev-default.rules:# FireWire (deprecated dv1394 and video1394 drivers) /lib/udev/rules.d/50-udev-default.rules:KERNEL=="dv1394-[0-9]*", NAME="dv1394/%n", GROUP="video" /lib/udev/rules.d/50-udev-default.rules:KERNEL=="video1394-[0-9]*", NAME="video1394/%n", GROUP="video" /lib/udev/rules.d/60-persistent-storage.rules:KERNEL=="sd*[!0-9]|sr*", ATTRS{ieee1394_id}=="?*", SYMLINK+="disk/by-id/ieee1394-$attr{ieee1394_id}" /lib/udev/rules.d/60-persistent-storage.rules:KERNEL=="sd*[0-9]", ATTRS{ieee1394_id}=="?*", SYMLINK+="disk/by-id/ieee1394-$attr{ieee1394_id}-part%n" And I find these lines in /var/log/syslog Apr 30 09:11:30 record kernel: [ 3.284010] ieee1394: Node added: ID:BUS[0-00:1023] GUID[000a9200c7062266] Apr 30 09:11:30 record kernel: [ 3.284195] ieee1394: Host added: ID:BUS[0-01:1023] GUID[00d0035600a97b9f] Apr 30 09:11:30 record kernel: [ 18.372791] ieee1394: raw1394: /dev/raw1394 device initialized What I can't figure out, is which line actually creates that raw1394 device in the first place. How do you get /dev/raw1394 to have permissions 0666?

  Read the article

• How do I effectively use WinSCP on my GoDaddy Dedicated Hosting

  - by Scott

  After being told that Virtual Private Servers would not fit the scope of my project, I have timidly entered the world of dedicated hosting. Unfortunately, this is forcing me how to learn the basics of being a Linux server admin. GoDaddy has a master account for the server. When you use SSH, they want you to use "su" to switch to the root user. Thus far, I have been able to do everything I have needed to thus far via the command line as this root user. However, now I need to upload files to my server. I'm used to using WinSCP to upload files. I can use my general server account to view the files but when I try to drag or create files its says that I cannot because I do not have permission to do so. I have researched the WinSCP documentation and it seems that this "su" function is beyond the scope of the program. How am I to grant myself access to upload these files using SSH? Should I create a user with the proper permissions? I'm happy to do this but thus far I have not been able to make sense of what I have found online. I'm going to try and move forward but any help and/or insight is appreciated.

  Read the article

• Running Mathematica-5 remotely

  - by oxinabox.ucc.asn.au

  I have Mathematica 5 - a powerful CAS. I have a cheap netbook (running Windows XP), wich not only is too slow to run mathmatica on, I doubt it has the harddrive space. I do however have remote access to a number of very powerful computers, (most of wich run variose Linuxes, but one of which is Windows Server 2008, though I'ld rather not use this one*). Mostly over SSH but other protocols can be arraged for some, I'm sure. So I'ld like to install Mathematica onto one of these machine and then run it remotely. Either from the command line via Putty or via some other method. I glanced through the mathematical documentation and read something about using some MathLink program, which links the front end installed on my computer to a remote kernel. Anyone have any experience with this? I'm not sure if this belongs here or in SuperUser. At the moment, it's being tinkered with, and when the tinkering stops it'll likely be used to run multiple thin terms. As compared to the Linux machines: I have access to a dual 2.4 Xeon with 3GB RAM, which the rest of the world seems to have completely forgotten about (runs freeBSD!).

  Read the article

• iSCSI, failover and XenServer

  - by jemmille

  I have an iSCSI fail over implementation setup so if one of my storage units fails the other takes over immediately (it also runs the NFS shares). When fail over occurs, volumes are exported, the IP is switched to the other machine and the targets are reconfigured. The fail over of the storage system itself works just fine. I use NexentaStor for my filer. When I do a test (manual) fail over of my storage the following occurs: Note: I run the admin VM's on NFS and customer based VM's on iSCSI All NFS based VM's remain up and working perfectly through the failover and after All VM 's running on iSCSI eventually report the following: An error about not being able to write to a particular block An error about journaling not working Then the file system goes RO To get the VM's working again I have to do the following: Force shutdown of the "broken" VM's. Detach the iSCSI SR Re-attach the iSCSI SR Boot the VM on a different server (5 in my pool) If I don't boot on a different server I get this error "Internal error: Failure("The VDI <uuid&gt; is already attached in RW mode; it can't be attached in RO mode!")" The only way I have found to fix that error is to reboot the entire server it was running on previously which is obviously a huge pain. Currently multipathing is NOT enabled (but can be and the same thing still occurs). I have edited much of the /etc/iscsid.conf file to work with the timeout settings but to no avail. In short, my storage fails over properly but XenServer does not keep the connection alive. As a thought, the error that shows up in #4 above might be the ultimate cause and fixing that would fix everything? Any help would be appreciated more than you know.

  Read the article

• Adding Static IP's to the NIC

  - by Brett Powell

  We are currently working on migrating a lot of new machines to our network, and my job this morning was to setup all of the IP Addresses. I worked on this all morning, and when I got back tonight I was informed that they had all been setup incorrectly, and had to be removed and re-added. I am quite confused as I have been setting up IP's on machines for a long time and I am curious as to what the issue is. Just taking into account this example... 72.26.196.160/29 255.255.255.248 A /29 block is 5 usable IP's. With the script I wrote and used, the IP Addresses .162 - .166 were added to the NIC. I can't remember now what the name for .161 was, but isn't it the broadcast address or something which isn't assigned to the NIC when adding additional IP Blocks? I am curious as to where my logic is failing me. Not to mention even if .161 was to be added, there is no reason why all of the IPs would have to be removed, as .161 could just be added in addition to these.

  Read the article

• Convert HTACCESS mod_rewrite directives to nginx format?

  - by Chris

  I'm brand new to nginx and I am trying to convert the app I wrote over from Apache as I need the ability to serve a lot of clients at once without a lot of overhead! I'm getting the hang of setting up nginx and FastCGI PHP but I can't wrap my head around nginx's rewrite format just yet. I know you have to write some simple script that goes in the server {} block in the nginx config but I'm not yet familiar with the syntax. Could anyone with experience with both Apache and nginx help me convert this to nginx format? Thanks! # ------------------------------------------------------ # # Rewrite from canonical domain (remove www.) # # ------------------------------------------------------ # RewriteCond %{HTTP_HOST} ^www.domain.com RewriteRule (.*) http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # This redirects index.php to / # # ------------------------------------------------------ # RewriteCond %{THE_REQUEST} ^[A-Z]+\ /(index|index\.php)\ HTTP/ RewriteRule ^(index|index\.php)$ http://domain.com/ [R=301,L] # ------------------------------------------------------ # # This rewrites 'directories' to their PHP files, # # fixes trailing-slash issues, and redirects .php # # to 'directory' to avoid duplicate content. # # ------------------------------------------------------ # RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)$ $1.php [L] RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)/$ http://domain.com/$1 [R=301,L] RewriteCond %{THE_REQUEST} ^[A-Z]+\ /[^.]+\.php\ HTTP/ RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^([^.]+)\.php$ http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # If it wasn't redirected previously and is not # # a file on the server, rewrite to image generation # # ------------------------------------------------------ # RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule ^([a-z0-9_\-@#\ "'\+]+)/?([a-z0-9_\-]+)?(\.png|/)?$ generation/image.php?user=${escapemap:$1}&template=${escapemap:$2} [NC,L]

  Read the article

• client flips between internal and external IP addresses??

  - by jmiller-miramontes

  I have what seems like a not-particularly-complicated home network, all things considered: a DSL line comes in to a modem/router, which goes off to a switch, which supports a bunch of machines. My machines live in a 192.168.0.x address space; however, I'm running some public servers on the network, so I have a block of 8 (5, really) static IP addresses that are mapped to the servers by the router. The non-servers get 192.168.0.x addresses via NAT; some machines have static addresses and some get addresses from DHCP. Locally, I'm running a DNS server (named) to map between the domain names and the 192.168 address space. Somewhat messy, but everything basically works. Except: One of my local non-server clients occasionally switches from its internal address to its external address. That is, if I check the logs of a website I'm running internally, the hits coming from this client sometimes show up with the internal 192.168 address, and sometimes with the external (216.103...) address. It will flip back and forth for no apparent reason, without my doing anything. This can be a problem in terms of how the clients interact with the way I have some of the clients' SSH systems configured (e.g., allowing access from the internal network but not the external network), but it also Just Seems Wrong. I will confess that I'm kinda skating on the very edge of my networking competence here, but I can't for the life of me figure out what's going on. If it helps, the client in question is running Mac OS X / 10.6; its address is statically assigned, is not one of the five externally-accessible addresses, and gets its DNS from (first) the internal DNS server and (second) my ISP's DNS servers. I can't swear that none of the other NAT clients are also showing this problem; the one I'm dealing with is my everyday machine, so this is where I run into it. Does anybody out there have any advice? This is driving me crazy...

  Read the article

• Is On-The-Fly string replacement possible using GreaseMonkey and Firefox

  - by Gary M. Mugford

  I have looked for means to stop Brightcove videos from autostarting in Firefox and have come to the conclusion it isn't possible without external programming via something like Grease Monkey. However, I'm not proficient in javascript let alone GM. So I thought I'd ask here first whether what I want to do is feasible, or whether it's a fool's errand. What I want to accomplish is have a site specific script executed to replace a string value on the run in that site's code. Specifically, what I am looking for is something GM-style that would do this: if site_domain = 'www.SiteWithAutoPlayVideos.com' then replace_all('<param name="autoStart" value="true" />', '<param name="autoStart" value="false" />'); Having looked through Super User for anything GreaseMonkey that might relate, I see notices that the sandbox GM executes scripts in has to remain separate for security reasons. So, I suspect I might be in for disappointment. BUT if it is accomplishable and somebody here can confirm it, then I will do my best to struggle through the learning curve and get this noisome little problem put to rest. Yes, I have tried Flash Block and FlashDisable in order to attack this issue with no avail. Thanks in advance for your time.

  Read the article

• remote telnet and email

  - by Mustafa Ismail Mustafa

  This issue has been occupying my work for the last few days and I will be understating when I say its driven me up the blasted walls. Essentially, I can ping and tracert the domain jnrcs.org and the subdomains mail.jnrcs.org and mail.jordanredcrescent.org. All three mentioned point to ip address 212.38.147.97. About 4 days ago, when we registered the domain "jnrcs.org" suddenly all external connection to the mail server from outside was lost. Not just mail, but other http based port-forwarded or natted services (such as camera surveillance and pbx services). I tried good old telnet (I'm a linux user) and I get the following output: telnet> o mail.jnrcs.org 25 Trying 212.38.147.97... telnet: Unable to connect to remote host: No route to host telnet> Tracert gives me: traceroute to mail.jnrcs.org (212.38.147.97), 30 hops max, 60 byte packets 1 192.168.1.2 (192.168.1.2) 0.869 ms 0.944 ms * 2 * * * 3 * * * 4 * * * 5 * * * 6 * 212.38.128.118 (212.38.128.118) 33.875 ms 39.187 ms 7 * * * 8 * * * 9 * * * 10 * * * 11 * * 212.38.147.97 (212.38.147.97) 67.621 ms I am stumped. Other friends from all around the world can telnet no problem. What could have possibly happened to make telnet/smtp/pop/imap/http access stop? Please bear in mind I'm primarily a developer but I [am under the delusion] that I can carry my weight in IT administration :) TIA

  Read the article

• Backing up VMs to a tape drive

  - by Aljoscha Vollmerhaus

  I've got myself one of these fancy tape drives, HP LTO2 with 200/400 GB cartridges. The st driver reports it like this: scsi 1:0:0:0: Sequential-Access HP Ultrium 2-SCSI T65D I can store and retrieve files like a charm using tar, both tar cf /dev/st0 somedirectory and tar xf /dev/st0 work flawless. However, what I really would like to backup are LVM LVs. They contain entire virtual machines with varying partition layouts, so using mount and tar is not an option. I've tried using something like dd if=/dev/VG/LV bs=64k of=/dev/st0 to achieve this, but there seem to be various problems associated with this approach. Firstly, I would like to be able to store more than 1 LV on a single tape. Now I guess I could seek to concatenate the data on the tape, but I think this would not work very well in an automated scenario with many different LVs of various sizes. Secondly, I would like to store a small XML file along with the raw data that contains some information about the VM contained in the LV. I could dump everything to a directory and tar it up - not very desirable, I would have to set aside huge amounts of scratch space. Is there an easier way to achieve this? Thirdly, from googling around it seems like it would be wise to use something like mbuffer when writing to the tape, to prevent what wikipedia calls "shoe-shining" the tape. However, I can't get anything useful done with mbuffer. The mbuffer man page suggests this for writing to a tape device: mbuffer -t -m 10M -p 80 -f -o $TAPE So I've tried this: dd if=/dev/VG/LV | mbuffer -t -m 10M -p 80 -f -d 64k -o /dev/st0 Note the added "-d 64k" to account for the 64k block size of the tape. However, reading data back from a tape written in this way never seems to yield any useful results - dd has been running for ages now, and managed to transfer only 361M of data from the tape. What's wrong here?

  Read the article

• MS SQL Server slows down over time?

  - by Dave Holland

  Have any of you experienced the following, and have you found a solution: A large part of our website's back-end is MS SQL Server 2005. Every week or two weeks the site begins running slower - and I see queries taking longer and longer to complete in SQL. I have a query that I like to use: USE master select text,wait_time,blocking_session_id AS "Block", percent_complete, * from sys.dm_exec_requests CROSS APPLY sys.dm_exec_sql_text(sql_handle) AS s2 order by start_time asc Which is fairly useful... it gives a snapshot of everything that's running right at that moment against your SQL server. What's nice is that even if your CPU is pegged at 100% for some reason and Activity Monitor is refusing to load (I'm sure some of you have been there) this query still returns and you can see what query is killing your DB. When I run this, or Activity Monitor during the times that SQL has begun to slow down I don't see any specific queries causing the issue - they are ALL running slower across the board. If I restart the MS SQL Service then everything is fine, it speeds right up - for a week or two until it happens again. Nothing that I can think of has changed, but this just started a few months ago... Ideas? --Added Please note that when this database slowdown happens it doesn't matter if we are getting 100K page views an hour (busier time of day) or 10K page views an hour (slow time) the queries all take a longer time to complete than normal. The server isn't really under stress - the CPU isn't high, the disk usage doesn't seem to be out of control... it feels like index fragmentation or something of the sort but that doesn't seem to be the case. As far as pasting results of the query I pasted above I really can't do that. The Query above lists the login of the user performing the task, the entire query, etc etc.. and I'd really not like to hand out the names of my databases, tables, columns and the logins online :)... I can tell you that the queries running at that time are normal, standard queries for our site that run all the time, nothing out of the norm.

  Read the article

• Setup site folders on Apache and PHP

  - by Cobus Kruger

  I'm trying to set up my first Apache server on my Windows PC at home and I have real trouble finding out which configuration settings go where. I downloaded and installed XAMPP which seemed to get everything nicely set up and can see a working website on http://localhost. So far so good. The point of this is to develop a website of course, and to make my life easier (irony?), I wanted to let the web site root point to my Eclipse project folder. So I opened httpd-vhosts.conf, uncommented a VirtualHost block and changed its DocumentRoot to my local path. Now when I try to load http://localhost I get a 403 (Access denied) error. So where do I configure permissions for my folder? And is that all I need to let my site run from the folder specified or am I going to have to clear another hurdle? Update: I tried to simplify things a little, so I reinstalled XAMPP and got back to a working http://localhost. Then I confirmed that httpd-vhosts.conf is included in httpd.conf and made the following changes to httpd-vhosts.conf: Uncommented the line NameVirtualHost *:80 Added a virtual host shown below. Restarted Apache and saw the expected page on http://localhost <VirtualHost *:80> DocumentRoot "C:/xampp/htdocs/" ServerName localhost ErrorLog "logs/dummy-host2.localhost-error.log" CustomLog "logs/dummy-host2.localhost-access.log" combined </VirtualHost> I then created a new folder named C:\testweb, added an index.html file and changed the DocumentRoot line shown above. For all intents and purposes I would then expect the two configurations to be equivalent. But this setup gives me an error 403. Even though the C:\testweb folder already had the same permissions as the C:\xampp\htdocs folder, I then went further and gave the Everyone group full control of C:\testweb and got exactly the same problem. So what did I miss?

  Read the article

• Juniper router dropping pings to external interface

  - by Alexander Garden

  My organization has a Juniper SSG20-WLAN that routes our traffic to the outside world. We've been having intermittent problems with our internet connection so I wrote up a Python script to ping the internal interface of the router, the external interface, a couple of our internal servers, the ISP router our router talks to, their upstream provider, and Google and Yahoo for good measure. It does that about every minute. What I have found is that when our internet goes out, our Juniper router ceases responding to pings on the external interface. Everything past that is, of course, unreachable. The internal interface and our internal servers continue to echo back without interruption. None of the counters indicate dropped packets of any type. They all look normal. The logs complain about VIP servers being unavailable but otherwise nothing indicative of network issues. My questions are these: Does this exonerate our ISP? Or, contrawise, might a problem with the connection be causing the external interface to go down? Is there somewhere else in the SSG20, beside the system log and counters, that might help me track down info on the problem? UPDATE: Turned out that one of the switches between my monitoring box and the router was a router itself, and occasionally diverting from the gateway to itself. Kudos to those who made suggestions along those lines. Not really sure which answer to mark as accepted, as it was really stuff in the comments that turned out to be right. Thanks for the suggestions.

  Read the article

• "Options ExecCGI is off in this directory" When try to run Ruby code using mod_ruby

  - by Itay Moav

  I am on Ubuntu, Apache 2.2 Installed the fcgi via apt-get then removed it via apt-get remove. Installed mod-ruby configuration I added to Apache: LoadModule ruby_module /usr/lib/apache2/modules/mod_ruby.so RubyRequire apache/ruby-run <Directory /var/www> Options +ExecCGI </Directory> <Files *.rb> SetHandler ruby-object RubyHandler Apache::RubyRun.instance </Files> <Files *.rbx> SetHandler ruby-object RubyHandler Apache::RubyRun.instance </Files> I have a file in the www direcoty with puts 'baba' I have other files in that directory, all accessible via Apache. Test file has been chmod 777 In the browser I get 403. In Apache error log I get: [error] access to /var/www/t.rb failed for (null), reason: Options ExecCGI is off in this directory If I move this to a sub folder rubytest and modify the relevant config to be: <Directory /var/www/rubytest> Options +ExecCGI </Directory> and making sure the directory has 755 permissions on it, it just try to download the file, as if it does not recognize the postfix *.rb any more If I give directory and files 777 it fails: usr/lib/ruby/1.8/apache/ruby-run.rb:53: warning: Insecure world writable dir /var/www/rubytest in LOAD_PATH, mode 040777 [Tue May 24 19:39:58 2011] [error] mod_ruby: error in ruby [Tue May 24 19:39:58 2011] [error] mod_ruby: /usr/lib/ruby/1.8/apache/ruby-run.rb:53:in load': loading from unsafe file /var/www/rubytest/t.rb (SecurityError) [Tue May 24 19:39:58 2011] [error] mod_ruby: from /usr/lib/ruby/1.8/apache/ruby-run.rb:53:in handler' BUT, IF I USE *.rbx it works like a charm...go figure.

  Read the article

• Display stretches 4:3 ratios; Adds scrolling to other ratios

  - by Matt

  I have a dual monitor setup. Normally, they both display at 1680x1050. They have been setup this way for about a year. I'm using Windows XP Professional 2003 x64 SP2. Today, out of nowhere, one of the monitors kicked back to a lower resolution. I was not playing with any configuration at the time.. in fact all I had done was close a window (maybe a browser). But the thing is that the resolution is still preserved partially by the fact that the screen will scroll when you move the mouse. So it's like looking through a 1024x768 window into a 1680x1050 world. The monitor itself does not appear to be damaged, because I also have it connected to my netbook (via KVM) and higher resolutions work fine. I tried uninstalling/reinstalling the drivers to no avail. System restore doesn't help either. I'm unsure of the exact ATI card I'm using.. Device Manager lists it as "Radeon X300/X550/X1050". There is no Catalyst Control Center software installed. I tried to install it, but there doesn't seem to be a way to install it by itself ... it forces you to install another driver, which breaks both of my displays, forcing me to go into safe mode and run system restore again. Any ideas? Thanks EDIT: After playing around more, I discovered that the "scrolling" behavior is only present for aspect ratios that are not 4:3. For 4:3 ratios, it just stretches out to fit the wide screen. My monitor's native ratio is 16:9 .. what could be causing it to think it needs to scroll?

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Routing WIFI and LAN for specific traffic

  - by jakebird451

  I have two network devices aboard my macbook pro: WIFI (en1): Used for general traffic. Connects to an ip of 192.168.19.* via DHCP LAN (en0): Used for specific traffic. Connects to an ip of 192.168.2.10 as a static IP. Does not connect to a router, only a switch for direct routing connection. I have 4 IP addresses I need to access on the LAN: 192.168.2.1 192.168.2.21 192.168.2.20 192.168.2.30 The rest of the traffic needs to go to WIFI. I have tried setting up a routing table for the specific ip addresses, but I only managed to mess up my network. I do not venture out into the world of networking too often, but this was the latest command I have been trying: sudo route add -host 192.168.2.30 -interface en0 This command killed my ability to use ping. It told me that ping could not allocate memory (is that even possible)? It also killed my wifi access. Logging out and back in fixed the issue. I really do not mind to make this solution permanent, so I am fine with a temporary routing. EDIT: If I currently have been trying: sudo route flush sudo route add default 192.168.19.1 This gets everything to work for about a minute. But after such minute it "forgets" the routing to WiFi while retaining LAN's (en0) routing. If I unplug and replug my LAN (en0) cable, the process works for another minute.

  Read the article

• How do I use a self encrypting drive?

  - by Unique_Key

  I recently purchased a Micron RealSSD c400 self encrypting drive, and I am having a few issues when trying to get it recognized by my laptop (HP Elitebook 8440p running Windows 7 x64; also tried on a custom-built desktop). When I try to initialize the drive from disk management, I get a CRC error; also, when attempting to partition it from Windows setup, the program can't create the partitions. I also tried with UBCD, nothing. I assume this is due to drive security, but I haven't been able to find much information about this online; do I need a management software or something? I'm completely stumped here. EDIT As requested, when I try partitioning the device from Windows setup I get a 0x80300024 error; when I try initializing it from disk management, I get a "Data error (cyclic redundancy check)" message, and the event log shows the following under System: Source: VDS Basic Provider, message: unexpected failure. error code 490@01010004 (2x) Source: Virtual Disk Service, message: VDS fails to write boot code on a disk during clean operation. Error code: 80070001@02070008 (1x) Source: Disk, message: The device \Device\Harddisk2\DR2 has a bad block (2x) The security logs show nothing related. Also, when attempting to configure it from UBCD (utility: HDAT2), I get an error along the lines of "can't edit partition information" or something to that tune.

  Read the article

• Mod_Perl configuration for multiple domains

  - by daliaessam

  Reading the Mod_Perl module documentation, can we configure it on per domain basis, what I mean can we configure it to run on every domain or specific domain only. What I see in the docs is: Registry Scripts To enable registry scripts add to httpd.conf: Alias /perl/ /home/httpd/2.0/perl/ <Location /perl/> SetHandler perl-script PerlResponseHandler ModPerl::Registry PerlOptions +ParseHeaders Options +ExecCGI </Location> and now assuming that we have the following script: #!/usr/bin/perl print "Content-type: text/plain\n\n"; print "mod_perl 2.0 rocks!\n"; saved in /home/httpd/httpd-2.0/perl/rock.pl. Make the script executable and readable by everybody: % chmod a+rx /home/httpd/httpd-2.0/perl/rock.pl Of course the path to the script should be readable by the server too. In the real world you probably want to have a tighter permissions, but for the purpose of testing, that things are working, this is just fine. From what I understand above, we can run Perl scripts only from one specific folder that we put the directive above. So the question again, can we make this directive per domain for all domains or for specific number of domains?

  Read the article

• Logitech webcam device only recognised by one software, without drivers

  - by Ben Franchuk

  A couple weeks ago I purchased a Logitech webcam at a garage sale; It did not come with any driver DVDs or anything like that. I plugged it in, turned on my computer, and continued work as usual. I did not at the time (and still have not) gotten any drivers for the device. Recently, though, I started up an audio software named as Cubase, only to find that it was picking up audio reads off of... something. I checked my sound card, and everything else plugged into my computer, but couldn't find where in the world this audio was being picked up from. There were no microphones listed in the device managers, and no "unknown devices" or whatever. Everything seemed as it always was. Running out of ideas, i blew an air-horn directly into the general area of the webcam, located directly in front of me. Sure enough, the audio peaked, indicating that the microphone was definitely in the webcam and that Cubase was somehow picking up this audio, even without drivers. The software lists the device as a "Universal USB Microphone". Adobe Audition, Soundbooth, and other audio applications cannot find the device either. Why is it that this one software (Cubase) can use this device without a driver, while every other piece of software on the computer can't? Not even the operating system can recognize it. Windows 7 Professional x64 bit

  Read the article

• How can I erase the traces of Folder Redirection from the Default Domain Policy

  - by bruor

  I've taken over from an IT outsourcer and have found a struggle now that we're starting a migration to windows 7. Someone decided that they would setup Folder redirection in the Default Domain Policy. I've since configured redirection in another policy at an OU level. No matter what I do, the windows 7 systems pick up the Default Domain Policy folder redirection settings only. I keep getting entries in the event log showing that the previously redirected folders "need to be redirected" with a status of 0x80000004. From what I can tell this just means that it's redirecting them locally. Is there a way I can wipe that section of the GPO clean so it's no longer there? I'm hesitant to try to reset the default domain policy to complete defaults. ***UPDATE 6-26 I found that the following condition occurred and was causing the grief here. I've already implemented the new policies for clients, and for some reason, XP was working great, 7 was refusing to process. The DDP was enforced. Because of this, and the fact that the folder redirection policies were set to redirect back to the local profile upon removal, it was forcing clients to pick up it's "redirect to local" settings. Requirements for to recreate the issue. -Create a new test OU and policy. -Create some folder redirection settings, set them to redirect to local upon removal -Remove settings on that GPO -Refresh your view of the GPO and check the settings. -You'll notice that the settings show "not configured" entries for folder redirection. -Enforce this GPO -Create another sub-OU -Create a GPO linked to this sub-ou and configure some folder redirection settings. -Watch as the enforced GPOs "not configured" setting overrides the policy you just defined. I've had to relink the DDP to all OU's that have "block inheritance" enabled, and disable the "enforced" option on the DDP as a workaround. I'd love to re-enable enforcement of the DDP, but until I can erase the traces of folder redirection settings from the DDP, I think I'm stuck.

  Read the article

< Previous Page | 464 465 466 467 468 469 470 471 472 473 474 475  | Next Page >