Search Results

Search found 2551 results on 103 pages for 'sequence'.

Page 72/103 | < Previous Page | 68 69 70 71 72 73 74 75 76 77 78 79  | Next Page >

  • How to dispatch a multimethod on the type of an array

    - by Arthur Ulfeldt
    I'm working on a multimethod that needs to update a hash for a bunch of different things in a sequence. Looked fairly straitforward until I tried to enter the 'type of an array of X'. (defmulti update-hash #(class %2)) (type (byte 1)) => java.lang.Byte (defmethod update-hash java.lang.Byte [md byte] (. md update byte)) (type (into-array [ (byte 1)])) => [Ljava.lang.Byte; (defmethod update-hash < WHAT GOES HERE > [md byte]

    Read the article

  • some thing wrong with memory?

    - by Rocker
    Hi there I am developing a game using Cocos2D. I got some error out of sudden after few time successfully played the game. And When i debugged it gives the error called EXC_BAD_ACCESS. here is the code. -(void) winGame { //the debug stopped here... WinningScene *winner = [WinningScene node]; [[Director sharedDirector] replaceScene:[FadeTransition transitionWithDuration:1.0 scene:winner]]; } if ((touchCount > 0 && touchCount ==2) && (rangeY2 > 0.0 && rangeY2 < 20.0)) { bras++; if (bras == 1) { //[self winGame]; [self runAction:[Sequence actionOne:[DelayTime actionWithDuration:0.5] two: [CallFunc actionWithTarget:self selector:@selector(winGame)]]]; } Could u guys tell me why ?

    Read the article

  • Flex: -frames.frame

    - by Michael Brewer-Davis
    Has anyone used this successfully or found further documentation than just the below (from the Adobe site): frames.frame label class_name [...] Specifies a SWF file frame label with a sequence of class names that are linked onto the frame. This option lets you add asset factories that stream in after the application that then publish their interfaces with the ModuleManager class. The advantage to doing this is that the application starts faster than it would have if the assets had been included in the code, but does not require moving the assets to an external SWF file. This is an advanced option.

    Read the article

  • GetWindowLongPtr fails if called when handling WM_CREATE

    - by Semen Semenych
    Calling the GetWindowLongPtr function for a dialog box with the DWL_USER parameter fails when done from the WM_CREATE handler. It gives no error (checked that, the return value is always zero), which, according to the MSDN documentation, occurs only if SetWindowLongPtr has not been called previously. However, I call it after registering the window class, and properly call the SetWindowPos after that. Finally, calling GetWindowLongPtr in any other event handler, that is, later than WM_CREATE, works fine. Is there something I'm missing in the initialization sequence, or maybe the messages are sent in some not so obvious order?

    Read the article

  • Regex to find a word, then extract a line containing the first occurence of a different word immedia

    - by Hinchy
    World's most convuluted title I know, an example should explain it better. I have a large txt file in the below format, though details and amount of lines will change everytime: Username: john_joe Owner: John Joe Account: CLI: Default: LGICMD: Flags: Primary days: Secondary days: No access restrictions Expiration: Pwdlifetime: Last Login: Maxjobs: Maxacctjobs: Maxdetach: Prclm: Prio: Queprio: CPU: Authorized Privileges: BYPASS Default Privileges: SYSPRV This sequence is repeated a couple of thousand times for different users. I need to find every user (ideally the entire first line of the above) that has SYSPRV under "Default Permissions". I know I could write an application to do this, I was just hoping their might be a nice regex I could use. Cheers

    Read the article

  • Mixing LINQ to SQL with properties of objects in a generic list

    - by BPotocki
    I am trying to accomplish something like this query: var query = from a in DatabaseTable where listOfObjects.Any(x => x.Id == a.Id) select a; Basically, I want to filter the results where a.Id equals a property of one of the objects in the generic list "listOfObjects". I'm getting the error "Local sequence cannot be used in LINQ to SQL implementation of query operators except the Contains() operator." Any ideas on how to filter this in an easily readable way using "contains" or another method? Thanks in advance.

    Read the article

  • In an If-Else Statement for a method return, should an Else be explicitly stated if it can instead b

    - by ccomet
    I have a method that checks certain things and returns a Boolean based on those checks. It involves a single branching If section that checks about 5 conditions in sequence. If any of those conditions return true, then the method will return true;. If none of the conditions return true, then the method will return false;. Since the code after the If section will only run if none of the conditions are true, then that code is logically identical to including an actual Else statement. So is it a better idea to actually write in the Else statement for this kind of situation?

    Read the article

  • What is the logic behind defining macros inside a struct?

    - by systemsfault
    As apparent in the title, I'm questioning the reason behind defining the macros inside a struct. I frequently see this approach in network programming for instance following snippet: struct sniff_tcp { u_short th_sport; /* source port */ u_short th_dport; /* destination port */ tcp_seq th_seq; /* sequence number */ tcp_seq th_ack; /* acknowledgement number */ u_char th_offx2; /* data offset, rsvd */ #define TH_OFF(th) (((th)->th_offx2 & 0xf0) >> 4) u_char th_flags; #define TH_FIN 0x01 #define TH_SYN 0x02 #define TH_RST 0x04 #define TH_PUSH 0x08 #define TH_ACK 0x10 #define TH_URG 0x20 #define TH_ECE 0x40 #define TH_CWR 0x80 #define TH_FLAGS (TH_FIN|TH_SYN|TH_RST|TH_ACK|TH_URG|TH_ECE|TH_CWR) u_short th_win; /* window */ u_short th_sum; /* checksum */ u_short th_urp; /* urgent pointer */ }; This example is from sniffex.c code in tcpdump's web site. Is this for enhancing readability and making code clearer.

    Read the article

  • "Othello" game needs some clarification

    - by pappu
    I am trying to see if my understanding of "othello" fame is correct or not. According to the rules, we flip the dark/light sides if we get some sequence like X000X = XXXXX. The question I have is if in the process of flipping 0-X or X- 0, do we also need to consider the rows/columns/diagonals of newly flipped elements? e.g. consider board state as shown in above image(New element X is placed @ 2,3) When we update board, we mark elements from 2,3 to 6,3 as Xs but in this process elements like horizontal 4,3 to 4,5 and diagonal 2,3 to 4,5 are also eligible for update? so do we update those elements as well? or just the elements which have starting as 2,3 (i.e update rows/column/diagonal whose starting point is the element we are dealing with, in our case 2,3?) Please help me understand it

    Read the article

  • How do I read UTF-8 characters via a pointer?

    - by Jen
    Suppose I have UTF-8 content stored in memory, how do I read the characters using a pointer? I presume I need to watch for the 8th bit indicating a multi-byte character, but how exactly do I turn the sequence into a valid Unicode character? Also, is wchar_t the proper type to store a single Unicode character? This is what I have in mind: wchar_t readNextChar (char** p) { char ch = *p++; if (ch & 128) { // This is a multi-byte character, what do I do now? // char chNext = *p++; // ... but how do I assemble the Unicode character? ... } ... }

    Read the article

  • Need generated UML diagrams for C++ plugin modules

    - by archer1742
    I need various UML diagrams (sequence/collaboration, class, package, and system component) from some C++ files. However, these files are plugins in a larger programming framework. I have tried generating UML from Rational Rose 7 (2002 version), but I am not very experienced and I am unsure if RR simply cannot produce the diagram, I am doing something wrong, or the diagrams are not rendering correctly because the source files are plugins instead of standalone programs. I have also tried Star Modeler with little success and there seem to be no tutorials on how to generate these models. Is there a simple, bulletproof way to get UML diagrams for C++ files?

    Read the article

  • Insert consecutive numbers

    - by Markus
    Hi. I have a table A (Acons, A1, A2, A3) in which I should insert information from another table B with columns (B1, B2, B3). The Acons is a column in which should contain some consecutive numbers (it is not an identity and I cannot make it identity). I know xmin - starting the from number the sequence has to be computed. How can I insert the rows into the table A, using a single Insert statement? I tried like the following, but it didn't work: DECLARE @i AS INT; SET @i = xmin; INSERT INTO A(Acons, A1, A2, A3) SELECT @i = (Bcons = (@i + 1)), B1, B2, B3 FROM B Unfortunatelly, the above solution does not work;

    Read the article

  • Modify a given number to find the required sum?

    - by Gaurav
    A friend of mine sent me this question. I haven't really been able to come up with any kind of algorithm to solve this problem. You are provided with a no. say 123456789 and two operators * and +. Now without changing the sequence of the provided no. and using these operators as many times as you wish, evaluate the given value: eg: given value 2097 Solution: 1+2+345*6+7+8+9 Any ideas on how to approach problems like these?

    Read the article

  • Combining XSLT transforms

    - by Flynn1179
    Is there a way to combine two XSLT documents into a single XSLT document that does the same as transforming using the original two in sequence? i.e. Combining XSLTA and XSLTB into XSLTC such that XSLTB( XSLTA( xml )) == XSLTC( xml )? There's three reasons I'd like to be able to do this: Simplifies development; some operations need sequential transforms, and although I can generate a combined one by hand, it's a lot more difficult to maintain that two much simpler, separate transforms. Speed; one transform is in most cases hopefully faster than two. I'm currently working on a program that literally just transforms a data file in XML into an XHTML page capable of editing it using one XSLT, and a second XSLT that transforms the XHTML page back into the data file when it's saved. One test I hope to be able to do is to combine the two, and easily confirm that the 'combined' XSLT should leave the data unchanged.

    Read the article

  • cleartool question

    - by chuanose
    Lets say I have a directory at \testfolder, and the latest is currently at /main/10. I know that the operation resulting in testfolder@@/main/6 is to remove a file named test.txt. What's a sequence of cleartool operations that can be done in a script that will take "testfolder@@/main/6" and "test.txt" as input, and will cat out the contents of test.txt as of that time? One way I can think of is to get the time of /main/6 operation, create a view with config spec -time set to that time, and then cat the test.txt at the directory. But I'm wondering if I can do this in a easier way that doesn't involve manipulating config specs, perhaps through "cleartool find" and extended path names

    Read the article

  • Concatenating Strings in Obj C

    - by eco_bach
    Hi It seems that Objective C jumps thru hoops to make seemingly simple tasks extremely difficult. I simply need to create a sequence of strings, image1.jpg, image2.jpg, etc etc ie in a loop var imgString:String='image'+i+'.jpg; I assume a best practice is to use a NSMutableString with appendString method? What am I doing wrong?? NSMutableString *imgString; for(int i=1;i<=NUMIMAGES;i++){ imgString.appendString(@"image"+i+@".jpg"); } I get the following error error: request for member 'appendString' in something not a structure or union

    Read the article

  • How to save an order (permutation) in an sql db

    - by Bendlas
    I have a tree structure in an sql table like so: CREATE TABLE containers ( container_id serial NOT NULL PRIMARY KEY, parent integer REFERENCES containers (container_id)) Now i want to define an ordering between nodes with the same parent. I Have thought of adding a node_index column, to ORDER BY, but that seem suboptimal, since that involves modifying the index of a lot of nodes when modifying the stucture. That could include adding, removing, reordering or moving nodes from some subtree to another. Is there a sql datatype for an ordered sequence, or an efficient way to emulate one? Doesn't need to be fully standard sql, I just need a solution for mssql and hopefully postgresql EDIT To make it clear, the ordering is arbitrary. Actually, the user will be able to drag'n'drop tree nodes in the GUI

    Read the article

  • Codeignitor Global Array Declaration

    - by Ajith
    I have a sequence of number like follows 1 - 25, 2 - 60, 3 - 80, 4 - 100 and so on which means that if input is 1 output will be 25 and so on...I need to store it in global array.I would like to use it in multiple pages also.In codeigniter where i can declare a global array and store all these? I am trying like as follows in constants.php $CONFIDENCEVALUE = array(); $CONFIDENCEVALUE[] = array('1'=>25,'2'=>'60','3'=>80,'4'=>100); If it is correct how can access these array value in required pages.Help me please.I am not an expert with codeignitor.Thanks

    Read the article

  • Error occurs while using SPADE method in R

    - by Yuwon Lee
    I'm currently mining sequence patterns using SPADE algorithm in R. SPADE is included in "arulesSequence" package of R. I'm running R on my CentOS 6.3 64bit. For an exercise, I've tried an example presented in http://en.wikibooks.org/wiki/Data_Mining_Algorithms_In_R/Sequence_Mining/SPADE When I tried to do "cspade(x, parameter = list(support = 0.4), control = list(verbose = TRUE))" R says: parameter specification: support : 0.4 maxsize : 10 maxlen : 10 algorithmic control: bfstype : FALSE verbose : TRUE summary : FALSE preprocessing ... 1 partition(s), 0 MB [0.096s] mining transactions ... 0 MB [0.066s] reading sequences ...Error in asMethod(object) : 's' is not an integer vector When I try to run SPADE on my Window 7 32bit, it runs well without any error. Does anybody know why such errors occur?

    Read the article

  • Does Visual Studio 2010 on x64 crash often? Or is it just on my PC?

    - by JK
    MY VS2010 crashes dozens of times a day. Compare that to 2008 and 2005 which were rock solid. Is 2010 known to be susceptible to crashing? Or could it be my environment? I'm using x64 as a dev box for the first time. The only plugin I has so far is Ankh. It crashes when doing different things. One I've noticed so far that always happens is if I press the key sequence alt-f-s-up (or any cursor key) it will crash every time.

    Read the article

  • sequencing function calls in javascript - are callbacks the only way?

    - by tim
    I read through various threads like this one for example. But it really escapes me how to accomplish the following: I have 4 functions, and want them happen one after another in sequence. Notice they are in incorrect order, to get my point across. I want the result that will output "1, 2, 3, 4' function firstFunction(){ // some very time consuming asynchronous code... console.log('1'); } function thirdFunction(){ // definitely dont wanna do this until secondFunction is finished console.log('3'); } function secondFunction(){ // waits for firstFunction to be completed console.log('2'); } function fourthFunction(){ // last function, not executed until the other 3 are done. console.log('4'); } I tried to figure out callbacks but am getting lost :( Isn't there some simple way to do this? Like looping through an array...

    Read the article

  • How to transfer large file (File size > Heap Size) over the network?

    - by neo
    How to transfer large file (File size Heap/RAM Size) over the network ? Lets say I have file (size 10GB) I want to transfer it machine a (RAM 512mb) to machine b (RAM 512mb). Want achieve this using java code. First, is it possible ? Any recommendation on framework. If possible, can we speed this up using threading ? Important criteria: file's data sequence needs to be maintained during transfer. Any example will be great help.

    Read the article

  • SQL Full Outer Join

    - by Torment March
    I have a table named 'Logs' with the following values : CheckDate CheckType CheckTime ------------------------------------------- 2011-11-25 IN 14:40:00 2011-11-25 OUT 14:45:00 2011-11-25 IN 14:50:00 2011-11-25 OUT 14:55:00 2011-11-25 IN 15:00:00 2011-11-25 OUT 15:05:00 2011-11-25 IN 15:15:00 2011-11-25 OUT 15:20:00 2011-11-25 IN 15:25:00 2011-11-25 OUT 15:30:00 2011-11-25 OUT 15:40:00 2011-11-25 IN 15:45:00 I want to use the previous table to produce a result of: CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 NULL 15:40:00 2011-11-25 15:45:00 NULL So far I have come up with this result set : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 15:45:00 NULL The problem is I cannot generate the log without CheckIns : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 NULL 15:40:00 The sequence of CheckIn - CheckOut pairing and order is in increasing time value.

    Read the article

  • Creating a file path in C#

    - by Jason
    So I'm trying to create a path in C#. I use Environment.Machinename and store it a variable serverName. Then I create another string variable and have some other path extension in there. Here is my code so far: string serverName = Environment.MachineName; string folderName = "\\AlarmLogger"; No matter what I do I can't seem to obtain only one backslash prior to AlarmLogger. Any ideas how I can specify a path in C#? Edit: I'm wondering if my code doesn't seem to want to paste correctly. Anyways when i paste it I only see one backslash but my code has two. Because of the escape character sequence. But something like string test = @"\" + serverName + folderName doesn't seem to want to work for me.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

< Previous Page | 68 69 70 71 72 73 74 75 76 77 78 79  | Next Page >