Search Results

Search found 30894 results on 1236 pages for 'best practice'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 669/1236 | < Previous Page | 665 666 667 668 669 670 671 672 673 674 675 676  | Next Page >

  • Good looking programs that use wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • asp.net Web Template

    - by Zorela
    I am trying to build a web site using asp.net, so since i an not very good on the design part. I am wondering where is the best site to get a good template for my web site.

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • mvc redirect after delay

    - by gre3ns0ul
    Hi guys, I'm recently new in MVC technology and i'm with a difficult I have a UI to create a user, and when i submit the content and all content is valid i pass a message into Viewdata["INFO"] and return a View called Info with Viewdata Informing than the usar was sucefully created. But in this moment i want to Regist a some script than, after a one delay specified the client redirects automatically to the base page "Users". Any ideas to get the best way to do it?

    Read the article

  • Setup filename convention? setup.exe vs install.exe vs others

    - by www.openidfrance.frfxkim
    Hi, I'm going to build an installer to deploy my application which is a Windows executable file(not a MSI file). I'm using NSIS. This application targets French people and "install" word is close to "installation" in French. Is there a filename convention? What is the best choice for you? It seems that "setup.exe" is the most popular name compare to "install.exe" What do you think? Thanks for your reply.

    Read the article

  • How can I memoize a method that may return true or false in Ruby?

    - by Seamus Abshere
    Obviously ||= won't work def x? @x_query ||= expensive_way_to_calculate_x end because if it turns out to be false, then expensive_way_to_calculate_x will get run over and over. Currently the best way I know is to put the memoized true or false into an Array: def x? return @x_query.first if @x_query.is_a?(Array) @x_query = [expensive_way_to_calculate_x] @x_query.first end Is there a more conventional or efficient way of doing this?

    Read the article

  • Get notification when NSOperationQueue finishes all tasks

    - by porneL
    NSOperationQueue has waitUntilAllOperationsAreFinished, but I don't want to wait synchronously for it. I just want to hide progress indicator in UI when queue finishes. What's the best way to accomplish this? I can't send notifications from my NSOperations, because I don't know which one is going to be last, and [queue operations] might not be empty yet (or worse - repopulated) when notification is received.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Sort a list of dicts by dict values

    - by ensnare
    I have a list of dictionaries: [{'title':'New York Times', 'title_url':'New_York_Times','id':4}, {'title':'USA Today','title_url':'USA_Today','id':6}, {'title':'Apple News','title_url':'Apple_News','id':2}] I'd like to sort it by the title, so elements with A go before Z: [{'title':'Apple News','title_url':'Apple_News','id':2}, {'title':'New York Times', 'title_url':'New_York_Times','id':4}, {'title':'USA Today','title_url':'USA_Today','id':6}] What's the best way to do this? Also, is there a way to ensure the order of each dictionary key stays constant, e.g., always title, title_url, then id? Thank you.

    Read the article

  • Getting RAW Soap Data from a Web Reference Client running in ASP.net

    - by Harry
    I'm trying to trouble shoot a web service client in my current project. I'm not sure of the platform of the Service Server (Most likely LAMP). I believe there is a fault on their side of the fence as i have eliminated the potential issues with my client. The client is a standard ASMX type web reference proxy auto generated from the service WSDL. What I need to get to is the RAW SOAP Messages (Request and Responses) What is the best way to go about this?

    Read the article

  • Duplicate conflicting frameworks in cocoa plug-ins

    - by Carmen
    I am currently writing a plug-in framework for my application. I would like to be able to release plugins without having to update my application, and I intend on making the framework available for third party plugins. I am currently running into issues when two plugins ship with identical frameworks. When the plugins are loaded the runtime gets confused because the framework gets loaded twice. What is the best way to mitigate this issue?

    Read the article

  • Azure scalability over XML File

    - by dayscott
    What is the best practise solution for programmaticaly changing the XML file where the number of instances are definied ? I know that this is somehow possible with this csmanage.exe for the Windows Azure API. How can i measure which Worker Role VMs are actually working? I asked this question on MSDN Community forums as well: http://social.msdn.microsoft.com/Forums/en-US/windowsazure/thread/02ae7321-11df-45a7-95d1-bfea402c5db1

    Read the article

  • Encryption messages in a queue between 2 dlls.

    - by scope-creep
    Hi, I'm sending messages between 1 dll and another, effectively posting messages onto the dll input queue and receiving a messages back from the dll output queue. These two dlls are very tightly integrated. DLL 1 is a producer,and DLL2 is the consumer. I want to encrypt the messages before they are sent. What would be the best approach? Any help would be appreciated.

    Read the article

  • Need to place a floating modeless form over excel main window (quasi-task pane)

    - by code4life
    Hi I need to emulate a task pane by floating a modeless form over the Excel main window. The reason for this requirement is that I need to have taskpane features for my Excel 2003 add-in, but cannot use the document-centric model. Can anyone suggest what would be the best way to do this? The modeless form would need to detect the main window resize event and resize itself accordingly, and also need to always position itself at the bottom of the window (kind of like a docking pane).

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 665 666 667 668 669 670 671 672 673 674 675 676  | Next Page >