Search Results

Search found 19966 results on 799 pages for 'wild thing'.

Page 608/799 | < Previous Page | 604 605 606 607 608 609 610 611 612 613 614 615  | Next Page >

  • SQL Server CLR stored procedures in data processing tasks - good or evil?

    - by Gart
    In short - is it a good design solution to implement most of the business logic in CLR stored procedures? I have read much about them recently but I can't figure out when they should be used, what are the best practices, are they good enough or not. For example, my business application needs to parse a large fixed-length text file, extract some numbers from each line in the file, according to these numbers apply some complex business rules (involving regex matching, pattern matching against data from many tables in the database and such), and as a result of this calculation update records in the database. There is also a GUI for the user to select the file, view the results, etc. This application seems to be a good candidate to implement the classic 3-tier architecture: the Data Layer, the Logic Layer, and the GUI layer. The Data Layer would access the database The Logic Layer would run as a WCF service and implement the business rules, interacting with the Data Layer The GUI Layer would be a means of communication between the Logic Layer and the User. Now, thinking of this design, I can see that most of the business rules may be implemented in a SQL CLR and stored in SQL Server. I might store all my raw data in the database, run the processing there, and get the results. I see some advantages and disadvantages of this solution: Pros: The business logic runs close to the data, meaning less network traffic. Process all data at once, possibly utilizing parallelizm and optimal execution plan. Cons: Scattering of the business logic: some part is here, some part is there. Questionable design solution, may encounter unknown problems. Difficult to implement a progress indicator for the processing task. I would like to hear all your opinions about SQL CLR. Does anybody use it in production? Are there any problems with such design? Is it a good thing?

    Read the article

  • Call to CFC via Ajax-POST does not work

    - by Philipp
    We have the following problem: A CFC-method that is called from AJAX suddenly redirects the request to cfcexplorer instead of executing the request. The strange thing is, that the problem only occurs when we make the ajax call via "POST" method, like this: // This will return the HTTP Status header: // Location: http://url.to:80/CFIDE/componentutils/cfcexplorer.cfc?method=getcfcinhtml&name=web.ajax&path=/web/ajax.cfc $.post( "http://url.to/ajax.cfc", {method: "test"}, function(res) { alert("ajax.cfc POST return:" + res); } ); Making the same request as "GET" request works perfectly: // This will call the method "test" of web/ajax.cfc $.get( "http://url.to/ajax.cfc", {method: "test"}, function(res) { alert("ajax.cfc GET return:" + res); } ); This is the ajax.cfc file (dummy file): <cfcomponent> <cffunction name="test" access="remote" returntype="Any" returnformat="JSON"> <cfset j = {}> <cfset j.data = "this is the data"> <cfreturn serializeJson(j)> </cffunction> </cfcomponent> What really puzzles us is that the request did work in the past (we have a lot of code all making ajax calls via POST and CF-code that expects FORM-data to be present, so we cannot simply change the method to GET) Maybe there was some setting that has changed or similar...

    Read the article

  • What are alternatives to Win32 PulseEvent() function?

    - by Bill
    The documentation for the Win32 API PulseEvent() function (kernel32.dll) states that this function is “… unreliable and should not be used by new applications. Instead, use condition variables”. However, condition variables cannot be used across process boundaries like (named) events can. I have a scenario that is cross-process, cross-runtime (native and managed code) in which a single producer occasionally has something interesting to make known to zero or more consumers. Right now, a well-known named event is used (and set to signaled state) by the producer using this PulseEvent function when it needs to make something known. Zero or more consumers wait on that event (WaitForSingleObject()) and perform an action in response. There is no need for two-way communication in my scenario, and the producer does not need to know if the event has any listeners, nor does it need to know if the event was successfully acted upon. On the other hand, I do not want any consumers to ever miss any events. In other words, the system needs to be perfectly reliable – but the producer does not need to know if that is the case or not. The scenario can be thought of as a “clock ticker” – i.e., the producer provides a semi-regular signal for zero or more consumers to count. And all consumers must have the correct count over any given period of time. No polling by consumers is allowed (performance reasons). The ticker is just a few milliseconds (20 or so, but not perfectly regular). Raymen Chen (The Old New Thing) has a blog post pointing out the “fundamentally flawed” nature of the PulseEvent() function, but I do not see an alternative for my scenario from Chen or the posted comments. Can anyone please suggest one? Please keep in mind that the IPC signal must cross process boundries on the machine, not simply threads. And the solution needs to have high performance in that consumers must be able to act within 10ms of each event.

    Read the article

  • Setting the target and parent dropdown values from a DB when using CascadingDropDown

    - by Ryan
    Hi, I have two dropdown lists with Cascading Dropdown, in the usual fashion: <asp:DropDownList ID="DropDownListIndustry" runat="server" DataSourceID="SqlDataSourceIndustries" DataTextField="name" DataValueField="industry_id" AppendDataBoundItems=" <asp:ListItem Text="(Please Select)" Value="-1" /> </asp:DropDownList> &nbsp;&nbsp; <ajax:CascadingDropDown ID="CascadingDropDownIndustry" runat="server" ParentControlID="DropDownListIndustry" TargetControlID="DropDownListSubIndustry" ServicePath="AjaxDataProvider.asmx" ServiceMethod="GetSubIndustry" Category="SubIndustry" /> <asp:DropDownList ID="DropDownListSubIndustry" runat="server"/> No surprises there. However, I sometimes want to set the values of the parent and target from a DB (I want to default them, based on a code entered by the user; the whole thing is wrapped in an update panel). So if the user keys in ABC, I look up ABC in the DB and default the Parent DropDown to ID 10 and Child DropDown to ID 101. However, this fails because the child has no items when the server side code runs (the web script method hasn't run, because the content of the parent dd wasn't changed on the client side) Does anybody know how to work around this? Thanks for any help! Ryan

    Read the article

  • Dojo DnD: how to access newly copied node on onDndDrop event?

    - by toshinao
    Hi. I am working on code like the following. 01: var c1 = new dojo.dnd.Source('container1', {copyOnly:true}); // container1 is a div 02: var c2 = new dojo.dnd.Source('container2'); // container2 is a div 03: var list = []; 04: for (var i = 0; i < 3; i++) { list.push( dojo.create('div') ); } 05: c1.insertNodes(false, list); 06: 07: function checkDndCopy(nodes, target){ 08: dojo.forEach(nodes, function(node){ alert(node.id); } ); 09: } 10: dojo.subscribe("/dnd/drop", function(){ 11: var mgr = dojo.dnd.manager(); 12: checkDndCopy(mgr.nodes, mgr.target); 13: }); The nodes inserted to the c1 at line 05 have id of "dojoUnique1, donoUnique2, dojoUnique3". On a event of drag and drop a node from c1 to c2, a onDndDrop event is fired and the subscribe method defined in line10-13 is invoked. I expected that newly copied node appears in the nodes (for example) at line 08. But this is not true. When dojoUnique1 is target of drag and drop, nodes at line 08 contains only dojoUnique1. I want to modify some attributes of newly copied nodes on the event of onDndDrop. Please let me know how such a thing is realized.

    Read the article

  • Problem parsing an atom feed using simplexml_load_file(), can't get an attribute.

    - by Craig Ward
    Hi, I am trying to create a social timeline. I pull in feeds form certain places so I have a timeline of thing I have done. The problem I am having is with Google reader Shared Items. I want to get the time at which I shared the item which is contained in <entry gr:crawl-timestamp-msec="1269088723811"> Trying to get the element using $date = $xml->entry[$i]->link->attributes()->gr:crawl-timestamp-msec; fails because of the : after gr which causes a PHP error. I could figure out how to get the element, so thought I would change the name using the code below but it throws the following error Warning: simplexml_load_file() [function.simplexml-load-file]: I/O warning : failed to load external entity "<?xml version="1.0"?><feed xmlns:idx="urn:atom-extension:indexing" xmlns:media="http://search.yahoo.com/mrss/" xmlns <?php $get_feed = file_get_contents('http://www.google.com/reader/public/atom/user/03120403612393553979/state/com.google/broadcast'); $old = "gr:crawl-timestamp-msec"; $new = "timestamp"; $xml_file = str_replace($old, $new, $get_feed); $xml = simplexml_load_file($xml_file); $i = 0; foreach ($xml->entry as $value) { $id = $xml->entry[$i]->id; $date = date('Y-m-d H:i:s', strtotime($xml->entry[$i]->attributes()->timestamp )); $text = $xml->entry[$i]->title; $link = $xml->entry[$i]->link->attributes()->href; $source = "googleshared"; echo "date = $date<br />"; $sql="INSERT IGNORE INTO timeline (id,date,text,link, source) VALUES ('$id', '$date', '$text', '$link', '$source')"; mysql_query($sql); $i++; }` Could someone point me in the right direction please. Cheers Craig

    Read the article

  • Check if the internet cannot be accessed in Python

    - by Sridhar Ratnakumar
    I have an app that makes a HTTP GET request to a particular URL on the internet. But when the network is down (say, no public wifi - or my ISP is down, or some such thing), I get the following traceback at urllib.urlopen: 70, in get u = urllib2.urlopen(req) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 126, in urlopen return _opener.open(url, data, timeout) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 391, in open response = self._open(req, data) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 409, in _open '_open', req) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 369, in _call_chain result = func(*args) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 1161, in http_open return self.do_open(httplib.HTTPConnection, req) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 1136, in do_open raise URLError(err) URLError: <urlopen error [Errno 8] nodename nor servname provided, or not known> I want to print a friendly error to the user telling him that his network maybe down instead of this unfriendly "nodename nor servname provided" error message. Sure I can catch URLError, but that would catch every url error, not just the one related to network downtime. I am not a purist, so even an error message like "The server example.com cannot be reached; either the server is indeed having problems or your network connection is down" would be nice. How do I go about selectively catching such errors? (For a start, if DNS resolution fails at urllib.urlopen, that can be reasonably assumed as network inaccessibility? If so, how do I "catch" it in the except block?)

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Long running stateful service in .NET

    - by Asaf R
    Hi, I need to create a service in .NET that maintains (inner) state in-memory, spawns multiple threads and is generally long-running. There are a lot options - Good-old Windows Service Windows Communication Services Windows Workflow Foundation I really don't know which to choose. Most of the functionality is in a library used by this service, so the service itself is rather simple. On one hand, it's important the service host is as close to "simply working" as possible, which excludes Windows Service. On the other hand, it's important that the service is not taken down by the host just because there's no external activity, which makes WCF kind o' "scary". As for WF, it's strongest selling point is the ability to create processes as, um..., workflows, which is something I don't need nor want. To sum it up, the plethora of Microsoft technologies got me a bit confused. I'd appreciate help regarding the pros and cons of each solution (or other's I've failed to mention) for the problem of a stateful, long running service in .NET Thanks, Asaf P.S., I'm using .NET 4. EDIT: What I mean by the host "simply working" is, for example, that the service I create be reactivated if it crashes. I guess the reason for this question is that I've created Windows Services in the past (I think it was in plain C++ with Win32 API), and I don't want to miss out on something simpler if there's is such as thing. Thanks for all the replies thus far! Asaf.

    Read the article

  • MPMoviePlayerController - streaming works on 3GS, not on anything pre-3GS

    - by Canada Dev
    I am having some serious issues and annoyances with MPMoviePlayerController. In my app you can watch trailers for some movies in .mov format. I have tested with a friend and had users report that it does not work on their device, which are all 3G. I have tested on my own, a 3GS and playback works fine. I have tried on a 1st gen iPhone and it doesn't work. So I am lead to believe it's a memory issue, and that it's simply stopping the playback and returning to the previous screen. Below is the code I use to launch the player, which is straight out of the MoviePlayer example from Apple. MPMoviePlayerController *mp = [[MPMoviePlayerController alloc] initWithContentURL:[NSURL URLWithString:trailerURL]]; if (mp) { self.moviePlayer = mp; [mp release]; [self.moviePlayer play]; } I have tried to check the NSError from the notifications, but the only thing I get is "An unknown playback error occurred" for both the localizedDescription and localizedRecoverySuggestion, making it impossible to figure out exactly why it's not working. I have seen many examples of people who just have issues with the movie player, but it's starting to annoy me that it sometimes seem to work fine and other times it just doesn't (again, appearing like a memory issue). Thanks for any help/feedback provided

    Read the article

  • How to make Fluent NHibernate ignore Dictionary properties

    - by Matt Winckler
    I'm trying to make Fluent NHibernate's automapping ignore a Dictionary property on one of my classes, but Fluent is ignoring me instead. Ignoring other types of properties seems to work fine, but even after following the documentation and adding an override for the Dictionary, I still get the following exception when BuildSessionFactory is called: The type or method has 2 generic parameter(s), but 1 generic argument(s) were provided. A generic argument must be provided for each generic parameter. I've tried overriding by property name: .Override<MyClass>(map => { map.IgnoreProperty(x => x.MyDictionaryProperty); }) and also tried implementing ignores using a custom attribute, both of which result in the same exception from BuildSessionFactory. The only thing so far that makes this exception go away is removing the Dictionary property entirely. My question seems to be identical to this one which was never answered (though I'll expand the scope by stating it doesn't matter whether the dictionary is on an abstract base class; the problem always happens for me regardless of what class the property is on). Any takers this time around?

    Read the article

  • user inheritance in django

    - by amateur
    Hi guys, I saw a couple of ways extending user information of users and decided to adopt the model inheritance method. for instance, I have : class Parent(User): contact_means = models.IntegerField() is_staff = False objects = userManager() Now it is done, I've downloaded django_registration to help me out with sending emails to new users. The thing is, instead of using registration forms to register new user, I want to to invoke the email sending/acitvation capability of django_registration. So my workflow is: 1. add new Parent object in admin page. 2. send email My problem is, the django-registration creates a new registration profile together with a new user in the user table. how do I tweak this such that I am able to add the user entry into the custom user table. I have tried to create a modelAdmin and alter the save_model method to launch the create_inactive_user from django_registration, however I do not how to save the user object generated from django_registration into my Parent table when I have using model inheritance and I do not have a Foreign key attribute in my parent model.

    Read the article

  • Bypassing confirmation prompt of an external process

    - by Alidad
    How can I convert this Perl code to Groovy? How to bypass confirmation prompts of an external process? I am trying to convert a Perl script to Groovy. The program is loading/delete maestro (job scheduling) jobs automatically. The problem is the delete command will prompt for confirmation (Y/N) on every single job that it finds. I tried the process execute in groovy but will stop at the prompts. The Perl script is writing bunch of Ys to the stream and print it to the handler( if I understood it correctly) to avoid stopping. I am wondering how to do the same thing in Groovy ? Or any other approach to execute a command and somehow write Y on every confirmation prompt. Perl Script: $maestrostring=""; while ($x < 1500) { $maestrostring .= "y\n"; $x++; } # delete the jobs open(MAESTRO_CMD, "|ssh mserver /bin/composer delete job=pserver#APPA@") print MAESTRO_CMD $maestrostring; close(MAESTRO_CMD); This is my groovy code so far: def deleteMaestroJobs (){ ... def commandSched ="ssh $maestro_server /bin/composer delete sched=$primary_server#$app_acronym$app_level@" def commandJobs ="ssh $maestro_server /bin/composer delete job=$primary_server#$app_acronym$app_level@" try { executeCommand commandJobs } catch (Exception ex ){ throw new Exception("Error executing the Maestro Composer [DELETE]") } try { executeCommand commandSched } catch (Exception ex ){ throw new Exception("Error executing the Maestro Composer [DELETE]") } } def executeCommand(command){ def process = command.execute() process.withWriter { writer -> 1500.times {writer.println 'Y' } } process.consumeProcessOutput(System.out, System.err) process.waitFor() }

    Read the article

  • Save as DialogBox to save textbox content to a newfile using asp.net

    - by user195114
    I want the users to type their text in the given textbox and on clicking on createNewFile Button, a SaveAs Dialogbox should popup and the users should browse through the location and save the file as desired. I have tried some thing but (1) the dialog box goes behind the application (2) when run, dialogbox opens 3 times, means it executes 3 times REPLY TO THE POST protected void btnNewFile_Click(object sender, EventArgs e) { StreamWriter sw = null; try { SaveFileDialog sdlg = new SaveFileDialog(); DialogResult result = sdlg.ShowDialog(); sdlg.InitialDirectory = @"C:\"; sdlg.AddExtension = true; sdlg.CheckPathExists = true; sdlg.CreatePrompt = false; sdlg.OverwritePrompt = true; sdlg.ValidateNames = true; sdlg.ShowHelp = true; sdlg.DefaultExt = "txt"; // sdlg.ShowDialog = Form.ActiveForm; string file = sdlg.FileName.ToString(); string data = txtNewFile.Text; if (sdlg.ShowDialog() == DialogResult.OK) { sw.WriteLine(txtNewFile.Text); sw.Close(); } if (sdlg.ShowDialog() == DialogResult.Cancel) { sw.Dispose(); } //Save(file, data); } catch { } finally { if (sw != null) { sw.Close(); } } } private void Save(string file, string data) { StreamWriter writer = new StreamWriter(file); SaveFileDialog sdlg1 = new SaveFileDialog(); try { if (sdlg1.ShowDialog() == DialogResult.OK) { writer.Write(data); writer.Close(); } else writer.Dispose(); } catch (Exception xp) { MessageBox.Show(xp.Message); } finally { if (writer != null) { writer.Close(); } } } I have tried this.

    Read the article

  • funny behavior of jquery code

    - by user253530
    Funny thing is that if i delete the comment for alert(data[i].id) the code works. As it is in the example, the string is not concatenated thus i have no options in the select box. Hints? Help? var bookmarkingSites = ''; $.getJSON("php/socialbookmark-get-bookmarking-sites.php",function(data){ for(var i = 0; i < data.length; i++){ //alert( data[i].id); bookmarkingSites += '<option value = \"' + data[i].id + '\">' + data[i].title + '</option>'; } }); <some more code> -------> toAppend += '<td><select name="sb2" id="sb2">'+ '<option value="'+ data.results[i].bookmark +'">' + data.results[i].bookmark +'</option>' + bookmarkingSites + '</select></td>'; <some more code>

    Read the article

  • JVM segmentation faults due to "Invalid memory access of location"

    - by Dan
    I have a small project written in Scala 2.9.2 with unit tests written using ScalaTest. I use SBT for compiling and running my tests. Running sbt test on my project makes the JVM segfault regularly, but just compiling and running my project from SBT works fine. Here is the exact error message: Invalid memory access of location 0x8 rip=0x10959f3c9 [1] 11925 segmentation fault sbt I cannot locate a core dump anywhere, but would be happy to provide it if it can be obtained. Running java -version results in this: java version "1.6.0_37" Java(TM) SE Runtime Environment (build 1.6.0_37-b06-434-11M3909) Java HotSpot(TM) 64-Bit Server VM (build 20.12-b01-434, mixed mode) But I've also got Java 7 installed (though I was never able to actually run a Java program with it, afaik). Another issue that may be related: some of my test cases contain titles including parentheses like ( and ). SBT or ScalaTest (not sure) will consequently insert square parens in the middle of the output. For example, a test case with the name (..)..(..) might suddenly look like (..[)..](..). Any help resolving these issues is much appreciated :-) EDIT: I installed the Java 7 JDK, so now java -version shows the right thing: java version "1.7.0_07" Java(TM) SE Runtime Environment (build 1.7.0_07-b10) Java HotSpot(TM) 64-Bit Server VM (build 23.3-b01, mixed mode) This also means that I now get a more detailed segfault error and a core dump: # # A fatal error has been detected by the Java Runtime Environment: # # SIGSEGV (0xb) at pc=0x000000010a71a3e3, pid=16830, tid=19459 # # JRE version: 7.0_07-b10 # Java VM: Java HotSpot(TM) 64-Bit Server VM (23.3-b01 mixed mode bsd-amd64 compressed oops) # Problematic frame: # V [libjvm.dylib+0x3cd3e3] And the dump.

    Read the article

  • AS3 microphone recording/saving works, in-flash PCM playback double speed

    - by Lowgain
    I have a working mic recording script in AS3 which I have been able to successfully use to save .wav files to a server through AMF. These files playback fine in any audio player with no weird effects. For reference, here is what I am doing to capture the mic's ByteArray: (within a class called AudioRecorder) public function startRecording():void { _rawData = new ByteArray(); _microphone.addEventListener(SampleDataEvent.SAMPLE_DATA, _samplesCaptured, false, 0, true); } private function _samplesCaptured(e:SampleDataEvent):void { _rawData.writeBytes(e.data); } This works with no problems. After the recording is complete I can take the _rawData variable and run it through a WavWriter class, etc. However, if I run this same ByteArray as a sound using the following code which I adapted from the adobe cookbook: (within a class called WavPlayer) public function playSound(data:ByteArray):void { _wavData = data; _wavData.position = 0; _sound.addEventListener(SampleDataEvent.SAMPLE_DATA, _playSoundHandler); _channel = _sound.play(); _channel.addEventListener(Event.SOUND_COMPLETE, _onPlaybackComplete, false, 0, true); } private function _playSoundHandler(e:SampleDataEvent):void { if(_wavData.bytesAvailable <= 0) return; for(var i:int = 0; i < 8192; i++) { var sample:Number = 0; if(_wavData.bytesAvailable > 0) sample = _wavData.readFloat(); e.data.writeFloat(sample); } } The audio file plays at double speed! I checked recording bitrates and such and am pretty sure those are all correct, and I tried changing the buffer size and whatever other numbers I could think of. Could it be a mono vs stereo thing? Hope I was clear enough here, thanks!

    Read the article

  • Efficiently Determine if EF 4 POCO Already in ObjectSet

    - by Eric J.
    I'm trying EF 4 with POCO's on a small project for the first time. In my Repository implementation, I want to provide a method AddOrUpdate that will add a passed-in POCO to the repository if it's new, else do nothing (as the updated POCO will be saved when SaveChanges is called). My first thought was to do this: public void AddOrUpdate(Poco p) { if (!Ctx.Pocos.Contains<Poco>(p)) { Ctx.Pocos.AddObject(p); } } However that results in a NotSupportedException as documented under Referencing Non-Scalar Variables Not Supported (bonus question: why would that not be supported?) Just removing the Contains part and always calling AddObject results in an InvalidStateException: An object with the same key already exists in the ObjectStateManager. The existing object is in the Unchanged state. An object can only be added to the ObjectStateManager again if it is in the added state. So clearly EF 4 knows somewhere that this is a duplicate based on the key. What's a clean, efficient way for the Repository to update Pocos for either a new or pre-existing object when AddOrUpdate is called so that the subsequent call to SaveChanges() will do the right thing? I did consider carrying an isNew flag on the object itself, but I'm trying to take persistence ignorance as far as practical.

    Read the article

  • Jquery Livesearch with quicksilver plugin to include not just the <li>s

    - by 133794m3r
    Ok, what i'm trying to do here is to make the exact code found here here ordered list and make it so that it doesn't just not work when i try to add additional elements into the list. Also i'm planning on using the more effecient one linked to at the end but i cannot put it here so you'll have to find that link on your own sadly. Since i'm trying to use this for a knowledge base page i want to allow people to be able to search through the items on the page and go to the proper part(ie loading it into the viewing area) but it's not letting me even include a simple anchor in there. if there is anyway to do something similar or to edit it so that it'll include everything within the <li> that'd be great. I don't know if anyone out there has done something like this before, but if they have and wouldn't mind sharing the code with me i'd be extremely happy. If no one has but does know how to make it include everything within the <li> including text also a great thing to have. I imagine that i won't be the only person out there in this world with my exact query.

    Read the article

  • Problem Activating Sharepoint Timer Job

    - by Ben Robinson
    I have created a very simple sharepoint timer job. All i want it to do is iterate through a list and update each list item so that it triggers an existing workflow that works fine. In other words all i am trying to do is work around the limitation that workflows cannot be triggered on a scheduled basis. I have written a class that inherits from SPJobDefinition that does the work and i have a class that inherits from SPFeatureReceiver to install and activate it. I have created the feature using SPVisualdev that my coleagues have used in the past for other SP development. My Job class is below: public class DriverSafetyCheckTrigger : SPJobDefinition { private string pi_SiteUrl; public DriverSafetyCheckTrigger(string SiteURL, SPWebApplication WebApp):base("DriverSafetyCheckTrigger",WebApp,null, SPJobLockType.Job) { this.Title = "DriverSafetyCheckTrigger"; pi_SiteUrl = SiteURL; } public override void Execute(Guid targetInstanceId) { using (SPSite siteCollection = new SPSite(pi_SiteUrl)) { using (SPWeb site = siteCollection.RootWeb) { SPList taskList = site.Lists["Driver Safety Check"]; foreach(SPListItem item in taskList.Items) { item.Update(); } } } } } And the only thing in the feature reciever class is that i have overridden the FeatureActivated method below: public override void FeatureActivated(SPFeatureReceiverProperties Properties) { SPSite site = Properties.Feature.Parent as SPSite; // Make sure the job isn't already registered. foreach (SPJobDefinition job in site.WebApplication.JobDefinitions) { if (job.Name == "DriverSafetyCheckTrigger") job.Delete(); } // Install the job. DriverSafetyCheckTrigger oDriverSafetyCheckTrigger = new DriverSafetyCheckTrigger(site.Url, site.WebApplication); SPDailySchedule oSchedule = new SPDailySchedule(); oSchedule.BeginHour = 1; oDriverSafetyCheckTrigger.Schedule = oSchedule; oDriverSafetyCheckTrigger.Update(); } The problem i have is that when i try to activate the feature it throws a NullReferenceException on the line oDriverSafetyCheckTrigger.Update(). I am not sure what is null in this case, the example i have followed for this is this tutorial. I am not sure what I am doing wrong.

    Read the article

  • Java Robot key activity seems to stop working while certain software is running

    - by Mike Turley
    I'm writing a Java application to automate character actions in an online game overnight (specifically, it catches fish in Final Fantasy XI). The app makes heavy use of java's Robot class both for emulating user keyboard input and for detecting color changes on certain parts of the screen. It also uses multithreading and a swing GUI. The application seems to work perfectly when I test it without the game running, just using screenshots to trigger the apps responses into notepad. But for some reason, when I actually launch FFXI and start the program, all of my keyboard and mouse manipulations just stop working altogether. The program is still running, and the Robot class is still able to read pixel colors. But Robot.keyPress, Robot.keyRelease, Robot.mouseMove, Robot.mousePress and Robot.mouseRelease all do nothing. It's the strangest thing-- to test it, I wrote a simple loop that just keeps typing letters, and focused notepad. I'd then start the game, refocus notepad, and it would do nothing. Then I'd exit the game, and it'd start working again immediately. Has anyone else come across something like this, where specific software will stop certain functions of java from working? Also, to make this more interesting-- Last year I wrote a very similar program using the same classes and programming techniques to automate healing a party in the game as they fight. Last year, this program worked perfectly. After running into these problems I dug up that old program, ran it without making any changes, and found that it too was having the same problems. The only differences between now and when it was working: I was running Windows Vista and now I'm running Windows 7, and several new Java versions as well as FFXI versions have been released. What the hell is going on? (if anyone needs to see my source code, email me at [email protected]. I'm trying to keep it to myself.)

    Read the article

  • How to create a view to manage associations between HABTM models? (Rails)

    - by Chris Hart
    Hello, I am using Ruby on Rails and need to create a view that allows the creation of records through a HABTM relationship to another model. Specifically, I have the following models: Customer and ServiceOverride, and a join table customers_serviceoverrides. Using the customer view for create/update, I need to be able to create, update and delete ServiceOverrides and manage the attributes of the associated model(s) from the same view. Visually I'd prefer to have something like a plus/minus sign to add/delete service overrides, and each serviceoverride record has two string entities which need to be displayed and editable as well. However, if I could just get the code (a kind of nested form, I'm assuming?) working, I could work out the UI aspects. The models are pretty simple: class ServiceOverride < ActiveRecord::Base has_and_belongs_to_many :customers end class Customer < ActiveRecord::Base has_and_belongs_to_many :serviceoverrides end The closest thing I've found explaining this online is on this blog but it doesn't really address what I'm trying to do (both manage the linkages to the other model, and edit attributes of that model. Any help is appreciated. Thanks in advance. Chris

    Read the article

  • Help me find an appropriate ruby/python parser generator

    - by Geo
    The first parser generator I've worked with was Parse::RecDescent, and the guides/tutorials available for it were great, but the most useful feature it has was it's debugging tools, specifically the tracing capabilities ( activated by setting $RD_TRACE to 1 ). I am looking for a parser generator that can help you debug it's rules. The thing is, it has to be written in python or in ruby, and have a verbose mode/trace mode or very helpful debugging techniques. Does anyone know such a parser generator ? EDIT: when I said debugging, I wasn't referring to debugging python or ruby. I was referring to debugging the parser generator, see what it's doing at every step, see every char it's reading, rules it's trying to match. Hope you get the point. BOUNTY EDIT: to win the bounty, please show a parser generator framework, and illustrate some of it's debugging features. I repeat, I'm not interested in pdb, but in parser's debugging framework. Also, please don't mention treetop. I'm not interested in it.

    Read the article

  • Can NSCollectionView autoresize the width of its subviews to display one column

    - by littlecharva
    Hi, I have an NSCollectionView that contains a collection of CustomViews. Initially it tiled the subviews into columns and rows like a grid. I then set the Columns property in IB to 1, so now it just displays them one after another in rows. However, even though my CustomView is 400px wide, it's set to autoresize, the NSCollectionView is 400px wide, and it's set to 1 column, the subviews are drawn about 80px wide. I know I can get around this by calling: CGFloat width = [collectionView bounds].size.width; NSSize size = NSMakeSize(width, 85); [collectionView setMinItemSize:size]; [collectionView setMaxItemSize:size]; But putting this code in the awakeFromNib method of my WindowController only sets the correct width when the program launches. When I resize the window (and the NSCollectionView autoresizes as I've specified), the CustomViews stay at their initially set width. I'm happy to take care of resizing the subviews myself if need be, but I'm quite new to Cocoa and can't seem to find any articles explaining how to do such a thing. Can someone point me in the right direction? Anthony

    Read the article

  • ColdFusion 8: Database Connection Reset Error

    - by Gavin
    I have been getting these intermittent ColdFusion Database connection reset errors and was wondering if anyone had experience with this and had a particular solution that worked? Here is the error: Error Executing Database Query.[Macromedia][SQLServer JDBC Driver]A problem occurred when attempting to contact the server (Server returned: Connection reset). Please ensure that the server parameters passed to the driver are correct and that the server is running. Also ensure that the maximum number of connections have not been exceeded for this server. This doesn't happen with any particular query, the code breaks in different queries every time, returning a SQLState error 08s01. These query's logic are fine, no logic errors etc. I checked the network logs and there were no database server connection refusals at the time of the error. Once the first error occurs, it keeps happening for no more than a minute or so at random times of the day, every few days. I've googled this thing and so far anyone that has had this issue was only on CF6 or 7, which the fixes coldFusion put out are only for CF6 or 7. Server configuration wise: The ColdFusion server is version 8 The database server is SQL Server 2005 Standard The database connections allowed setting is set to unlimited on both SQL Server and ColdFusion Any help would be greatly appreciated, Thanks!

    Read the article

< Previous Page | 604 605 606 607 608 609 610 611 612 613 614 615  | Next Page >