Search Results

Search found 36131 results on 1446 pages for 'text manipulation'.

Page 608/1446 | < Previous Page | 604 605 606 607 608 609 610 611 612 613 614 615  | Next Page >

• Clickable links in UILabel?

  - by lope

  Hi there, I have been searching for this for hours but I failed. I probably don't even know what should I be looking for. Many applications have text and in this text are web hyperlinks in rounded rect, when I click them UIWebView opens. What puzzles me is that they often have custom links, for example if words starts with # it is also clickable and aplication responds by opening another view. How can I do that? Is it possible with UILabel or do I need UITextView or something else? I really hope it is standard functionality and i don't need to subclass anything :/

  Read the article

• How to parse a complex string using jQuery Tablesorter plugin ?

  - by Anth0

  I have a table like this I'd like to sort : | Name | Case | | John | X-123/08 P| | Bob | X-123/09 | | Dylan | X-45/10 | I want to sort the Case colum by case's year then case's number knowing that the format is always "X-(1 to 4 digits for case's number)/(case's year on 2 digits) (sometimes some text)". It's possible that after the year's case I have some text but it shoud be ignored for sorting. I am using tablesorter jQuery's plugin and I am struggling to add a custom parser for this. Thanks for your help !

  Read the article

• django + xmppy: send a message to two recipients

  - by Agrajag

  I'm trying to use xmpppy for sending jabber-messages from a django-website. This works entirely fine. However, the message only gets sent to the -first- of the recipients in the list. This happens when I run the following function from django, and also if I run it from an interactive python-shell. The weird part though, is that if I extract the -body- of the function and run that interactively, then all the recipients (there's just 2 at the moment) get the message. Also, I do know that the inner for-loop gets run the correct count times (2), because the print-statement does run twice, and return two different message-ids. The function looks like this: def hello_jabber(request, text): jid=xmpp.protocol.JID(settings.JABBER_ID) cl=xmpp.Client(jid.getDomain(),debug=[]) con=cl.connect() auth=cl.auth(jid.getNode(),settings.JABBER_PW,resource=jid.getResource()) for friend in settings.JABBER_FRIENDS: id=cl.send(xmpp.protocol.Message(friend,friend + ' is awesome:' + text)) print 'sent message with id ' + str(id) cl.disconnect() return render_to_response('jabber/sent.htm', locals())

  Read the article

• CIE XYZ colorspace: do I have RGBA or XYZA?

  - by Tronic

  I plan to write a painting program based on linear combinations of xy plane points (0,1), (1,0) and (0,0). Such system works identically to RGB, except that the primaries are not within the gamut but at the corners of a triangle that encloses the entire gamut. I have seen the three points being referred to as X, Y and Z (upper case) somewhere, but I cannot find the page anymore (I marked them to the picture myself). My pixel format stores the intensity of each of those three components the same way as RGB does, together with alpha value. This allows using pretty much any image manipulation operation designed for RGBA without modifying the code. What is my format called? Is it XYZA, RGBA or something else? Google doesn't seem to know of XYZA. RGBA will get confused with sRGB + alpha (which I also need to use in the same program). Notice that the primaries X, Y and Z and their intensities have little to do with the x, y and z coordinates (lower case) that are more commonly used.

  Read the article

• Validation errors from Google App Engine Logout link

  - by goggin13

  I am making a web page using the Google App Engine. I am validating my pages, and found that the logout link that is generated by the call to the users api (in python) users.create_logout_url(request.uri) does not validate as XHTML 1.0 Strict. The href in the anchor tag looks like this: /_ah/login?continue=http%3A//localhost%3A8080/&action=Logout Including a link with this anchor text throws three different validation errors: *general entity "action" not defined and no default entity *reference to entity "action" for which no system identifier could be generated *EntityRef: expecting ';' Here is a dummy page with the anchor tag in it, if you want to try it on w3c validator.Dummy Page. The logout link wont work, but you can see how the page is valid without it, but the actual text inside the href tag breaks the validation. Any thoughts on whats going on? Thank you!

  Read the article

• Https in java ends up with strange results

  - by Senne

  I'm trying to illustrate to students how https is used in java. But i have the feeling my example is not really the best out there... The code works well on my windows 7: I start the server, go to https://localhost:8080/somefile.txt and i get asked to trust the certificate, and all goes well. When I try over http (before or after accepting the certificate) I just get a blank page, which is ok for me. BUT when I try the exact same thing on my windows XP: Same thing, all goes well. But then (after accepting the certificate first), I'm also able to get all the the files through http! (if I first try http before https followed by accepting the certificate, I get no answer..) I tried refreshing, hard refreshing a million times but this should not be working, right? Is there something wrong in my code? I'm not sure if I use the right approach to implement https here... package Security; import java.io.*; import java.net.*; import java.util.*; import java.util.concurrent.Executors; import java.security.*; import javax.net.ssl.*; import com.sun.net.httpserver.*; public class HTTPSServer { public static void main(String[] args) throws IOException { InetSocketAddress addr = new InetSocketAddress(8080); HttpsServer server = HttpsServer.create(addr, 0); try { System.out.println("\nInitializing context ...\n"); KeyStore ks = KeyStore.getInstance("JKS"); char[] password = "vwpolo".toCharArray(); ks.load(new FileInputStream("myKeys"), password); KeyManagerFactory kmf = KeyManagerFactory.getInstance("SunX509"); kmf.init(ks, password); SSLContext sslContext = SSLContext.getInstance("TLS"); sslContext.init(kmf.getKeyManagers(), null, null); // a HTTPS server must have a configurator for the SSL connections. server.setHttpsConfigurator (new HttpsConfigurator(sslContext) { // override configure to change default configuration. public void configure (HttpsParameters params) { try { // get SSL context for this configurator SSLContext c = getSSLContext(); // get the default settings for this SSL context SSLParameters sslparams = c.getDefaultSSLParameters(); // set parameters for the HTTPS connection. params.setNeedClientAuth(true); params.setSSLParameters(sslparams); System.out.println("SSL context created ...\n"); } catch(Exception e2) { System.out.println("Invalid parameter ...\n"); e2.printStackTrace(); } } }); } catch(Exception e1) { e1.printStackTrace(); } server.createContext("/", new MyHandler1()); server.setExecutor(Executors.newCachedThreadPool()); server.start(); System.out.println("Server is listening on port 8080 ...\n"); } } class MyHandler implements HttpHandler { public void handle(HttpExchange exchange) throws IOException { String requestMethod = exchange.getRequestMethod(); if (requestMethod.equalsIgnoreCase("GET")) { Headers responseHeaders = exchange.getResponseHeaders(); responseHeaders.set("Content-Type", "text/plain"); exchange.sendResponseHeaders(200, 0); OutputStream responseBody = exchange.getResponseBody(); String response = "HTTP headers included in your request:\n\n"; responseBody.write(response.getBytes()); Headers requestHeaders = exchange.getRequestHeaders(); Set<String> keySet = requestHeaders.keySet(); Iterator<String> iter = keySet.iterator(); while (iter.hasNext()) { String key = iter.next(); List values = requestHeaders.get(key); response = key + " = " + values.toString() + "\n"; responseBody.write(response.getBytes()); System.out.print(response); } response = "\nHTTP request body: "; responseBody.write(response.getBytes()); InputStream requestBody = exchange.getRequestBody(); byte[] buffer = new byte[256]; if(requestBody.read(buffer) > 0) { responseBody.write(buffer); } else { responseBody.write("empty.".getBytes()); } URI requestURI = exchange.getRequestURI(); String file = requestURI.getPath().substring(1); response = "\n\nFile requested = " + file + "\n\n"; responseBody.write(response.getBytes()); responseBody.flush(); System.out.print(response); Scanner source = new Scanner(new File(file)); String text; while (source.hasNext()) { text = source.nextLine() + "\n"; responseBody.write(text.getBytes()); } source.close(); responseBody.close(); exchange.close(); } } }

  Read the article

• Changing properties of controls that were added at runtime

  - by user257412

  I have a form in which several buttons are added at runtime via a 'for' method public Form() { for (int i = 0 ... ) Button b = new Button() b.text = (string) i ; etc.. etc.. } . now i wish to change the text property of the buttons on a certain event. How can this be accomplished? I have tried a few things but none worked.. since the buttons variables are inside the method , they are not available outside. Thanks

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• How to skip integers in C++ taken from a fstream txt file?

  - by Elaina

  I need to create a function that uses a loop. This function will open a text file and then must be able to skip a variable number of leading random integers. The program must be able to handle any number of leading random integers. Example if the opened file reads this on its first line: 100 120 92 82 38 49 102 and the SKIP_NUMBER variable is assigned 3 the number the function would grab is 82. The function must continue to grab the integers every SKIP_NUMBER until it reaches the end of the file. These integers taken from the txt file are then placed into another text file. Please help I'm really lost on how to create this loop! :D Here is my function so far... //Function skips variables and returns needed integer int skipVariable (int SKIP_NUMBER) { return 0; //temporary return } These are my program variables: // initialize function/variables ifstream fin; string IN_FILE_NAME, OUT_FILE_NAME; int SKIP_NUMBER;

  Read the article

• Dynamic Array Java program converted to C#

  - by Sef

  Hello, The folowing program was orignally in java. But i still get 1 error with the program in C#. (the eror is listed in comment in the 2nd block of code). using System; using System.Collections.Generic; using System.Linq; using System.Text; using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace DynArray { public class DynArrayTester { static void Main(string[] args) { DynArray da = new DynArray(5); for (int i = 1; i <= 7; i++) { da.setData(i, i); //da.put(0, 0); //da.put(6, 6); } Console.WriteLine(da); } }/*DynArrayTester*/ } using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace DynArray { public class DynArray { //toestand private int[] data; //gedrag public DynArray(int size) { data = new int[size]; } public int getData(int index) { return data[index - 1]; } private void expand(int size) { int[] tmp = data; data = new int[size]; for (int i = 0; i < tmp.Length; i++) { data[i] = tmp[i]; } }/*expand*/ public void setData(int index, int data) { if (0 < index) { if (index > this.data.length) // ***error, does not contain definition for "lenght" and no exetension method "lenght"*** expand(index); this.data[index - 1] = data; } } public override string ToString() { StringBuilder buf = new StringBuilder(); for (int i = 0; i < data.Length; i++) { buf.Append("[" + i + "]"); buf.Append(data[i]); buf.Append('\n'); } return buf.ToString(); } }/*DynArray*/ }

  Read the article

• Replace a list of emoticons with their images

  - by Damiano

  Hello, I have an array with: emoticons = { ':-)' : 'smile1.gif', ':)' : 'smile2.gif', ':D' : 'smile3.gif' } then i have a variabile with the text. var text = 'this is a simple test :)'; and a variable with the url of the website var url = "http://www.domain.com/"; How to write a function that replace the symbols with their images? The <img> tag result should be: <img src="http://www.domain.com/simple2.gif" /> (I have to concatenate the url varible to the name of the image). THank you very much!

  Read the article

• IPP linker errors on cygwin

  - by Jason Sundram

  I've built a program that uses mkl and ipp that runs on mac and linux. I'm now building that program for Windows using cygwin and gcc, and can't get it to link. The errors I'm getting are: Warning: .drectve -defaultlib:"uuid.lib" ' unrecognized ../../../bin/libMath.a(VectorUtility.cxx.o):VectorUtility.cxx:(.text+0x95): undefined reference to _ippGetLibVersion' ../../../bin/libMath.a(VectorUtility.cxx.o):VectorUtility.cxx:(.text+0x157): undefined reference to `_ippsWinHann_32f_I' (and many more like that). I'm using link path: /opt/intel/IPP/6.1.2.041/ia32/lib and linking to the following: ippiemerged, ippimerged, ippmemerged, ippmmerged, ippsemerged, ippsmerged and ippcorel. Can someone point me to what I'm doing wrong?

  Read the article

• Cross Browser input field width stylization

  - by Derek Adair

  Hi, I have a shipping/billing input form and I'm having trouble styling the input fields to be the same width... Here is a link (click one of the order bottles to go to the checkout page which contains the form) The Problem: -a field <input type="text" size="X" /> appears to render with different sizes in different browsers (see link). -In addition, select fields seem to render on a differently as well. -Chrome/safari do not seem to respond to the font-size property for select fields. Any guidance on how to stylize the size of text-input and select fields cross-browser would be oh so very helpful. Must I result to having a different sytlesheet for each browser... just for these input fields? -thanks

  Read the article

• Sharing variable within different javascript file at client side

  - by Aman

  I was actually going through this link. which explains how we can share global variable across multiple js. but the point is what need to be done if I am getting some variable into one js and need to pass to another one mentioned in same document after the 1st one. approach which followed was: Script 1 <script type="text/javascript" src="js/client.js"></script> body added some hidden input with id myHiddenId, where values are set using client.js Script 2 <script type="text/javascript" src="js/anotherJS.js"></script> inside script 2 I am simply using $("#myHiddenId").val(); and using for my purpose. I want to know whether I am following correct approach, because that hidden field may have some data which client should not get aware of. is there any other way through which I can pass the variable values across the js files ? Since I am at beginner level hence digging up some resources/books but still no luck.

  Read the article

• How to refresh an activity?

  - by poeschlorn

  Hi Guys, after implementing some Android Apps, including several Map activities, I try to refresh the activity when the GPS listener's onLocationChanged() mehtod is called. I have no Idea how to tell the map activity to refresh on its own and display the new coords... the coords to store will have to be in global values, so that the location listener will have access to it. In my sample GPS-class (see code below) I just changed the text of a text view....but how to do that in map view? private class MyLocationListener implements LocationListener { @Override public void onLocationChanged(Location loc) { final TextView tv = (TextView) findViewById(R.id.myTextView); if (loc != null) { tv.setText("Location changed : Lat: " + loc.getLatitude() + " Lng: " + loc.getLongitude()); } } I think the solution of this Problem won't be very difficult, but I just need the beginning ;-) This whole app shall work like a really simple navigation system. It would be great if someone could help me a little bit further :) nice greetings, Poeschlorn

  Read the article

• Alter highchart output to display start - end date

  - by php_d

  I currently have the following highchart which display a start date and outputs the values for the next 31 days of data. Does anyone know how I may improve on this to include and end date so that I can filter the data by smaller specific amounts? On the x-axis I am also trying to only display labels that have data attached to them and hide any others. Any help is appreciated. My code is as follows: <script type="text/javascript"> var chart; $(document).ready(function() { chart = new Highcharts.Chart({ chart: { renderTo: 'container', type: 'line', marginRight: 130, marginBottom: 25 }, title: { text: '<?php echo $type ?>', x: -20 //center }, xAxis: { categories: [ <?php $start = $_POST["dateStart"]; $dates = array(); for ($i = 0, $days = date('t', strtotime($start)); $i < $days; ++$i) { $dates[] = date('Y-m-d', strtotime($start . ' + ' . $i . ' day')); } echo "'" . implode("', '", $dates) . "'"; ?> ] }, yAxis: { title: { text: 'Total Amount' }, plotLines: [{ value: 0, width: 1, color: '#808080' }] }, tooltip: { formatter: function() { return '<b>'+ this.series.name +'</b><br/>'+ this.x +': '+ this.y; } }, legend: { layout: 'vertical', align: 'right', verticalAlign: 'top', x: -10, y: 100, borderWidth: 0 }, series: [ <?php foreach ($array as $legend => $data) { echo '{'; echo "name: '" . $legend . "',"; $values = array(); for ($i = 0; $i < $days; ++$i) { $date = date('Y-m-d', strtotime($start . ' + ' . $i . ' day')); $values[] = isset($data[$date]) ? $data[$date] : 0; } echo 'data: [' . implode(', ', $values) . '],'; echo '},'; } ?> ] }); }); Thanks

  Read the article

• How to access the relative directory of a ASP.NET website?

  - by Michael Schilling

  I need to access a folder that will contain various text files for my web site. I'm using Visual Web Developer 2010 Express. I made a web site using visual basic. Here is the failing code: Dim fileName As String fileName = CurDir.ToString + fileName.Text + ".txt" FileOpen(1, fileName, OpenMode.Output) FileClose(1) CurDir.ToString is giving me strange directory path that isn't anywhere near where my website files are located. I need to be able to access the files in a folder inside of the WebSite1 folder without using C:\Users\..., but I'm at a loss on how to do that. Can anyone help me out?

  Read the article

• Better explanation of $this-> in this example please

  - by Doug

  Referring to this question: http://stackoverflow.com/questions/2035449/why-is-oop-hard-for-me class Form { protected $inputs = array(); public function makeInput($type, $name) { echo '<input type="'.$type.'" name="'.$name.'">'; } public function addInput($type, $name) { $this->inputs[] = array("type" => $type, "name" => $name); } public function run() { foreach($this->inputs as $array) { $this->makeInput($array['type'], $array['name']; } } } $form = new form(); $this->addInput("text", "username"); $this->addInput("text", "password");** Can I get a better explanation of what the $this->input[] is doing in this part: public function addInput($type, $name) { $this->inputs[] = array("type" => $type, "name" => $name); }

  Read the article

• Re-measuring custom item renderer on a List

  - by leolobato

  I'm writing an Adobe Air client to a service similar to Twitter. On the timeline (List component) I have a custom item renderer which is basically a Canvas with a fixed-width Image and a Text control, which is multi-line. If the text is long enough to change the Canvas height, it will only be resized if I manually change the width of the Window, forcing a redraw of all renderers. If I simply scroll through the List, all "new" renderers will have the minimum height possible (which is the Image height). Any ideas on how to force the re-measurement of the renderer when I set it's data? Thanks in advance! :)

  Read the article

• IntentNotFoundException for TextToSpeech.Engine.ACTION_INSTALL_TTS_DATA

  - by Casebash

  I am trying to implement text to speech by following this article on the Android Developers Blog. It suggests the following code for installing text to speech data if it is not supported. Intent installIntent = new Intent(); installIntent.setAction(TextToSpeech.Engine.ACTION_INSTALL_TTS_DATA); startActivity(installIntent); This throws an Exception: ActivityNotFoundException: No activity found to handle Intent However, I am using the code here to determine the the intent is actually supported. Here is the list representation: [ResolveInfo{43cc5280 com.svox.pico.DownloadVoiceData p=0 o=0 m=0x108000}] Why doesn't this work?

  Read the article

• How to use backreferences in PHP

  - by Slinky

  I want to add a character to the end of each file extension found in a body of text using preg_replace(). Here is some sample text: $string='http://www.mysite.com/expert/images/imageone.jpghttp://www.mysite.com/expert/images/imagetwo.jpg'; This search & replace works fine in TextWrangler, appending a semi colon to file extensions: (\.(jpg|gif|html?|php|tiff?|pdf|png)) \1; Translated to PHP, however does not work, having no effect; no errors. preg_replace("/(\.(jpg|gif|html|php|tif|tiff|pdf|htm|png))/","\\1;",$string);

  Read the article

• Nesting quotes in JavaScript/HTML

  - by Ryan Elkins

  How do you nest quotes in HTML beyond the second level? As far as I know, there are only 2 types of quotes - single(') and double("). I am aware of escaping - you have to escape in the code but it converts the escaped quotes back to regular quotes when it hits the browser. What is the accepted method to get around something like the following? <p onclick="exampleFunc('<div id="divId"></div>');">Some Text</p> That code prints to the browser: ');"Some Text

  Read the article

• Ignoring unclosed tags from another <div>?

  - by Mike

  I have a website where members can input text using a limited subset of HTML. When a page is displayed that contains a user's text, if they have any unclosed tags, the formatting "bleeds" across into the next area. For example, if the user entered: Hi, my name is <b>John Then, the rest of the page will be bold. Ideally, there'd be someting I could do that would be this simple: <div contained>Hi, my name is <b>John</div> And no tags could bleed out of that div. Assuming there isn't anything this simple, how would I accomplish a similar effect? Or, is there something this easy? Importantly, I do not want to validate the user's input and return an error if they have unclosed tags, since I want to provide the "easiest" user interface possible for my users. Thanks!

  Read the article

• Advantage Data Architect doesn't accept 'output to', are there any other options for outputting a ta

  - by likesalmon

  I'm trying to output the results of a SELECT query to a tab delimited text file in Advantage Data Architect. I know I can use the 'Export to' feature to do this, but there are a lot of tables and that is going to take forever. I would rather use the SQL editor, but I found out it does not accept the OUTPUT TO argument, even though that command is part of Sybase SQL. I would like to do this: SELECT * FROM tablename; OUTPUT TO 'C:/ExportDirectory' DELIMITED BY '\t' FORMAT TEXT; Is there another way?

  Read the article

• Is it possible to use an input within a <label> field?

  - by javanix

  I have a bunch of optional "write-in" values for a survey I'm working on. These are basically a radio button with a textbox within the answer field - the idea being that you would toggle the button and write something into the box. What I'd like to do is have the radio button toggled whenever a user clicks in the text field - this seems like a use-case that makes a lot of sense. Doing this: <input type="radio" id="radiobutton"><label for="radiobutton">Other: <input type="text" id="radiobutton_other"></label> works fine in Chrome (and I am guessing, other WebKit browsers as well), but there are weird selection issues in Firefox, so I'm assuming its a non-standard practice that I should stay away from. Is there a way to replicate this functionality without using JavaScript? I have an onclick function that will work, but we're trying to make our site usable for people who might have NoScript-type stuff running.

  Read the article

< Previous Page | 604 605 606 607 608 609 610 611 612 613 614 615  | Next Page >