Search Results

Search found 36131 results on 1446 pages for 'text manipulation'.

Page 606/1446 | < Previous Page | 602 603 604 605 606 607 608 609 610 611 612 613  | Next Page >

  • clicking a button via javascript does not cause a post

    - by Andreas Niedermair
    hi there! <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.1//EN" "http://www.w3.org/TR/xhtml11/DTD/xhtml11.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <head> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.js"></script> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8.2/jquery-ui.js"></script> </head> <body> <form id="fooForm"> <script type="text/javascript"> function FooMethod() { alert('hello'); } var fooButton; var fooForm; $(document).ready(function() { InitializeVariables(); InitiliazeDialog(); InitiliazeForm(); }); function InitializeVariables() { fooButton = $('#fooButton'); fooForm = $('#fooForm'); } function InitiliazeDialog() { var dialog = $('<div/>'); dialog.css('display', 'none'); var content = $('<p/>'); var icon = $('<span/>'); icon.addClass('ui-icon ui-icon-alert'); icon.css('float', 'left'); icon.css('margin', '0px 7px 20px 0px'); content.text('do you really want to hurt me?'); icon.prependTo(content); content.appendTo(dialog); var dialogOpenMethod = function () { dialog.dialog('open'); return false; }; var dialogOpenHandlerMethod = function (event, ui) { var widget = dialog.dialog('widget'); widget.appendTo(fooForm); var overlay = widget.prev(); overlay.css('z-index', 999); overlay.appendTo(fooForm); widget.css('position', 'fixed'); widget.css('top', '50%'); widget.css('margin-top', widget.height() / 2 * -1); widget.css('left', '50%'); widget.css('margin-left', widget.width() / 2 * -1); }; var submitMethod = function () { dialog.dialog('option', 'closeOnEscape', false); var widget = dialog.dialog('widget'); var yesButton = $(':button:eq(0)', widget); var noButton = $(':button:eq(1)', widget); var closeButton = $('a.ui-dialog-titlebar-close', widget); noButton.remove(); closeButton.remove(); fooButton.unbind('click', dialogOpenMethod); fooButton.click(); }; dialog.dialog({ autoOpen: false, modal: true, buttons: { 'Ja': submitMethod, 'Nein': function () { dialog.dialog('close'); } }, open: dialogOpenHandlerMethod }); fooButton.bind('click', dialogOpenMethod); } function InitiliazeForm() { fooButton.button(); fooForm.submit(function () { alert('doing a submit'); }); } </script> <input type="submit" id="fooButton" value="submit it!" onclick="FooMethod();"></input> </form> </body> </html> what am i doing? i want a modal-confirmation: user clicks on button, confirmation "do you really want to...?", user clicks "yes", this click unbinds the original click-handler and clicks the button again (which should cause a submit). what/why is not working? indeed you need a special case. this demo won't work, unless you set modal: false. interesting to mention: the original handler (onclick="FooMethod();") is called in modal and non-modal dialog. can anybody help me out? thanks in advance! i also opened a ticket on jqueryUI for this

    Read the article

  • How can I change Twitter's Share button height?

    - by user1035890
    How can I change Twitter's icon height? I have another custom image, but the height stays the same. How do I fix this? https://dev.twitter.com/docs/tweet-button and I used the div method and not the iframe because I wanted to add the data-title I used this code: <script src="//platform.twitter.com/widgets.js" type="text/javascript"></script> <div> <a href="https://twitter.com/share" class="twitter-share-button" data-url="https://dev.twitter.com/pages/tweet_button" data-via="your_screen_name" data-text="Checking out this page about Tweet Buttons" data-related="anywhere:The Javascript API" data-count="vertical">Tweet</a> </div>

    Read the article

  • Prolog - Finding the current directory, relative directory for 'tell' predicate

    - by Bharat
    I'm having trouble trying to figure out how to get prolog to spit out a text file where I want it to. I'm currently doing a bunch of operations and then using tell('output.txt') to record the output. Now the problem is that when I do this, it creates this file in the SWI \bin\ folder. I was wondering if there's a way to make it create this file in the directory containing the actual .pl file. So even if the file was moved (and it will be), the text file gets created right where the source file is. Long story short, is there a way to get the location of the source file once the source file has been consulted? Many Thanks!

    Read the article

  • Doing some stuff right before the user exits the page

    - by Mike
    I have seen some questions here regarding what I want to achieve and have based what I have so far on those answer. But there is a slight misbehavior that is still irritating me. What I have is sort of a recovery feature. Whenever you are typing text, the client sends a sync request to the server every 45 seconds. It does 2 things. First, it extends the lease the client has on the record (only one person may edit at one time) for another 60 seconds. Second, it sends the text typed so far to the server in case the server crashes, internet connection fails, etc. In that case, the next time the user enters our application, the user is notified that something has gone wrong and that some text was recovered. Think of Microsoft or OpenOffice recovery whenever they crash! Of course, if the user leaves the page willingly, the user does not need to be notified and as a result, the recovery is deleted. I do that final request via a beforeunload event. Everything went fine until I was asked to make a final adjustment... The same behavior you have here at stack overflow when you exit the editor... a confirm dialogue. This works so far, BUT, the confirm dialogue is shown twice. Here is the code. The event if (local.sync.autosave_textelement) { window.onbeforeunload = exitConfirm; } The function function exitConfirm() { var local = Core; if (confirm('blub?')) { local.sync.autosave_destroy = true; sync(false); return true; } else { return false; } }; Some problem irrelevant clarifications: Core is a global Object that contains a lot of variables that are used everywhere. sync makes an ajax request. The values are based on the values that the Core.sync object contains. The parameter determines if the call should be async (default) or sync. Edit 1 I did try to separate both things (recovery deletion and user confirmation that is) into beforeunload and unload. The problem there was that unload is a bit too late. The user gets informed that there is a recovery even though it is scheduled to be deleted. If you refresh the page 1 second later, the dialogue disappears as the file was deleted by then.

    Read the article

  • Proper Regex to find and replace escaped UTF-8 strings

    - by Piet Binnenbocht
    (edited) I am reading a JSON file that includes some UTF-8 characters that are encoded like this: "\uf36b". I am trying to write a RegExp to convert this to an HTML entity that looks like "&#x1F36B;". This displays the character correctly in my html page. I haven't been able to correctly display the character that should be associated with "\uf36b", especially when in a longer sentence that also includes other text. How can I write a regexp that replaces strings like "\uf4d6" and "\uf36b" but leaves other text alone? Example: var str = "I need \uf36b #chocolate"; This should be converted to: I need &#x1F36B; #chocolate;

    Read the article

  • Can't retrieve more than 2 gmail messages using Zend framework imap access - server dies - doens't r

    - by Ali
    Hi guys I'm working on a google apps application. Basically I've set it up so users can add multiple gmail addresses and check on their inboxes in the application. It works fine with a google apps email address however when I add a gmail address it just dies out. I'm using this code here: $mail = new Zend_Mail_Storage_Imap($mail_options); $all_messages = array(); $page = isset($_GET['page'])?$_GET['page']:1; $limit = isset($_GET['limit'])?$_GET['limit']:20; $offset = (($page-1)*$limit)+1; $end = ($page*$limit)>$c?$c:($page*$limit); for ($i=$offset;$i<=$end;$i++){ $h2t = new html2text(); $h2t->set_allowed_tags('<a>'); if(!$mail[$i]) break; else{ $one_message = $mail->getMessage($i); $one_message->id = $i; $one_message->UID = $mail->getUniqueId($i); $one_message->parts = array(); $one_message->body = ''; $count = 1; foreach (new RecursiveIteratorIterator($mail->getMessage($i)) as $ii=>$part) { try { $tpart = $part; //$tpart->_content = ''; $one_message->parts[$count] = $tpart; $count++; // check for html body if (strtok($part->contentType, ';') == 'text/html') { $b = $part->getContent(); if($part->contentTransferEncoding == 'quoted-printable') $b = quoted_printable_decode($b); $one_message->html_body = $b; $h2t->set_html($b); $one_message->body = $h2t->get_text(); } //check for text body if (strtok($part->contentType, ';') == 'text/plain') { $b = $part->getContent(); if($part->contentTransferEncoding == 'quoted-printable') $b = quoted_printable_decode($b); $one_message->text_body = $b; $one_message->body = $b;//$part->getContent(); } } catch (Zend_Mail_Exception $e) { // ignore } } $all_messages[] = $one_message; } } No matter what the emails it dies out on retrieving just 2 emails... whats going on here?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Turning PHP page calling Zend functions procedurally into Zend Framework MVC-help!

    - by Joel
    Hi guys, I posted much of this question, but if didn't include all the Zend stuff because I thought it'd be overkill, but now I'm thinking it's not easy to figure out an OO way of doing this without that code... So with that said, please forgive the verbose code. I'm learning how to use MVC and OO in general, and I have a website that is all in PHP but most of the pages are basic static pages. I have already converted them all to views in Zend Framework, and have the Controller and layout set. All is good there. The one remaining page I have is the main reason I did this...it in fact uses Zend library (for gData connection and pulling info from a Google Calendar and displaying it on the page. I don't know enough about this to know where to begin to refactor the code to fit in the Zend Framework MVC model. Any help would be greatly appreciated!! .phtml view page: <div id="dhtmltooltip" align="left"></div> <script src="../js/tooltip.js" type="text/javascript"> </script> <div id="container"> <div id="conten"> <a name="C4"></a> <?php function get_desc_second_part(&$value) { list(,$val_b) = explode('==',$value); $value = trim($val_b); } function filterEventDetails($contentText) { $data = array(); foreach($contentText as $row) { if(strstr($row, 'When: ')) { ##cleaning "when" string to get date in the format "May 28, 2009"## $data['duration'] = str_replace('When: ','',$row); list($when, ) = explode(' to ',$data['duration']); $data['when'] = substr($when,4); if(strlen($data['when'])>13) $data['when'] = trim(str_replace(strrchr($data['when'], ' '),'',$data['when'])); $data['duration'] = substr($data['duration'], 0, strlen($data['duration'])-4); //trimming time zone identifier (UTC etc.) } if(strstr($row, 'Where: ')) { $data['where'] = str_replace('Where: ','',$row); //pr($row); //$where = strstr($row, 'Where: '); //pr($where); } if(strstr($row, 'Event Description: ')) { $event_desc = str_replace('Event Description: ','',$row); //$event_desc = strstr($row, 'Event Description: '); ## Filtering event description and extracting venue, ticket urls etc from it. //$event_desc = str_replace('Event Description: ','',$contentText[3]); $event_desc_array = explode('|',$event_desc); array_walk($event_desc_array,'get_desc_second_part'); //pr($event_desc_array); $data['venue_url'] = $event_desc_array[0]; $data['details'] = $event_desc_array[1]; $data['tickets_url'] = $event_desc_array[2]; $data['tickets_button'] = $event_desc_array[3]; $data['facebook_url'] = $event_desc_array[4]; $data['facebook_icon'] = $event_desc_array[5]; } } return $data; } // load library require_once 'Zend/Loader.php'; Zend_Loader::loadClass('Zend_Gdata'); Zend_Loader::loadClass('Zend_Gdata_ClientLogin'); Zend_Loader::loadClass('Zend_Gdata_Calendar'); Zend_Loader::loadClass('Zend_Http_Client'); // create authenticated HTTP client for Calendar service $gcal = Zend_Gdata_Calendar::AUTH_SERVICE_NAME; $user = "[email protected]"; $pass = "xxxxxxxx"; $client = Zend_Gdata_ClientLogin::getHttpClient($user, $pass, $gcal); $gcal = new Zend_Gdata_Calendar($client); $query = $gcal->newEventQuery(); $query->setUser('[email protected]'); $secondary=true; $query->setVisibility('private'); $query->setProjection('basic'); $query->setOrderby('starttime'); $query->setSortOrder('ascending'); //$query->setFutureevents('true'); $startDate=date('Y-m-d h:i:s'); $endDate="2015-12-31"; $query->setStartMin($startDate); $query->setStartMax($endDate); $query->setMaxResults(30); try { $feed = $gcal->getCalendarEventFeed($query); } catch (Zend_Gdata_App_Exception $e) { echo "Error: " . $e->getResponse(); } ?> <h1><?php echo $feed->title; ?></h1> <?php echo $feed->totalResults; ?> event(s) found. <table width="90%" border="3" align="center"> <tr> <td width="20%" align="center" valign="middle"><b>;DATE</b></td> <td width="25%" align="center" valign="middle"><b>VENUE</b></td> <td width="20%" align="center" valign="middle"><b>CITY</b></td> <td width="20%" align="center" valign="middle"><b>DETAILS</b></td> <td width="15%" align="center" valign="middle"><b>LINKS</b></td> </tr> <?php if((int)$feed->totalResults>0) { //checking if at least one event is there in this date range foreach ($feed as $event) { //iterating through all events //pr($event);die; $contentText = stripslashes($event->content->text); //striping any escape character $contentText = preg_replace('/\<br \/\>[\n\t\s]{1,}\<br \/\>/','<br />',stripslashes($event->content->text)); //replacing multiple breaks with a single break //die(); $contentText = explode('<br />',$contentText); //splitting data by break tag $eventData = filterEventDetails($contentText); $when = $eventData['when']; $where = $eventData['where']; $duration = $eventData['duration']; $venue_url = $eventData['venue_url']; $details = $eventData['details']; $tickets_url = $eventData['tickets_url']; $tickets_button = $eventData['tickets_button']; $facebook_url = $eventData['facebook_url']; $facebook_icon = $eventData['facebook_icon']; $title = stripslashes($event->title); echo '<tr>'; echo '<td width="20%" align="center" valign="middle" nowrap="nowrap">'; echo $when; echo '</td>'; echo '<td width="20%" align="center" valign="middle">'; if($venue_url!='') { echo '<a href="'.$venue_url.'" target="_blank">'.$title.'</a>'; } else { echo $title; } echo '</td>'; echo '<td width="20%" align="center" valign="middle">'; echo $where; echo '</td>'; echo '<td width="20%" align="center" valign="middle">'; $details = str_replace("\n","<br>",htmlentities($details)); $duration = str_replace("\n","<br>",$duration); $detailed_description = "<b>When</b>: <br>".$duration."<br><br>"; $detailed_description .= "<b>Description</b>: <br>".$details; echo '<a href="javascript:void(0);" onmouseover="ddrivetip(\''.$detailed_description.'\')" onmouseout="hideddrivetip()" onclick="return false">View Details</a>'; echo '</td>'; echo '<td width="20%" valign="middle">'; if(trim($tickets_url) !='' && trim($tickets_button)!='') { echo '<a href="'.$tickets_url.'" target="_blank"><img src="'.$tickets_button.'" border="0" ></a>'; } if(trim($facebook_url) !='' && trim($facebook_icon)!='') { echo '<a href="'.$facebook_url.'" target="_blank"><img src="'.$facebook_icon.'" border="0" ></a>'; } else { echo '......'; } echo '</td>'; echo '</tr>'; } } else { //else show 'no event found' message echo '<tr>'; echo '<td width="100%" align="center" valign="middle" colspan="5">'; echo "No event found"; echo '</td>'; } ?> </table> <h3><a href="#pastevents">Scroll down for a list of past shows.</a></h3> <br /> <a name="pastevents"></a> <ul class="pastShows"> <?php $startDate='2005-01-01'; $endDate=date('Y-m-d'); /*$gcal = Zend_Gdata_Calendar::AUTH_SERVICE_NAME; $user = "[email protected]"; $pass = "silverroof10"; $client = Zend_Gdata_ClientLogin::getHttpClient($user, $pass, $gcal); $gcal = new Zend_Gdata_Calendar($client); $query = $gcal->newEventQuery(); $query->setUser('[email protected]'); $query->setVisibility('private'); $query->setProjection('basic');*/ $query->setOrderby('starttime'); $query->setSortOrder('descending'); $query->setFutureevents('false'); $query->setStartMin($startDate); $query->setStartMax($endDate); $query->setMaxResults(1000); try { $feed = $gcal->getCalendarEventFeed($query); } catch (Zend_Gdata_App_Exception $e) { echo "Error: " . $e->getResponse(); } if((int)$feed->totalResults>0) { //checking if at least one event is there in this date range foreach ($feed as $event) { //iterating through all events $contentText = stripslashes($event->content->text); //striping any escape character $contentText = preg_replace('/\<br \/\>[\n\t\s]{1,}\<br \/\>/','<br />',stripslashes($event->content->text)); //replacing multiple breaks with a single break $contentText = explode('<br />',$contentText); //splitting data by break tag $eventData = filterEventDetails($contentText); $when = $eventData['when']; $where = $eventData['where']; $duration = $eventData['duration']; $title = stripslashes($event->title); echo '<li class="pastShows">' . $when . " - " . $title . ", " . $where . '</li>'; } } ?> </div> </div>

    Read the article

  • JQuery selfbuild plugin question - default value is overwritten.

    - by Bruno
    Hi jQuery ninjas. I need your help. I have made a really clean and simple example to illustrate my problem. I have build my own jquery plugin: (function($) { $.fn.setColorTest = function(options) { options = $.extend($.fn.setColorTest.defaults,options); return this.each(function() { $(this).css({ 'color': options.color}); }); } $.fn.setColorTest.defaults = { color: '#000' }; })(jQuery); As you can see I'm setting a default color and making it possible for the user to change it. My problem/question is: I have two paragraphs on the same page where I want to use the default color for the first and a different color for the second paragraph: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"/> <title>Color Test</title> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $('a#click').click(function() { $('#test1').setColorTest(); }); $('a#click2').click(function() { $('#test2').setColorTest({color: '#fff666'}); }); }); </script> </head> <body> <a id="click">click here</a> <a id="click2">click here2</a> <p id="test1">Test 1</p> <p id="test2">Test 2</p> </body> </html> My problem is that if I click on the second paragraph (p) that overrides the default color and afterwards clicks on the first p it will use the overwritten color and not the default color for the first p. How can I ensure that the first p always will use the default color? I know I can just define the color for the first p as well but that is not an option here $('#test1').setColorTest('color': '#000'); So what to do?

    Read the article

  • accessing and modifying tab opened using window.open in google chrome

    - by sonofdelphi
    I used to be able to this to create an exported HTML page containing some data. But the code is not working with the latest version of Google Chrome (It works alright with Chrome 5.0.307.11 beta and all other major browsers). function createExport(text) { var target = window.open(); target.title = 'Memonaut - Exported View'; target.document.open(); target.document.write(text); target.document.close(); } Chrome now complains that the domains don't match and disallows the Javascript calls as unsafe. How can I access and modify the document of a newly opened browser-tab in such a scenario?

    Read the article

  • Convert XML to .plist

    - by Dror Sabbag
    Hey, I have an XML exported from Oracle DB, which will be downloaded into my application main bundle. i would like to convert this XML file into .plist file so i can assign the values into NSDictionary and NSArrays.. Is there a way to get this to work? or is there a better way to work with an external XML file? note that one of the fields in the XML is a full HTML content example: <main> <DATA_RECORD> <ID>ID1</ID> <NO>1234512</NO> <TYPE>NEW</TYPE> <TYPE_NO>0</TYPE_NO> <TEXT_ID>TEXT1</TEXT_ID> <TEXT><HTML>some html goes here</HTML></TEXT> </DATA_RECORD> </main>

    Read the article

  • How do I make OneNote 2007 images searchable when inserted via code?

    - by Scott Bruns
    When I insert an image into OneNote 2007 using C# my images have 'Make Text in Image Searchable' set to Disabled. How do I insert an image with Make Text in Image Searchable enabled, or how do I enable this property after the image is imported. I have already imported a lot of images. How to I make the existing imported images searchable? I already know how to do this manually by right clicking the image and setting the language. The OCR works fine, I just need to do it automatically.

    Read the article

  • Haskell - Parsec Parsing <p> element

    - by Martin
    I'm using Text.ParserCombinators.Parsec and Text.XHtml to parse an input like this: This is the first paragraph example\n with two lines\n \n And this is the second paragraph\n And my output should be: <p>This is the first paragraph example\n with two lines\n</p> <p>And this is the second paragraph\n</p> I defined: line= do{ ;t<-manyTill (anyChar) newline ;return t } paragraph = do{ t<-many1 (line) ;return ( p << t ) } But it returns: <p>This is the first paragraph example\n with two lines\n\n And this is the second paragraph\n</p> What is wrong? Any ideas? Thanks!

    Read the article

  • What's the best way to offer javascript embed that won't slow a page down?

    - by Shpigford
    I have a chunk of javascript that users can copy and paste to put on their sites. I'm currently using the following code (ala WEDJE) that allows the rest of the page to load even if my script is slow or not responding. <script type="text/javascript"> var number = "987654321"; var key = "123abc"; (function(){ document.write('<div id="ttp"></div>'); s=document.createElement('script'); s.type="text/javascript"; s.src="http://example.com/javascripts/embed.js?" + Math.random(); setTimeout("document.getElementById('ttp').appendChild(s);",1); })() </script> But that method is a few years old and so I wasn't sure if there was a more efficient way of doing the same thing that others have come up with.

    Read the article

  • xpath help substring expression

    - by NA
    Hi i have a document from which i am trying to extract a date. But the problem is within the node along with the date their is some text too. Something like <div class="postHeader"> Posted on July 20, 2009 9:22 PM PDT </div> From this tag i just want the date item not the Posted on text. something like ./xhtml:div[@class = 'postHeader'] is getting everything. and to be precise, the document i have is basically a nodelist of this elements for eg i will get 10 nodes of these elements with different date values but to be worse the problem is sometime inside these tags some random other tags also pops us like anchors etc. Can i write a universal expath which will just get the date out of the div tag?

    Read the article

  • PHP: Join two separate mysql queries into the same json data object

    - by Dan
    I'm trying to mesh the below mysql query results into a single json object, but not quite sure how to do it properly. //return data $sql_result = mysql_query($sql,$connection) or die ("Fail."); $arr = array(); while($obj = mysql_fetch_object($sql_result)) { $arr[] = $obj; } echo json_encode($arr); //return json //plus the selected options $sql_result2 = mysql_query($sql2,$connection) or die ("Fail."); $arr2 = array(); while($obj2 = mysql_fetch_object($sql_result2)) { $arr2[] = $obj2; } echo json_encode($arr2); //return json Here's the current result: [{"po_number":"test","start_date":"1261116000","end_date":"1262239200","description":"test","taa_required":"0","account_overdue":"1","jobs_id":null,"job_number":null,"companies_id":"4","companies_name":"Primacore Inc."}][{"types_id":"37"},{"types_id":"4"}] Notice how the last section [{"types_id":"37"},{"types_id":"4"}] is placed into a separate chunk under root. I'm wanting it to be nested inside the first branch under a name like, "types". I think my question has more to do with Php array manipulation, but I'm not the best with that. Thank you for any guidance.

    Read the article

  • string parsing and substring in c

    - by Josh
    I'm trying to parse the string below in a good way so I can get the sub-string stringI-wantToGet: const char *str = "Hello \"FOO stringI-wantToGet BAR some other extra text"; str will vary in length but always same pattern - FOO and BAR What I had in mind was something like: const char *str = "Hello \"FOO stringI-wantToGet BAR some other extra text"; char *probe, *pointer; probe = str; while(probe != '\n'){ if(probe = strstr("\"FOO")!=NULL) probe++ else probe = ""; // Nulterm part if(pointer = strchr(probe, ' ')!=NULL) pointer = '\0'; // not sure here, I was planning to separate it with \0's } Any help will be appreciate it.

    Read the article

  • xml appending issue - in ie, chrome browsers

    - by 3gwebtrain
    Hi, i am using this coding for my xml information to append in to html. As well it works fine. but in the ie7,ie8 as well chrome browser it's not propelry. This code work9ing well with firefox,opera, safari.. i unable to find, what is the mistake i made this.. any one help me please? $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var receivedData = myData; var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) // alert('thisTitle : '+thisTitle+'thisIntro :'+thisIntro); $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); // Append content of 'list' node $('ul.level'+count).append($(this).children()); }); }); }); })

    Read the article

  • Blackberry Development, java.lang.outofmemoryerror

    - by Nikesh Yadav
    Hi Forum, I am new to Blackberry development (I am using Eclipse with Blackberry plug-in), I am trying to read a text file, which I placed in the "src" folder of my Blackberry project and this text file just contain a word "Test". when I run the program, I gets "UncaughtException: java.lang.outofmemoryerror". Here is the code I am using, where "speech.txt" is the file I am trying to read and is placed in the "src" folder - public class SpeechMain extends MainScreen { public SpeechMain() { try { Class myClass = this.getClass(); InputStream is = null; is = myClass.getResourceAsStream("speech.txt"); InputStreamReader isr = new InputStreamReader(is); char c; while ((c = (char)isr.read()) != -1) { add(new LabelField("" + c)); } } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); add(new LabelField(e.getMessage())); } } } Thanks in advance. Thanks, Nikesh

    Read the article

  • Extract multiple values from one column in MySql

    - by Neil
    I've noticed that MySql has an extensive search capacity, allowing both wildcards and regular expressions. However, I'm in somewhat in a bind since I'm trying to extract multiple values from a single string in my select query. For example, if I had the text "<span>Test</span> this <span>query</span>", perhaps using regular expressions I could find and extract values "Test" or "query", but in my case, I have potentially n such strings to extract. And since I can't define n columns in my select statement, that means I'm stuck. Is there anyway I could have a list of values (ideally separated by commas) of any text contained with span tags? In other words, if I ran this query, I would get "Test,query" as the value of spanlist: select <insert logic here> as spanlist from HtmlPages ...

    Read the article

  • How do I get the current time in a Windows 7 gadget?

    - by norlando02
    For my first windows gadget I'm trying to make one that displays the current time and date. The code below is what I have, but I can't figure out why the javascript is not running. Any ideas? <html> <head> http-equiv="Content-Type" content="text/html; charset=Unicode" /> <title>Clock</title> <style type="text/css"> body { width: 130px; height: 60px; margin: 1 1 1 2; } body { font-family: Segoe UI, Arial; font-size: 11px; font-weight: bold; white-space: nowrap; } </style> <script type="text/javascript"> var background; var interval; var connection_id; var timeZone; var now; function load() { try { interval = 1000; connection_id = 0; timeZone = System.Time.currentTimeZone; update(); } catch(e){} } function update() { try { now = new Date(Date.parse(System.Time.getLocalTime(timeZone))); curDate.innerHTML = now.format('M jS, Y'); curTime.innerHTML = now.format('h:i:s A'); clearTimeout(connection_id); connection_id = setTimeout("update()", interval); } catch(e) {} </script> </head> <body onload="load()"> <div id="curDate"> </div> <div id="curTime"> </div> </body> </html>

    Read the article

  • GetDate in a string in c#

    - by Doncho
    Hi, I'm having some trouble using regular expression to get date in a string. Example : string text = "75000+ Sept.-Oct. 2004"; MatchCollection dates = Regex.Matches(text, @"[0-9]{5,}[+][\s](jan|feb|fev|mar|apr|avr|may|mai|jun|jui|jul|jui|aug|aoû|sept|oct|nov|dec)[\.][\-](jan|feb|fev|mar|apr|avr|may|mai|jun|jui|jul|jui|aug|aoû|sept|oct|nov|dec)[\.]\s[0-9]{4}", RegexOptions.IgnoreCase); This code is matching with my current string but i would like to get in my matchcollection, "Sept 2004" and "Oct 2004" in order to parse it in 2 datetime. If anyone have any idea, thanks a lot.

    Read the article

  • Long html table looses its background image

    - by Alegro
    I have about 7500 (short) text lines in a table cell. The table looses its background image on about 1800th line. Is there a limit about the table's length? Text in the cell stays visible till end, but without background. Table is named #story. #story{ margin-top:15px; border:medium ridge #FFF; border-radius:9px; background-image:url(img/back01.jpg); } Also tried: background: url("img/back01.jpg") repeat; // without result background-color:#FFF; // this works along the whole table. }

    Read the article

  • Problem re-factoring multiple timer countdown

    - by Joko Wandiro
    I create my multiple timer countdown from easy or simple script. entire code The problem's happen when i want to add timer countdown again i have to declare variable current_total_second CODE: elapsed_seconds= tampilkan("#time1"); and variable timer who set with setInterval.. timer= setInterval(function() { if (elapsed_seconds != 0){ elapsed_seconds = elapsed_seconds - 1; $('#time1').text(get_elapsed_time_string(elapsed_seconds)) }else{ $('#time1').parent().slideUp('slow', function(){ $(this).find('.post').text("Post has been deleted"); }) $('#time1').parent().slideDown('slow'); clearInterval(timer); } }, 1000); i've already know about re-factoring and try different way but i'm stack to re-factoring this code i want implement flexibelity to it.. when i add more of timer countdown.. script do it automatically or dynamically without i have to add a bunch of code.. and the code become clear and more efficient. Thanks in Advance

    Read the article

  • Date in textboxes changing format

    - by AWinters
    I have an application (asp.net 3.5) that support 4 different languages. Along with other cultural changes, the date formats must match the current culture on out reporting pages. We set the date formats of each of the textboxes like: string date = DateTime.Today.ToString("d"); //returns the date portion only textbox1.Text = date; textbox2.Text = date; etc... When the user selects Spanish or British English the format should be dd/mm/yyyy. However, then I navigate to the page it displays in mm/dd/yyyy. After a postback it then displays dd/mm/yyyy. After another postback it switches to the mm/dd/yyyy format and on and on. I have debugged through this and I see that the culture is correct for the application and the date formats are returned to me correctly, yet when it displays, it displays incorrectly. Has anyone ever seen this or know what is happening?

    Read the article

< Previous Page | 602 603 604 605 606 607 608 609 610 611 612 613  | Next Page >