Search Results

Search found 30894 results on 1236 pages for 'best practice'.

Page 668/1236 | < Previous Page | 664 665 666 667 668 669 670 671 672 673 674 675  | Next Page >

  • how to refresh mulitple divs when after posting using jquery

    - by oo
    i have a screen with multiple little widgets (all with different divs around them). i have one form and when i post (using jquery) right now it updates the single form using ajax. i want two other divs to refresh as well (that are outside the form). What is the best way to trigger a refresh of multiple different divs on a single jquery ajax post callback?

    Read the article

  • markdown to HTML with customised WMD editor

    - by spirytus
    For my application I customized slightly the way WMD behaves so when user enters empty lines, these are reflected in HTML output as <br />'s. Now I came to a point when I should store it somewhere at backend and so after going thru SO posts for a while I'm not sure what is the best way to do it. I have few options and if you could point out which their pros/cons that would be much appreciated. send to server and store as markdown rather than HTML. To me obvious advantage would be keeping exactly same formatting as user originally entered. But then how can I convert it back to HTML for display to a client? It seems very troublesome to convert it on client side as even if it would be possible what would happen if JS would be disabled? If I wanted to do it on the server, then standard server side implementations of markup to HTML might be resource expensive. Would that be an issue in your opinion? Even if it wouldn't be the case then as I mentioned my WMD implementation is customised and those server side solutions wouldn't probably do the right conversion to markdown anyway and there always would be a risk that something would convert wrong. Send to server as converted HTML. Same as above.. conversion on client side would be difficult, server side same with possibility of getting it wrong. send original markdown and converted HTML and store both. No performance issues related to converting markdown to HTML on client side, nor on server side. Users would have always same markdown they originally entered and same HTML they originally saw in preview (possibly sanitized in php though). It would have to take twice that much storage space though and that is my biggest worry. I tend to lean towards 3rd solution as it seems simplest, but there is a worry of doubled storage space needed for this solution. Please bear in mind that my implementation of WMD is slightly modified and also I'm going with PHP/MySql server side implementation. So apart from 3 options I listed above, are there any other possible solutions to my problem? Did I miss anything important that would make one of the options above better then the rest? And what other pros/cons would apply to each solution I listed? Also how is it implemented on SO? I read somwhere that they using option 3, and so if its good enough for SO would be good enough for me :) but not sure if its true anyway, so how is it done? Also please forgive me, but at least for once I got to say that StackOverflow IS THE BEST DAMN RESOURCE ON THE WEB and I truly appreciate all the people trying to help others here! The site and users here are simply amazing!

    Read the article

  • Have you read any ASP.NET MVC 2.0 book?

    - by Dan Dumitru
    I'm sorry for asking yet another "best [insert-technology] book". I know a bit of MVC, I want to start a project in MVC 2 and a good book would be really helpful. Usually, after a while, people come to a consensus what are the top 2-3 books for learning a given technology. Have you read any ASP.NET MVC 2.0 book? If so, how was it?

    Read the article

  • HTML - Which element to output text?

    - by Oliver Weiler
    I'm implementing a little chat application where I receive messages from a server, which I would like to display to a user. As I'm more of a backend guy, and lacking experience in frontend development, I don't know which element would be suited best to output the text. Two options come to my mind: Using a plain div Using a textarea (as far as I understand, this is intended to be used for input). (Would also be nice if I could somehow fade in the text using JQuery).

    Read the article

  • Checking OpenGL resource leaks

    - by kamziro
    So I have a rather large openGL program going, and checking for normal memory leaks (those by new and delete) is rather trivial -- just run it on valgrind. But what is the best way to check for potential opengl leaks? Is there an opengl utility that'll tell you how many resources (e.g framebuffers) are being used at the time, or such? Or is the only way to attach a counter to every glGenBlah and glDeleteBlah pairs?

    Read the article

  • ASP.Net Learning

    - by Zorela
    Hi i am trying to build a website usign ASP.NET what is the best resource or way to learn it? Also do i need DotNetNuke or something similar to manage my project? Thanks in advance.

    Read the article

  • Java - Make an object collection friendly

    - by DutrowLLC
    If an object holds a unique primary key, what interfaces does it need to implement in order to be collection friendly especially in terms of being efficiently sortable, hashable, etc...? If the primary key is a string, how are these interfaces best implemented? Thanks!

    Read the article

  • How should I handle the case in which a username is already in use?

    - by idealmachine
    I'm a JavaScript programmer and new to PHP and MySQL (want to get into server-side coding). Because I'm trying to learn PHP by building a simple online game (more specifically, correspondence chess), I'm starting by implementing a simple user accounts system. Of course, user registration comes first. What are the best practices for: How I should handle the (likely) possibility that when a user tries to register, the username he has chosen is already in use, particularly when it comes to function return values?($result === true is rather ugly, and I'm not sure whether checking the MySQL error code is the best way to do it either) How to cleanly handle varying page titles?($gPageTitle = '...'; require_once 'bgsheader.php'; is also rather ugly) Anything else I'm doing wrong? In some ways, PHP is rather different from JavaScript... Here is a (rather large) excerpt of the code I have written so far. Note that this is a work in progress and is missing security checks that I will add as my next step. function addUser( $username, $password ) { global $gDB, $gPasswordSalt; $stmt = $gDB->prepare( 'INSERT INTO user(user_name, user_password, user_registration) VALUES(?, ?, NOW())' ); $stmt || trigger_error( 'Failed to prepare statement: ' . htmlspecialchars( $gDB->error ) ); $hashedPassword = hash_hmac( 'sha256', $password, $gPasswordSalt, true ); $stmt->bind_param( 'ss', $username, $hashedPassword ); if( $stmt->execute() ) { return true; } elseif( $stmt->errno == 1062) { return 'exists'; } else { trigger_error( 'Failed to execute statement: ' . htmlspecialchars( $stmt->error ) ); } } $username = $_REQUEST['username']; $password = $_REQUEST['password']; $result = addUser( $username, $password ); if( $result === true ) { $gPageTitle = 'Registration successful'; require_once 'bgsheader.php'; echo '<p>You have successfully registered as ' . htmlspecialchars( $username ) . ' on this site.</p>'; } elseif( $result == 'exists' ) { $gPageTitle = 'Username already taken'; require_once 'bgsheader.php'; echo '<p>Someone is already using the username you have chosen. Please try using another one instead.'; } else { trigger_error('This should never happen'); } require_once 'bgsfooter.php';

    Read the article

  • Creating SVG map from geometry stored in MySQL

    - by Barnabe
    I have a group of geometries stored in MySQl (as polygon and as well-known text) representing counties. I can build a table of geometries and color codes after querying some county data (say GDP per capita). What is the best way to export this as an SVG map? I cannot find any reference to SVG conversion in the MySQL documentation.

    Read the article

  • compare two following values in numpy array

    - by Billy Mitchell
    What is the best way to touch two following values in an numpy array? example: npdata = np.array([13,15,20,25]) for i in range( len(npdata) ): print npdata[i] - npdata[i+1] this looks really messed up and additionally needs exception code for the last iteration of the loop. any ideas? Thanks!

    Read the article

  • Get notification when NSOperationQueue finishes all tasks

    - by porneL
    NSOperationQueue has waitUntilAllOperationsAreFinished, but I don't want to wait synchronously for it. I just want to hide progress indicator in UI when queue finishes. What's the best way to accomplish this? I can't send notifications from my NSOperations, because I don't know which one is going to be last, and [queue operations] might not be empty yet (or worse - repopulated) when notification is received.

    Read the article

  • How do I generate a custom SID?

    - by Max Schmeling
    I need to generate custom SIDs for users in my web application for use with Microsoft AzMan. What is the best way to do this? What do I need to know before doing this? This is what I'm thinking, but I'm not sure if I'm missing something: S-1-9-1234-{user_id + 1000} S-{first revision}-{resource manager authority}-{domain (unique number for the specific app)}-{unique id for user} UPDATE: Changed to resource manager authority because of David Crawford's blog entry: http://blogs.msdn.com/dc995/archive/2006/08/23/715021.aspx

    Read the article

  • Tuples vs. Anonymous Types vs. Expando object. (in regards to LINQ queries)

    - by punkouter
    I am a beginner who finally started understanding anonymous types. (see old post http://stackoverflow.com/questions/3010147/what-is-the-return-type-for-a-anonymous-linq-query-select-what-is-the-best-way-t) So in LINQ queries you form the type of return value you want within the linq query right? It seems the way to do this is anonymous type right? Can someone explain to me if and when I could use a Tuple/Expando object instead? They all seem very simliar?

    Read the article

  • Copying a byte buffer with JNI

    - by Daniel
    I've found plenty of tutorials / questions on Stackoverflow that deal with copying char arrays from C/JNI side into something like a byte[] in Java, but not the other way around. I am using a native C library which expects a byte array. I simply want to get data from a byte[] in java, into preferably an unsigned char[] in C. Long story short: What is the best way of copying data from a jBytearray in JNI? Is there any way to detect it's size?

    Read the article

  • IE layers issue when dtd with doctype tag is not added

    - by keshav.veerapaneni
    Hello colleagues, I am facing a very strange issue because of which when i do not add the below line to the html the layers(z-index) is not working. <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"; "_http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> Please let me know if you are aware of the issue and how to get layers working without adding this tag. Best Regards, Keshav

    Read the article

  • Good looking programs that use wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • Jquery date in a dropdown with interval

    - by Zoom Pat
    I am trying to use Jquery to display dates in a dropdown with interval of half month... so the first value would be the coming month's 1st, then second will be the coming month's 15th and third value would be next to next month's first and so on... If today date is less than 15th then the first value would be the 15th of current month. What will be the best or a cleaner way to do this... (want to display in the dropdown) Thanks

    Read the article

  • Defining a class with specific style dynamically in jQuery

    - by Acorn
    Is it possible to define a class with specific style attributes dynamically with jQuery, rather than setting the style of all elements with that class? I could set the attributes of the class at the end of the script once all the elements have been created, but is that the best way to go about it? If I define the style of the class with $('.class').css('property','value'); at the beginning of the script, nothing would happen because the elements with class .class haven't been created yet, right?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to design a command line program reusable for a future development of a GUI?

    - by systempuntoout
    What are some best practices to keep in mind when developing a script program that could be integrated with a GUI, probably by somebody else, in the future? Possible scenario: i develop a fancy python CLI program that scrapes every unicorn images from the web i decide to publish it on github a unicorn fan programmer decides to take the sources and build a GUI on them. he\she gives up because my code is not reusable How do i avoid step four and let unicorn fan programmer build his\her GUI without hassle?

    Read the article

< Previous Page | 664 665 666 667 668 669 670 671 672 673 674 675  | Next Page >