Search Results

Search found 41511 results on 1661 pages for 'via point'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 655/1661 | < Previous Page | 651 652 653 654 655 656 657 658 659 660 661 662  | Next Page >

  • What would you suggest as a high school first language?

    - by ldigas
    Edit by OA: After reading some answers I'll just update the question a little. At first I put it a little bluntly, but some of those gave me some good arguments which have to be taken into consideration while making a stand on this one. (these are mostly picked up from comments and answers below). A few things to take into account: to many pupils this is a first programming language - at this stage most of them have trouble grasping a difference between data types, variable passing, ... and whatnot, less alone pointers and similar 'low level stuff' :) they will all have to pass this to get into next grade (well, big majority of them anyway) not all of them have computers at home, not all of them are willing to learn this, less alone interested in - so the concepts have to be taught on a finite time scale in school hours (as well as practice on computers) free literature is a bonus - the teacher will make some scripts and handaways, but still ... I wouldn't like to bear the parents with the burden of buying expensive literature (also, english is not a native language here ... and although they are all learning it, their ability to read it fluently is somewhat questionable) somebody gave an argument - "a language which does not get in the way of ideas" - good one accessibility on different platforms in not expecially important at this point - although most of the suggested ones are available on win as well as linux - not many macs in this part of europe (their prices are sky high for anything but specialised usage) I will check what are the licencing issues on ms express editions about using it massively in high schools for purposes like this - if someone has any info about this, please, do not be shy with it :) A friend of mine, informatics teacher - in EU it comes as something as junior cs teacher, in a local high school asked me what I thought about what should be the first language pupils should be taught? It is a technical school (a little more oriented towards mathematics than the gymnasium, but not computer oriented totally). So I'm asking you - what do you think should be the first language pupils are exposed to in highschool? They have been teaching Pascal so far, but she's not sure that's a good course. She thought about switching to C (which I resented; considering not all pupils have interests in programming, to start with, and should be taught something higher level since they are just gripping the idea of a loop and such ... for a start), I suggested python or ruby (preferably py since it handles all paradigms). What is your opinion on this one? I looked, but didn't find a similar question on SO, so if there is one, please just point me towards it. Edit: The assumption is that none of the pupils have been exposed to any programming in junior school. See also: What is the best way to teach young kids some basic programming concepts? Best ways to teach a beginner to program How and when do you teach a kid to code What is the easiest language to start with? High School Programming

    Read the article

  • Do Qt Applications require KDE?

    - by Evans
    Do all Qt applications require KDE to be installed? Is it enough if the Qt runtime is installed along with GNOME? Can I make a Qt application look exactly like a GTK application under GNOME? Could anyone please point me to some article detailing the relationship between Qt, GTK, KDE, GNOME, X?

    Read the article

  • markdown to HTML with customised WMD editor

    - by spirytus
    For my application I customized slightly the way WMD behaves so when user enters empty lines, these are reflected in HTML output as <br />'s. Now I came to a point when I should store it somewhere at backend and so after going thru SO posts for a while I'm not sure what is the best way to do it. I have few options and if you could point out which their pros/cons that would be much appreciated. send to server and store as markdown rather than HTML. To me obvious advantage would be keeping exactly same formatting as user originally entered. But then how can I convert it back to HTML for display to a client? It seems very troublesome to convert it on client side as even if it would be possible what would happen if JS would be disabled? If I wanted to do it on the server, then standard server side implementations of markup to HTML might be resource expensive. Would that be an issue in your opinion? Even if it wouldn't be the case then as I mentioned my WMD implementation is customised and those server side solutions wouldn't probably do the right conversion to markdown anyway and there always would be a risk that something would convert wrong. Send to server as converted HTML. Same as above.. conversion on client side would be difficult, server side same with possibility of getting it wrong. send original markdown and converted HTML and store both. No performance issues related to converting markdown to HTML on client side, nor on server side. Users would have always same markdown they originally entered and same HTML they originally saw in preview (possibly sanitized in php though). It would have to take twice that much storage space though and that is my biggest worry. I tend to lean towards 3rd solution as it seems simplest, but there is a worry of doubled storage space needed for this solution. Please bear in mind that my implementation of WMD is slightly modified and also I'm going with PHP/MySql server side implementation. So apart from 3 options I listed above, are there any other possible solutions to my problem? Did I miss anything important that would make one of the options above better then the rest? And what other pros/cons would apply to each solution I listed? Also how is it implemented on SO? I read somwhere that they using option 3, and so if its good enough for SO would be good enough for me :) but not sure if its true anyway, so how is it done? Also please forgive me, but at least for once I got to say that StackOverflow IS THE BEST DAMN RESOURCE ON THE WEB and I truly appreciate all the people trying to help others here! The site and users here are simply amazing!

    Read the article

  • stock trade app help

    - by Rajesh Kumar Chandra
    Ok my last post disapper so I ask again. Ok if you cant send me code to stock trading app, i understand its dificult for to get code from forum can you point me to techonologies to use for making stock app. i got job from online brocker copany, they need to display both bombay exchange and others java, or c . or asp maybe thanks

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Converting JBOSS annotations to xml

    - by sixtyfootersdude
    Good Morning, I was just hoping that someone could point me to a reference that defines about what JBOSS annotations are equivalent to what xml tags. I am particularly interested in these tags: @WebContext in org.jboss.ws.annotation.WebContext and @SecurityDomain in org.jboss.annotation.security.SecurityDomain

    Read the article

  • How to Create Own HashMap in Java?

    - by Taranfx
    I know about hashing algorithm and hashCode() to convert "key" into an equivalent integer (using some mathematically random expression) that is then compressed and stored into buckets. But can someone point me to an implementation or at least data structure that should be used as baseline? I haven't found it anywhere on the web.

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • mysql insert data from multiple select queries

    - by daulex
    What I've got working and it's what I need to improve on: INSERT form_data (id,data_id, email) SELECT fk_form_joiner_id AS data_id, value AS email FROM wp_contactform_submit_data WHERE form_key='your-email' This just gets the emails, now this is great, but not enough as I have a good few different values of form_key that I need to import into different columns, I'm aware that I can do it via php using foreach loops and updates, but this needs to be done purely in mysql. So how do I do something like: insert form_data(id,data,email,name,surname,etc) Select [..],Select [..].... Please help

    Read the article

  • How to speed up/slow down application's 'time'

    - by overboming
    I guess I am not saying it right in the title. What I intend to do is to hook to some system api,like a time interrupt happens every amount of time (which is how every application in the operating system interprets time) and make an application's call to this api return some bigger/smaller result. So from the point view of an applicaiton, time has been speed up or slow down. I have found some application on windows doing this, can anyone gives me some pointers on how to implement this on Mac OS X?

    Read the article

  • Effect of 'myObj = [[[[MyClass alloc] init] autorelease] retain];'?

    - by filipe
    I've just downloaded the Facebook iOS SDK and I noticed that in the sample code that comes with the SDK whenever it creates an instance of the Facebook class it does it like this: _facebook = [[[[Facebook alloc] init] autorelease] retain]; where _facebook is a member variable of the calling object (i.e. not a local variable). Can anyone explain exactly what's the point of autoreleasing and then retaining it?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • f# interactive System.OutOfMemoryException

    - by user343550
    f# interactive throws System.OutOfMemoryException when loading large objects into memory. Exception is thrown at approximately 1.3 gigs. Data set is 2.2 gigs, and loads fine in debugger mode. Using VS2008 with April 2010 CTP This is mostly a java library that is being used via ikvmc, but if that were an issue, it shouldn't be running in the debugger either.

    Read the article

  • C#: Drawing only a portion of a path

    - by John
    I have a series of points in a GraphicsPath; for our purpose lets assume its the outline of an uppercase B. I want to be able to be able to draw only the bottom portion that would resemble an uppercase L. I'd like to be able to select a window of points from the GraphicsPath. Is there a handy way to do this without doing point interpolation?

    Read the article

  • How long can rails keep Ajax open

    - by Alexey
    My application is suppose to constantly update the page without any user interaction. The criteria is that the page just has to be there, as an extra window on the monitor so the user can see the information get updated real time. I'm using the Ajax in jQuery with Rails, and my question is - how long will the .erb page keep Ajax open? Will there be a point where I have to refresh the page or re-initialize? Or will that won't be a problem at all?

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • WPF: How to programmatically utilize the ErrorTemplate of an Control?

    - by geeraija
    Hi, is there a way to programmatically set and remove the ErrorTemplate of an Control without the whole Validation mechanism? Basically, what I'd like to do, is to retrieve the ErrorTemplate of an Control at some point like this: ControlTemplate errTemplate = Validation.GetErrorTemplate(myTxtBx); and temporarily use it as it's ControlTemplate like this: myTxtBx.Template = errTemplate; Can you somehow do this?

    Read the article

  • How to Login Google webmaster tools with XMLHTTP

    - by darkandcold
    Hello, I have tried so many times but I couldn't get it worked. I am trying to log in google webmaster tools to get Search Queries List (top 20) I used XMLHTTP and AspTear, but no action :(. It says "my browser isnt cookie supported" But how can I log in google webmaster tools via xMLHTTP cookied enables? xmlhttp has any parameter about cookie?

    Read the article

  • Get location of object when animation is complete in android

    - by bgm
    Is there a way to find out the final location of my animated "object" after the animation? Let's say I am animating an ImageView with location in parent as (0,0 - 20,20) using TranslateAnimation and ScaleAnimation over 1 second with setFillAfter(true). How to I find the final location of this "object" (since the View location itself does not move)? I need to continue the animation from this point based on an user input.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 651 652 653 654 655 656 657 658 659 660 661 662  | Next Page >