Search Results

Search found 18786 results on 752 pages for 'edit insanely'.

Page 619/752 | < Previous Page | 615 616 617 618 619 620 621 622 623 624 625 626  | Next Page >

  • form not identifying the new input fields generated through a javascript

    - by tibin mathew
    Hi, I am developing a site in php. i have some issues with my form i have to more than one software packages at a time. so i have used javascript to append file and a dropdown to my html. i have called ajs function to add the new input fields each time when i click a link. and its displaying correctly. but its not identifying in my action page. i cant take the value of new input fields which i have created through that javascript function. below is the code page which i have used. function addInput(divName){ var newsel= document.createElement('div'); newsel.innerHTML="Operating System: --Select OS--    bc_linux    Linux   Solaris   2000/XP/Vista   XP/Vista   2K/XP/Vista/W7   HP   Windows 2000/XP/Vista zip   Windows 2000/XP/Vista exe   X Server - 2.2M   Fonts - 32.9M"; document.getElementById(divName).appendChild(newsel); var newdiv = document.createElement('div'); newdiv.innerHTML = "Upload Software File: "; document.getElementById(divName).appendChild(newdiv); } <form action="act-add-software.php" method="post" onSubmit="return validate(this);" enctype="multipart/form-data">  Operating System:  Operating System: <select name="frm_os" class="text_area" style="width:200px"> <option value="">--Select OS--</option> <optgroup label="Spind Enabled"> </optgroup> <option value="bc_linux">&nbsp;&nbsp;&nbsp;bc_linux</option> <optgroup label="Packages"> </optgroup> <option value="Linux">&nbsp;&nbsp;&nbsp;Linux</option> <option value="Solaris">&nbsp;&nbsp;&nbsp;Solaris</option> <option value="2000/XP/Vista">&nbsp;&nbsp;&nbsp;2000/XP/Vista</option> <option value="XP/Vista">&nbsp;&nbsp;&nbsp;XP/Vista</option> <option value="2K/XP/Vista/W7">&nbsp;&nbsp;&nbsp;2K/XP/Vista/W7</option> <option value="HP">&nbsp;&nbsp;&nbsp;HP</option> <option value="Windows 2000/XP/Vista zip">&nbsp;&nbsp;&nbsp;Windows 2000/XP/Vista zip</option> <option value="Windows 2000/XP/Vista exe">&nbsp;&nbsp;&nbsp;Windows 2000/XP/Vista exe</option> <option value="X Server - 2.2M">&nbsp;&nbsp;&nbsp;X Server - 2.2M</option> <option value="Fonts - 32.9M">&nbsp;&nbsp;&nbsp;Fonts - 32.9M</option> </select> <a onClick="addInput('dynamicInput');">Add More Package</a> </td> </td> </tr> <tr> <td colspan="2"><table border="0" cellpadding="0" cellspacing="0"> <tr align="center" valign="middle" class="tbl_row1"> <td height="25" align="left" class="font1" width="156" bgcolor="White"><div align="right"> <?if(strstr($frm_server_side_error,'frm_software')){?> <font class="error"><b> <font color="#dd0000">*</font>&nbsp;Upload Software File: </font> <?}else{?> <font class="form_element"> <font color="#dd0000">*</font>&nbsp;Upload Software File: <?}?> </div> </B> </td> <td class="font1" bgcolor="White" align="center" style="padding-left:2px;"><input type="file" name="frm_image[]" class="text_area"> </td> <?if($frm_sfile !=""){?> <td class="font1" bgcolor="White" align="center"></td> <?}else{?> <td class="font1" bgcolor="White" align="center">&nbsp;(Current File: NOT Uploaded Yet) </td> <?}?> </tr> </table></td> </tr> <tr> <td colspan="2"> <div id="dynamicInput"> </div> </td> </tr> <? if(isset($_REQUEST['edit'])){?> <tr> <td colspan="2"><table border="0" cellpadding="0" cellspacing="0"> <tr align="center" valign="middle" class="tbl_row1"> <td height="25" align="left" class="font1" width="156" bgcolor="White"><div align="right">&nbsp;Upload Version TXT File: </div> </B> </td> <td class="font1" bgcolor="White" align="right" style="padding-left:2px;"><input type="file" name="frm_version_txt" class="text_area"> </td> <?if($frm_vers_txt !=""){?> <td class="font1" bgcolor="White" align="center">&nbsp;(Current File: <?echo $frm_vers_txt;?>) </td> <?}else{?> <td class="font1" bgcolor="White" align="center">&nbsp;(Current File: NOT Uploaded Yet) </td> <?}?> </tr> </table></td> </tr> <?}?> <tr><td colspan="2" height="5" ></td></tr> <tr> <td align="right" width="30%" style="font-size:13px;color:#000000;" colspan="2"><div align="left"><font color="#dd0000">&nbsp;&nbsp;&nbsp;*</font> Asterisks denote required fields&nbsp;&nbsp;</div></td> </tr> <tr><td colspan="2" height="5" ></td></tr> <tr> <td align="right" width="30%" style="font-size:13px;color:#000000;" colspan="2"><div align="left"><font color="#dd0000">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</font>Note: Only one software can be uploaded per Operating System for a particular version. </div></td> </tr> <tr> <td colspan="2" height="5" ></td> </tr> <tr valign="middle" bgcolor="White"> <td nowrap colspan="2"><div align="center"> <table> <tr> <input type="hidden" name="like" value="<?=$sub_like?>"> <input type="hidden" name="offset" value="<?=$offset?>"> <input type="hidden" name="edit" value="<?=$faq_id?>"> <input type="hidden" name="add" value="<?=$_REQUEST[add]?>"> <input type="hidden" name="ex_np_link" value="<?=$ex_np_link?>"> <input type="hidden" name="frm_group_show" value="<?=$frm_bc?>"> <input type="hidden" name="frm_pd_id" value="<?=$pdct_id?>"> <input type="hidden" name="count_val" value="1" id="id_count"> <!-- <input type="hidden" name="frm_pdct" value="<?=$pdct_id?>"> <input type="hidden" name="frm_dname" value="<?=$frm_question?>"> <input type="hidden" name="frm_date_created" value="<?=$edit_created_date?>"> --> <input type="hidden" name="frm_txt_else" value="<?=$frm_vers_txt?>"> </tr> </table> </div> </td> </tr> </table> </div> </td> <th background="../admin_images/bg4.jpg" style="background-repeat:repeat-y "scope="row"></th> </tr> <tr> <th width="3%" background="../admin_images/bg8.jpg" style="background-repeat:repeat-y "scope="row">&nbsp;</th> <td colspan="2" style="padding-left:5px;padding-bottom:1px;"><table width="100%" border="0" cellspacing="0" cellpadding="0"> <tr> <td colspan="2" valign="top"><div align="right"> <table border="0"> <tr> <td vAlign="right" title="Save">&nbsp; <input type="Image" src="./../admin_images/save.jpg" name="btn_submit" value="<?=$btn_value?>" onClick="return validate(this.form);"> </td> <td title="Cancel"><a href="manage-software.php?field_name=SUnq&sort_meth=<?=$sort_meth?>&like=<?=$sub_like?>&offset=<?=$offset?>&frm_group_show=<?=$frm_bc?>"><img src="./../admin_images/cancel.jpg" border="0" align="absmiddle"></a></td> <input type="hidden" name="like" value="<?=$sub_like?>"> <input type="hidden" name="offset" value="<?=$offset?>"> </tr> </table> </div></td> </tr> </table></td> <th background="../admin_images/bg4.jpg" style="background-repeat:repeat-y "scope="row"></th> </tr> </form> For the simplicity of viewing this code page i have included only required code lines please help me to solve this issue

    Read the article

  • TinyMCE is glitchy/unusable in IE8

    - by Force Flow
    I'm using the jQuery version of TinyMCE 3.3.9.3 In firefox, it works fine (10 sec video depicting it in use): http://www.youtube.com/watch?v=TrAE0igfT3I In IE8 (in IE8 standards mode), I can't type or click any buttons. However, if I use ctrl+v to paste, then I can start typing, but the buttons still don't work (a 45 sec video depicting it in use): http://www.youtube.com/watch?v=iBSRlE8D8F4 The jQuery TinyMCE demo on TinyMCE's site works for me in IE8. Here's the init code: $().ready(function(){ function tinymce_focus(){ $('.defaultSkin table.mceLayout').css({'border-color' : '#6478D7'}); $('.defaultSkin table.mceLayout tr.mceFirst td').css({'border-top-color' : '#6478D7'}); $('.defaultSkin table.mceLayout tr.mceLast td').css({'border-bottom-color' : '#6478D7'}); } function tinymce_blur(){ $('.defaultSkin table.mceLayout').css({'border-color' : '#93a6e1'}); $('.defaultSkin table.mceLayout tr.mceFirst td').css({'border-top-color' : '#93a6e1'}); $('.defaultSkin table.mceLayout tr.mceLast td').css({'border-bottom-color' : '#93a6e1'}); } $('textarea.tinymce').tinymce({ script_url : 'JS/tinymce/tiny_mce.js', theme : "advanced", mode : "exact", invalid_elements : "b,i,iframe,font,input,textarea,select,button,form,fieldset,legend,script,noscript,object,embed,table,img,a,h1,h2,h3,h4,h5,h6", //theme options theme_advanced_buttons1 : "cut,copy,paste,pastetext,pasteword,selectall,|,undo,redo,|,cleanup,removeformat,|", theme_advanced_buttons2 : "bold,italic,underline,|,bullist,numlist,|,forecolor,backcolor,|", theme_advanced_buttons3 : "", theme_advanced_buttons4 : "", theme_advanced_toolbar_location : "top", theme_advanced_toolbar_align : "left", theme_advanced_statusbar_location : "none", theme_advanced_resizing : false, //plugins plugins : "inlinepopups,paste", dialog_type : "modal", paste_auto_cleanup_on_paste : true, setup: function(ed){ ed.onInit.add(function(ed){ //check for addEventListener -- primarily supported by firefox only var edDoc = ed.getDoc(); if ("addEventListener" in edDoc){ edDoc.addEventListener("focus", function(){ tinymce_focus(); }, false); edDoc.addEventListener("blur", function(){ tinymce_blur(); }, false); } }); } }); }); Any ideas as to why it's not working in IE8? [edit]: stripping everything out of the init (leaving just script_url and theme) results in the same symptoms

    Read the article

  • get_by_id method on Model classes in Google App Engine Datastore

    - by tarn
    I'm unable to workout how you can get objects from the Google App Engine Datastore using get_by_id. Here is the model from google.appengine.ext import db class Address(db.Model): description = db.StringProperty(multiline=True) latitude = db.FloatProperty() longitdue = db.FloatProperty() date = db.DateTimeProperty(auto_now_add=True) I can create them, put them, and retrieve them with gql. address = Address() address.description = self.request.get('name') address.latitude = float(self.request.get('latitude')) address.longitude = float(self.request.get('longitude')) address.put() A saved address has values for >> address.key() aglndWVzdGJvb2tyDQsSB0FkZHJlc3MYDQw >> address.key().id() 14 I can find them using the key from google.appengine.ext import db address = db.get('aglndWVzdGJvb2tyDQsSB0FkZHJlc3MYDQw') But can't find them by id >> from google.appengine.ext import db >> address = db.Model.get_by_id(14) The address is None, when I try >> Address.get_by_id(14) AttributeError: type object 'Address' has no attribute 'get_by_id' How can I find by id? EDIT: It turns out I'm an idiot and was trying find an Address Model in a function called Address. Thanks for your answers, I've marked Brandon as the correct answer as he got in first and demonstrated it should all work.

    Read the article

  • Performance of VIEW vs. SQL statement

    - by Matt W.
    I have a query that goes something like the following: select <field list> from <table list> where <join conditions> and <condition list> and PrimaryKey in (select PrimaryKey from <table list> where <join list> and <condition list>) and PrimaryKey not in (select PrimaryKey from <table list> where <join list> and <condition list>) The sub-select queries both have multiple sub-select queries of their own that I'm not showing so as not to clutter the statement. One of the developers on my team thinks a view would be better. I disagree in that the SQL statement uses variables passed in by the program (based on the user's login Id). Are there any hard and fast rules on when a view should be used vs. using a SQL statement? What kind of performance gain issues are there in running SQL statements on their own against regular tables vs. against views. (Note that all the joins / where conditions are against indexed columns, so that shouldn't be an issue.) EDIT for clarification... Here's the query I'm working with: select obj_id from object where obj_id in( (select distinct(sec_id) from security where sec_type_id = 494 and ( (sec_usergroup_id = 3278 and sec_usergroup_type_id = 230) or (sec_usergroup_id in (select ug_gi_id from user_group where ug_ui_id = 3278) and sec_usergroup_type_id = 231) ) and sec_obj_id in ( select obj_id from object where obj_ot_id in (select of_ot_id from obj_form left outer join obj_type on ot_id = of_ot_id where ot_app_id = 87 and of_id in (select sec_obj_id from security where sec_type_id = 493 and ( (sec_usergroup_id = 3278 and sec_usergroup_type_id = 230) or (sec_usergroup_id in (select ug_gi_id from user_group where ug_ui_id = 3278) and sec_usergroup_type_id = 231) ) ) and of_usage_type_id = 131 ) ) ) ) or (obj_ot_id in (select of_ot_id from obj_form left outer join obj_type on ot_id = of_ot_id where ot_app_id = 87 and of_id in (select sec_obj_id from security where sec_type_id = 493 and ( (sec_usergroup_id = 3278 and sec_usergroup_type_id = 230) or (sec_usergroup_id in (select ug_gi_id from user_group where ug_ui_id = 3278) and sec_usergroup_type_id = 231) ) ) and of_usage_type_id = 131 ) and obj_id not in (select sec_obj_id from security where sec_type_id = 494) )

    Read the article

  • Writing a VM - well formed bytecode?

    - by David Titarenco
    Hi, I'm writing a virtual machine in C just for fun. Lame, I know, but luckily I'm on SO so hopefully no one will make fun :) I wrote a really quick'n'dirty VM that reads lines of (my own) ASM and does stuff. Right now, I only have 3 instructions: add, jmp, end. All is well and it's actually pretty cool being able to feed lines (doing it something like write_line(&prog[1], "jmp", regA, regB, 0); and then running the program: while (machine.code_pointer <= BOUNDS && DONE != true) { run_line(&prog[machine.cp]); } I'm using an opcode lookup table (which may not be efficient but it's elegant) in C and everything seems to be working OK. My question is more of a "best practices" question but I do think there's a correct answer to it. I'm making the VM able to read binary files (storing bytes in unsigned char[]) and execute bytecode. My question is: is it the VM's job to make sure the bytecode is well formed or is it just the compiler's job to make sure the binary file it spits out is well formed? I only ask this because what would happen if someone would edit a binary file and screw stuff up (delete arbitrary parts of it, etc). Clearly, the program would be buggy and probably not functional. Is this even the VM's problem? I'm sure that people much smarter than me have figured out solutions to these problems, I'm just curious what they are!

    Read the article

  • Count the no of LI then add class to parent UL.

    - by Wazdesign
    <ul class="taglib-ratings thumbs"> <li id="qezr_yourRating"> <a href="javascript:;" class="rating rate-up "></a> </li> </ul> <ul class="taglib-ratings thumbs"> <li id="qezr_yourRating"> <a href="javascript:;" class="rating rate-up "></a> </li> <li id="qezr_yourRating"> <a href="javascript:;" class="rating rate-up "></a> </li> </ul> I want to apply the class to the UL on base of the Count of the Inner LIs. Like if it has two LI then the class should be like two-thumbs Like if it has one LI then the class should be like one-thumbs I am trying this JS but not working it returns 2 jQuery(document).ready(function(){ var countLi = $(".taglib-ratings > li").size(); alert(countLi); if(countLi == 2) { $(this).parent('.taglib-ratings').addClass('2-col'); alert ('this ul has 2 li'); } else if(countLi == 1) { $(this).parent('.taglib-ratings').addClass('2-col'); alert ('this ul has 1 li'); } else if(countLi > 2) { alert ('this ul has'+ countLi +' li'); } }); Here is the JSbin link to the same. http://jsbin.com/ofeda/edit

    Read the article

  • Concept of WNDCLASSEX, good programming habits and WndProc for system classes

    - by luiscubal
    I understand that the Windows API uses "classes", relying to the WNDCLASS/WNDCLASSEX structures. I have successfully gone through windows API Hello World applications and understand that this class is used by our own windows, but also by Windows core controls, such as "EDIT", "BUTTON", etc. I also understand that it is somehow related to WndProc(it allows me to define a function for it) Although I can find documentation about this class, I can't find anything explaining the concept. So far, the only thing I found about it was this: A Window Class has NOTHING to do with C++ classes. Which really doesn't help(it tells me what it isn't but doesn't tellme what it is). In fact, this only confuses me more, since I'd be tempted to associate WNDCLASSEX to C++ classes and think that "WNDCLASSEX" represents a control type . So, my first question is What is it? In second place, I understand that one can define a WndProc in a class. However, a window can also get messages from the child controls(or windows, or whatever they are called in the Windows API). How can this be? Finally, when is it a good programming practise to define a new class? Per application(for the main frame), per frame, one per control I define(if I create my own progress bar class, for example)? I know Java/Swing, C#/Windows.Form, C/GTK+ and C++/wxWidgets, so I'll probably understand comparisons with these toolkits.

    Read the article

  • File descriptor limits and default stack sizes

    - by Charles
    Where I work we build and distribute a library and a couple complex programs built on that library. All code is written in C and is available on most 'standard' systems like Windows, Linux, Aix, Solaris, Darwin. I started in the QA department and while running tests recently I have been reminded several times that I need to remember to set the file descriptor limits and default stack sizes higher or bad things will happen. This is particularly the case with Solaris and now Darwin. Now this is very strange to me because I am a believer in 0 required environment fiddling to make a product work. So I am wondering if there are times where this sort of requirement is a necessary evil, or if we are doing something wrong. Edit: Great comments that describe the problem and a little background. However I do not believe I worded the question well enough. Currently, we require customers, and hence, us the testers, to set these limits before running our code. We do not do this programatically. And this is not a situation where they MIGHT run out, under normal load our programs WILL run out and seg fault. So rewording the question, is requiring the customer to change these ulimit values to run our software to be expected on some platforms, ie, Solaris, Aix, or are we as a company making it to difficult for these users to get going? Bounty: I added a bounty to hopefully get a little more information on what other companies are doing to manage these limits. Can you set these pragmatically? Should we? Should our programs even be hitting these limits or could this be a sign that things might be a bit messy under the covers? That is really what I want to know, as a perfectionist a seemingly dirty program really bugs me.

    Read the article

  • Loading specific icon size into TIcon from stream (Delphi XE)

    - by moodforaday
    My application downloads and displays favicons for specific websites. I followed Bing's solution for detecting image format from stream, but have hit another snag. Assuming an actual icon image, the code goes like this: var icon : TIcon; begin icon := TIcon.Create; try icon.LoadFromStream( faviconStream ); spFavicon.Glyph.Assign( icon ); finally icon.Free; end; end; (spFavicon is TRzGlyphStatus from Raize Components. Its Glyph property is a TBitmap) Now, this works, but sometimes the downloaded icon contains multiple images in different sizes, e.g. 32x32 in addition to the expected 16x16. For some reason the control's Glyph property picks the larger size. How can I load only the 16x16 size into TIcon, or from TIcon into TBitmap? Test favicon: http://www.kpfa.org/favicon.ico On edit: If at all possible, I'd rather avoid saving the icon to a file first.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • PHP header redirection does not reload <iframe> in IE

    - by Marco Demaio
    When displaying data from DB usually I'm in this situation I'm in page A.php that shows data from DB, user performs some action (like edit/delete etc) and page B.php is loaded to perform the action, once page B performed the action, it redirects browser to page A, page A is auto reloaded during step (3) therefor it shows an updated situation of the data In order to make page B to redirect to page A i use a simple PHP header("Location: " . "A.php", TRUE, 302); This works well in all situations, except when pages A.php is displaied into an <iframe>: in such a case it does not reload (step 4 does not get done). This seems to happen only in IE7 (don't know about IE8), it works perfectly on FF/Safari. And only when using an <iframe>, if page A.php is not in <iframe> it gest refreshed also in IE7. In order to solve this I simply added a couple of headers in page A.php to set it to not be cached: header("Cache-Control: no-cache, must-revalidate"); // HTTP/1.1 header("Expires: Sat, 26 Jul 1997 05:00:00 GMT"); // Date in the past But I was curious if you might have experienced the same issue too in the past, and if you good give me some advice about this?

    Read the article

  • Create a model that switches between two different states using Temporal Logic?

    - by NLed
    Im trying to design a model that can manage different requests for different water sources. Platform : MAC OSX, using latest Python with TuLip module installed. For example, Definitions : Two water sources : w1 and w2 3 different requests : r1,r2,and r3 - Specifications : Water 1 (w1) is preferred, but w2 will be used if w1 unavailable. Water 2 is only used if w1 is depleted. r1 has the maximum priority. If all entities request simultaneously, r1's supply must not fall below 50%. - The water sources are not discrete but rather continuous, this will increase the difficulty of creating the model. I can do a crude discretization for the water levels but I prefer finding a model for the continuous state first. So how do I start doing that ? Some of my thoughts : Create a matrix W where w1,w2 ? W Create a matrix R where r1,r2,r3 ? R or leave all variables singular without putting them in a matrix I'm not an expert in coding so that's why I need help. Not sure what is the best way to start tackling this problem. I am only interested in the model, or a code sample of how can this be put together. edit Now imagine I do a crude discretization of the water sources to have w1=[0...4] and w2=[0...4] for 0, 25, 50, 75,100 percent respectively. == means implies Usage of water sources : if w1[0]==w2[4] -- meaning if water source 1 has 0%, then use 100% of water source 2 etc if w1[1]==w2[3] if w1[2]==w2[2] if w1[3]==w2[1] if w1[4]==w2[0] r1=r2=r3=[0,1] -- 0 means request OFF and 1 means request ON Now what model can be designed that will give each request 100% water depending on the values of w1 and w2 (w1 and w2 values are uncontrollable so cannot define specific value, but 0...4 is used for simplicity )

    Read the article

  • confluence experiences?

    - by Nickolay
    We're considering moving from trac to Atlassian Confluence as our knowledge base solution. ("We" are a growing IT consulting company, so most users are somewhat technical.) There are many reasons we're looking for an alternative to trac: ACL, better wiki refactoring tools (Move/rename, Delete (retaining history), What links here, Attachments [change tracking], easier way to track changes (i.e. better "timeline" interface), etc.), "templates"/"macros", WYSIWYG/Word integration. Confluence looks to be very nice from the feature list POV. But toying with it for a little I had the impression that its interface may seem somewhat confusing to the new users (and I recently saw a comment to that effect on SO). I hope that can be fixed by installing/creating a simpler skin, though. If you've used Confluence, what are your thoughts on it? Do you agree it's not as easy to use as other software, can anything be done about it? What are its other shortcomings? Would you choose a different wiki if you had another chance? [edit] my own experiences

    Read the article

  • Building a custom Linux Live CD

    - by Mike Heinz
    Can anyone point me to a good tutorial on creating a bootable Linux CD from scratch? I need help with a fairly specialized problem: my firm sells an expansion card that requires custom firmware. Currently we use an extremely old live CD image of RH7.2 that we update with current firmware. Manufacturing puts the cards in a machine, boots off the CD, the CD writes the firmware, they power off and pull the cards. Because of this cycle, it's essential that the CD boot and shut down as quickly as possible. The problem is that with the next generation of cards, I have to update the CD to a 2.6 kernel. It's easy enough to acquire a pre-existing live CD - but those all are designed for showing off Linux on the desktop - which means they take forever to boot. Can anyone fix me up with a current How-To? Update: So, just as a final update for anyone reading this later - the tool I ended up using was "livecd-creator". My reason for choosing this tool was that it is available for RedHat-based distributions like CentOs, Fedora and RHEL - which are all distributions that my company supports already. In addition, while the project is very poorly documented it is extremely customizable. I was able to create a minimal LiveCD and edit the boot sequence so that it booted directly into the firmware updater instead of a bash shell. The whole job would have only taken an hour or two if there had been a README explaining the configuration file!

    Read the article

  • I'm trying to grasp the concept of creating a program that uses a SQL Server database, but I'm used

    - by Sergio Tapia
    How can I make a program use a SQL Server database, and have that program work on whatever computer it's installed on. If you've been following my string of questions today, you'd know that I'm making an open source and free Help Desk suite for small and medium businesses. The client application. The client application is a Windows Forms app. On installation and first launch on every client machine, it'll ask for the address of the main Help Desk server. The server. Here I plan to handle all incoming help requests, show them to the IT guys, and provide WCF services for the Client application to consume. My dilemma lies in that, I know how to make the program run on my local machine; but I'm really stumped on how to make this work for everyone who wants to download and install the server bit on their Windows Server. Would I have to make an SQL Script and have it run on the MS SQL server when a user wants to install the 'server' application? Many thanks to all for your valuable time and effort to teach me. It's really really appreciated. :) Edit: To clarify, each business will have their server completely separate from me. I will have no access whatsoever to them nor will they be in any way connected to me. (I don't know why I should clarify this :P ) So, assuming the have ABSOLUTELY NO DATABASE SERVER installed; what can I do?

    Read the article

  • rspec and ruby 1.9.1: problem with dummy controller and routes

    - by giorgian
    I want to test a module that basically executes some verify statements, to ensure that actions are invoked with the correct method. # /lib/rest_verification.rb module RestVerification def self.included(base) # :nodoc: base.extend(ClassMethods) end module ClassMethods def verify_rest_actions verify :method => :post, :only => [:create], :redirect_to => { :action => :new } ... end end end I tried this: describe RestVerification do class FooController < ActionController::Base include RestVerification verify_rest_actions def new ; end def index ; end def create ; end def edit ; end def update ; end def destroy ; end end # controller_name 'foo' # this only works with ruby 1.8.7 : 1.9.1 says "uninitialized constant FooController" tests FooController # this works with both before(:each) do ActionController::Routing::Routes.draw do |map| map.resources :foo end end after(:each) do ActionController::Routing::Routes.reload! end it ':create should redirect to :new if invoked with wrong verb' do [:get, :put, :delete].each do |verb| send verb, :create response.should redirect_to(new_foo_url) end end ... end When testing: $ ruby -v ruby 1.8.7 (2010-01-10 patchlevel 249) [i486-linux] $ rake RestVerification :create should redirect to :new if invoked with wrong verb Finished in 0.175586 seconds $ rvm use 1.9.1 Using ruby 1.9.1 p378 $ rake RestVerification :create should redirect to :new if invoked with wrong verb (FAILED - 1) 1) 'RestVerification :create should redirect to :new if invoked with wrong verb' FAILED expected redirect to "http://test.host/foo/new", got redirect to "http://test.host/spec/rails/example/controller_example_group/subclass_1/foo/new" Is this a known issue? Is there a workaround?

    Read the article

  • 60K+ Sprites on the 360?

    - by Jeffrey Kern
    Hey everyone, Just wondering - throwing ideas in my head - about starting a new XNA project for the 360. I would like it to be retro-old school, and emulating scanlines and color palettes and such. As part of this idea, what I would ideally like to do is manually draw each and every pixel of the screen. So, worst-case scenario I would have to draw about 60K sprites on a 252x240 resolution (I think thats correct). 60K sprites on the screen at a time. So, before I even attempt to code this - would the XBOX 360 be able to keep up with this even? That is a lot of sprites, but they aren't big sprites, and the texture data needed would be non-existant. However, I guess how this project would be implemented would make it or break it, but all I was thinking was coming up with a 2D array and mapping which color value would need to be drawn at that point. Of course, this is watered down talk right now. But what you all suggest? EDIT: Each sprite would represent one pixel. E.g., a sprite at 0,0. Another at 0,1. etc.

    Read the article

  • How to use Nhibernate Validator + NHib component + ddl

    - by mynkow
    I just configured my NHibValidator. My NHibernate creates the DB schema. When I set MaxLenght="20" to some property of a class then in the database the length appears in the database column. I am doing this in the NHibValidator xml file. But the problem is that I have components and cannot figure out how to achieve this behaviour. The component is configured correctly in the Customer.hbm.xml file. EDIT: Well, I found that Hibernate Validator users had the same problem two years ago. http://opensource.atlassian.com/projects/hibernate/browse/HV-25 Is this an issue for NHibernate Validator or it is fixed. If it is working tell me how please. ----------------------------------------------------- public class Customer { public virtual string Name{get;set;} public virtual Contact Contacts{ get; } } ----------------------------------------------------- public class Contact { public virtual string Address{get;set;} } ----------------------------------------------------- <?xml version="1.0" encoding="utf-8" ?> <nhv-mapping xmlns="urn:nhibernate-validator-1.0" namespace="MyNamespace" assembly="MyAssembly"> <class name="Customer"> <property name="Name"> <length max="20"/> </property> <property name="Contacts"> <notNull/> <valid/> </property> </class> </nhv-mapping> ----------------------------------------------------- <?xml version="1.0" encoding="utf-8" ?> <nhv-mapping xmlns="urn:nhibernate-validator-1.0" namespace="MyNamespace" assembly="MyAssembly"> <class name="Contact"> <property name="Address"> <length max="50"/> <valid/> </property> </class> </nhv-mapping> -----------------------------------------------------

    Read the article

  • Intermittent bug - IE6 showing file as text in browser, rather than as file download

    - by Richard Ev
    In an ASP.NET WebForms 2.0 site we are encountering an intermittent bug in IE6 whereby a file download attempt results in the contents of the being shown directly in the browser as text, rather than the file save dialog being displayed. Our application allows the user to download both PDF and CSV files. The code we're using is: HttpResponse response = HttpContext.Current.Response; response.Clear(); response.AddHeader("Content-Disposition", "attachment;filename=\"theFilename.pdf\""); response.ContentType = "application/pdf"; response.BinaryWrite(MethodThatReturnsFileContents()); response.End(); This is called from the code-behind click event handler of a button server control. Where are we going wrong with this approach? Edit Following James' answer to this posting, the code I'm using now looks like this: HttpResponse response = HttpContext.Current.Response; response.ClearHeaders(); // Setting cache to NoCache was recommended, but doing so results in a security // warning in IE6 //response.Cache.SetCacheability(HttpCacheability.NoCache); response.AppendHeader("Content-Disposition", "attachment; filename=\"theFilename.pdf\""); response.ContentType = "application/pdf"; response.BinaryWrite(MethodThatReturnsFileContents()); response.Flush(); response.End(); However, I don't believe that any of the changes made will fix the issue.

    Read the article

  • Why is debugging better in an IDE?

    - by Bill Karwin
    I've been a software developer for over twenty years, programming in C, Perl, SQL, Java, PHP, JavaScript, and recently Python. I've never had a problem I could not debug using some careful thought, and well-placed debugging print statements. I respect that many people say that my techniques are primitive, and using a real debugger in an IDE is much better. Yet from my observation, IDE users don't appear to debug faster or more successfully than I can, using my stone knives and bear skins. I'm sincerely open to learning the right tools, I've just never been shown a compelling advantage to using visual debuggers. Moreover, I have never read a tutorial or book that showed how to debug effectively using an IDE, beyond the basics of how to set breakpoints and display the contents of variables. What am I missing? What makes IDE debugging tools so much more effective than thoughtful use of diagnostic print statements? Can you suggest resources (tutorials, books, screencasts) that show the finer techniques of IDE debugging? Sweet answers! Thanks much to everyone for taking the time. Very illuminating. I voted up many, and voted none down. Some notable points: Debuggers can help me do ad hoc inspection or alteration of variables, code, or any other aspect of the runtime environment, whereas manual debugging requires me to stop, edit, and re-execute the application (possibly requiring recompilation). Debuggers can attach to a running process or use a crash dump, whereas with manual debugging, "steps to reproduce" a defect are necessary. Debuggers can display complex data structures, multi-threaded environments, or full runtime stacks easily and in a more readable manner. Debuggers offer many ways to reduce the time and repetitive work to do almost any debugging tasks. Visual debuggers and console debuggers are both useful, and have many features in common. A visual debugger integrated into an IDE also gives you convenient access to smart editing and all the other features of the IDE, in a single integrated development environment (hence the name).

    Read the article

  • jQuery UI sortable - sorting images

    - by GSTAR
    I've just implemented the jQuery UI sortable plugin for a set of images. The markup I have is as follows: <ul id="images" class="ui-sortable"> <li id="7884029"><img src="/images/member/4698568/7884029_t.jpg" alt="" /></li> <li id="7379458"><img src="/images/member/4698568/7379458_t.jpg" alt="" /></li> <li id="1704208"><img src="/images/member/4698568/1704208_t.jpg" alt="" /></li> <li id="1750715"><img src="/images/member/4698568/1750715_t.jpg" alt="" /></li> <li id="4364912"><img src="/images/member/4698568/4364912_t.png" alt="" /></li> </ul> <script type="text/javascript"> /*<![CDATA[*/ jQuery(function($) { jQuery('#images').sortable({'delay':'100'}); }); /*]]>*/ </script> The LI id is the 'name' column in the DB table - I prefer not to display the ID column. Now my question is how do I capture the sorting? I understand this would be an AJAX request but I have no idea how to do it. I have set up a sort_order column in my DB table and I am using PHP as my scripting language. I could do with a code example. EDIT: Ideally I prefer if the sort order is applied upon moving an item, i.e. I do not want to enclose it all in a form.

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • Threshold of blurry image - part 2

    - by 1''
    How can I threshold this blurry image to make the digits as clear as possible? In a previous post, I tried adaptively thresholding a blurry image (left), which resulted in distorted and disconnected digits (right): Since then, I've tried using a morphological closing operation as described in this post to make the brightness of the image uniform: If I adaptively threshold this image, I don't get significantly better results. However, because the brightness is approximately uniform, I can now use an ordinary threshold: This is a lot better than before, but I have two problems: I had to manually choose the threshold value. Although the closing operation results in uniform brightness, the level of brightness might be different for other images. Different parts of the image would do better with slight variations in the threshold level. For instance, the 9 and 7 in the top left come out partially faded and should have a lower threshold, while some of the 6s have fused into 8s and should have a higher threshold. I thought that going back to an adaptive threshold, but with a very large block size (1/9th of the image) would solve both problems. Instead, I end up with a weird "halo effect" where the centre of the image is a lot brighter, but the edges are about the same as the normally-thresholded image: Edit: remi suggested morphologically opening the thresholded image at the top right of this post. This doesn't work too well. Using elliptical kernels, only a 3x3 is small enough to avoid obliterating the image entirely, and even then there are significant breakages in the digits:

    Read the article

  • Type errors when using same name

    - by lykimq
    I have 3 files: 1) cpf0.ml type string = char list type url = string type var = string type name = string type symbol = | Symbol_name of name 2) problem.ml: type symbol = | Ident of string 3) test.ml open Problem;; open Cpf0;; let symbol b = function | Symbol_name n -> Ident n When I combine test.ml: ocamlc -c test.ml. I received an error: This expression has type Cpf0.name = char list but an expression was expected of type string Could you please help me to correct it? Thank you very much EDIT: Thank you for your answer. I want to explain more about these 3 files: Because I am working with extraction in Coq to Ocaml type: cpf0.ml is generated from cpf.v : Require Import String. Definition string := string. Definition name := string. Inductive symbol := | Symbol_name : name -> symbol. The code extraction.v: Set Extraction Optimize. Extraction Language Ocaml. Require ExtrOcamlBasic ExtrOcamlString. Extraction Blacklist cpf list. where ExtrOcamlString I opened: open Cpf0;; in problem.ml, and I got a new problem because in problem.ml they have another definition for type string This expression has type Cpf0.string = char list but an expression was expected of type Util.StrSet.elt = string Here is a definition in util.ml defined type string: module Str = struct type t = string end;; module StrOrd = Ord.Make (Str);; module StrSet = Set.Make (StrOrd);; module StrMap = Map.Make (StrOrd);; let set_add_chk x s = if StrSet.mem x s then failwith (x ^ " already declared") else StrSet.add x s;; I was trying to change t = string to t = char list, but if I do that I have to change a lot of function it depend on (for example: set_add_chk above). Could you please give me a good idea? how I would do in this case.

    Read the article

  • Giving writing permissions for IIS user at Windows 2003 Server

    - by Steve
    I am running a website over Windows 2003 Server and IIS6 and I am having problems to write or delete files in some temporary folder obtaining this kind of warmings: Warning: unlink(C:\Inetpub\wwwroot\cakephp\app\tmp\cache\persistent\myapp_cake_core_cake_): Permission denied in C:\Inetpub\wwwroot\cakephp\lib\Cake\Cache\Engine\FileEngine.php on line 254 I went to the tmp directory and at the properties I gave the IIS User the following permissions: Read & Execute List folder Contents Read And it still showing the same warnings. When I am on the properties window, if I click on Advanced the IIS username appears twice. One with Allow type and read & execute permissions and the other with Deny type and Special permissions. My question is: Should I give this user not only the Read & Execute permissions but also this ones?: Create Attributes Create Files/ Write Data Create Folders/ Append Data Delete Subfolders and Files Delete They are available to select if I Click on the edit button over the username. Wouldn't I be opening a security hole if I do this? Otherwise, how can I do to read and delete the files my website uses? Thanks.

    Read the article

< Previous Page | 615 616 617 618 619 620 621 622 623 624 625 626  | Next Page >