Search Results

Search found 2551 results on 103 pages for 'sequence'.

Page 75/103 | < Previous Page | 71 72 73 74 75 76 77 78 79 80 81 82  | Next Page >

  • RHEL hangs after starting virt-who succesfully

    - by Nick
    Idea #1: Is there a way to REPAIR an RHEL 6.2 installation? During the start-up procedure, after a recent forced reboot, my Linux machine (RHEL 6.2) hangs right after successfully starting virt-who. I can use login screens (Alt + F2/F3...) in text mode. I am clueless -- how can I find out what is the next step in the startup sequence? That step is most likely what is causing it to hang. These are the last lines saved to /var/log/boot.log: Starting RPC idmapd: [60G[[0;32m OK [0;39m] Starting cups: [60G[[0;32m OK [0;39m] Starting acpi daemon: [60G[[0;32m OK [0;39m] Starting HAL daemon: [60G[[0;32m OK [0;39m] Starting PC/SC smart card daemon (pcscd): [60G[[0;32m OK [0;39m] Retrigger failed udev events[60G[[0;32m OK [0;39m] Loading autofs4: [60G[[0;32m OK [0;39m] Starting automount: [60G[[0;32m OK [0;39m] Enabling Bluetooth devices: Starting sshd: [60G[[0;32m OK [0;39m] Starting ntpd: [60G[[0;32m OK [0;39m] Starting mysqld: [60G[[0;32m OK [0;39m] Starting postfix: [60G[[0;32m OK [0;39m] Starting abrt daemon: [60G[[0;32m OK [0;39m] Starting ksm: [60G[[0;32m OK [0;39m] Starting ksmtuned: [60G[[0;32m OK [0;39m] Starting Qpid AMQP daemon: [60G[[0;32m OK [0;39m] Starting crond: [60G[[0;32m OK [0;39m] Starting atd: [60G[[0;32m OK [0;39m] Starting libvirtd daemon: [60G[[0;32m OK [0;39m] Starting rhsmcertd 240 1440[60G[[0;32m OK [0;39m] Starting virt-who: [60G[[0;32m OK [0;39m]

    Read the article

  • Megacli is killing me, any help appreciated

    - by Stefan
    I run a server with 2 drives in raid0 configured through BIOS. I just added 2 more drives using hotplug (the server is dell r610 with RHEL 5.4 64bit) and I would like to configure a separate raid0 partition on these drives. I am getting the following error: /opt/MegaRAID/MegaCli/MegaCli64 -CfgLdAdd r0[32:2, 32:3] -a0 The specified physical disk does not have the appropriate attributes to complete the requested command. Exit Code: 0x26 All the parameters are correct and there is just no reason why this command could not work, see this (fujitsu is current raid, seagate is the new one I want to create): /opt/MegaRAID/MegaCli/MegaCli64 -PDList -aALL | egrep 'Adapter|Enclosure|Slot|Inquiry' Adapter #0 Enclosure Device ID: 32 Slot Number: 0 Enclosure position: 0 Inquiry Data: FUJITSU MBD2147RC D807D0A4PA101174 Enclosure Device ID: 32 Slot Number: 1 Enclosure position: 0 Inquiry Data: FUJITSU MBD2147RC D807D0A4PA10115T Enclosure Device ID: 32 Slot Number: 2 Enclosure position: 0 Inquiry Data: SEAGATE ST9300603SS FS033SE0TF5K Enclosure Device ID: 32 Slot Number: 3 Enclosure position: 0 Inquiry Data: SEAGATE ST9300603SS FS023SE070FK I also tried to set up the drive as hotspare, also some strange error: /opt/MegaRAID/MegaCli/MegaCli64 -PDHSP -Set -physdrv[32:3] -a0 Adapter: 0: Set Physical Drive at EnclId-32 SlotId-3 as Hot Spare Failed. FW error description: The specified device is in a state that doesn't support the requested command. Exit Code: 0x32 As you can see the disk is in Unconfigured, Good state: Enclosure Device ID: 32 Slot Number: 3 Enclosure position: 0 Device Id: 3 Sequence Number: 1 Media Error Count: 0 Other Error Count: 0 Predictive Failure Count: 0 Last Predictive Failure Event Seq Number: 0 PD Type: SAS Raw Size: 279.396 GB [0x22ecb25c Sectors] Non Coerced Size: 278.896 GB [0x22dcb25c Sectors] Coerced Size: 278.875 GB [0x22dc0000 Sectors] Firmware state: Unconfigured(good), Spun Up SAS Address(0): 0x5000c50005cd20b1 SAS Address(1): 0x0 Connected Port Number: 3(path0) Inquiry Data: SEAGATE ST9300603SS FS023SE070FK FDE Capable: Not Capable FDE Enable: Disable Secured: Unsecured Locked: Unlocked Needs EKM Attention: No Foreign State: Foreign Foreign Secure: Drive is not secured by a foreign lock key Device Speed: Unknown Link Speed: Unknown Media Type: Hard Disk Device Drive Temperature :30C (86.00 F)

    Read the article

  • Moving from WDS to MDT + WDS - Prestaged Computer Name

    - by MSCF
    We previously used just WDS to deploy our images. WDS was setup to request approval for new machines. We used the "Name and Approve" option to name the machines as we added them. If it was pre-existing, it would just use the existing computer name from AD. Then in our unattend.xml file we had Computername=%MACHINENAME%. This picked up the name we gave it during approval and set the computer name accordingly. We are now implementing MDT to manage our images and drivers. But upon testing, we noticed it would assign random computer names. I went into the Unattend.xml for the deploy task sequence and added that value under Specialize amd64_Microsoft-Windows-Shell-Setup_neutral Computername=%MACHINENAME%. But when we try applying the image, it errors out at that point of the install. How can an MDT deployment be configured to leverage the pre-staged name? Some additional info: Error message during the imaging process: Windows could not parse or process the unattend answer file for pass [specialize]. The settings specified in the answer file cannot be applied. The error was detected while processing settings for component [Microsoft-Windows-Shell-Setup].? setuperr.log: 2014-07-22 14:02:13, Error [setup.exe] [Action Queue] : Unattend action failed with exit code 4 2014-07-22 14:02:13, Error [setup.exe] Execution of unattend GCs failed; hr = 0x0; pResults-hrResult = 0x8030000b

    Read the article

  • fsck on LVM snapshots

    - by Alpha01
    I'm trying to do some file system checks using LVM snapshots of our Logical Volumes to see if any of them have dirty file systems. The problem that I have is that our LVM only has one Volume Group with no available space. I was able to do fsck's on some of the logical volumes using a loopback file system. However my question is, is it possible to create a 200GB loopback file system, and saved it on the same partition/logical volume that I'll be taking a snapshot of? Is LVM smart enough to not take a snapshot copy of the actual snapshot? [root@server z]# vgdisplay --- Volume group --- VG Name Web2-Vol System ID Format lvm2 Metadata Areas 1 Metadata Sequence No 29 VG Access read/write VG Status resizable MAX LV 0 Cur LV 6 Open LV 6 Max PV 0 Cur PV 1 Act PV 1 VG Size 544.73 GB PE Size 4.00 MB Total PE 139450 Alloc PE / Size 139450 / 544.73 GB Free PE / Size 0 / 0 VG UUID BrVwNz-h1IO-ZETA-MeIf-1yq7-fHpn-fwMTcV [root@server z]# df -h Filesystem Size Used Avail Use% Mounted on /dev/sda2 9.7G 3.6G 5.6G 40% / /dev/sda1 251M 29M 210M 12% /boot /dev/mapper/Web2--Vol-var 12G 1.1G 11G 10% /var /dev/mapper/Web2--Vol-var--spool 12G 184M 12G 2% /var/spool /dev/mapper/Web2--Vol-var--lib--mysql 30G 15G 14G 52% /var/lib/mysql /dev/mapper/Web2--Vol-usr 13G 3.3G 8.9G 27% /usr /dev/mapper/Web2--Vol-z 468G 197G 267G 43% /z /dev/mapper/Web2--Vol-tmp 3.0G 76M 2.8G 3% /tmp tmpfs 7.9G 92K 7.9G 1% /dev/shm The logical volume in question is /dev/mapper/Web2--Vol-z. I'm afraid if I created the loopback file system in /dev/mapper/Web2--Vol-z and take a snapshot of it, the disk size will be trippled in size, thus running out of disk space available.

    Read the article

  • Error when trying to deploy Windows XP SP3 with WDS

    - by Nic Young
    I have created a WDS server running Windows Server 2008 R2. I have built my custom images of Windows 7 using WAIK and MDT 2010 that are installed on the server. I used this guide to help me through the process. The Windows 7 images that I have created capture and deploy properly. I am attempting to follow the same steps from the guide I linked to capture and deploy a Windows XP SP3 image. I am able to sysprep and capture the reference machine with no errors. I am then able to import the custom .wim that I just captured in to MDT 2010 with no issues either. However when I try to deploy this image to a test virtual machine I get the following error: Deployment Error: I have made sure that the .iso that I am importing the source files from originally to create the sysprep and capture sequence is indeed a Windows XP SP3 iso. When I first select a PE boot environment before I deploy I select the x86 PE boot image that I created originally when making this for my Windows 7 deployments. Could this be the issue? If so how do I make a boot image specific for Windows XP SP3 deployments? I have Googled around for this error and some places point to the deployment image not being able to find setup.exe and other important system files for installing the operating system. If so, how do I add these to the image? Any ideas?

    Read the article

  • Open Office crashes, recovers, crashes again

    - by Daniel R Hicks
    After completely reinstalling my laptop due to apparent registry corruption, I've encountered a problem with Open Office: I open a simple Calc spreadsheet, it comes up normally, but then after anywhere from 5 seconds to several minutes (without even touching the Calc window) OO crashes, then comes up through recovery. If I let it "recover" it will do so and bring the spreadsheet up again, only to repeat the crash scenario again. If I kept clicking "OK" it would apparently do this all day. I reinstalled OO once and the problem went away for awhile, but it came back. I then attempted to "reset" my profile (ie, rename the OO user directory in App Data), but OO crashed during the first startup after that, then resumed the original behavior. If I open the same file using Excel it complains of errors in the file, and "recovers" them, but the "error report" it generates contains no details. If I save the "recovered" file then OO Calc will open it, but the problem returns after saving again. Any ideas? (The system is Vista SP2, running OO 3.4.1) How to reproduce: Start Open Office Calc. Save workspace as "CrashTest.ods" From Task Manager kill Open Office (soffice.exe/bin -- one of each) Double click on the saved "CrashTest.ods" in Explorer. OO puts up a message that recovery will occur -- allow it. When the Calc window comes up, don't touch it -- just wait about 10 seconds. Calc window closes and OO puts up a message that recovery will occur -- from now on the sequence will repeat. I suspect this behavior is limited to a few (recent) versions of OO, and very possibly only Calc. Reported as Open Office Bug 1211094. Sigh!! As much as it irritates me, I'm having to switch over to Excel for several things I used to do with Calc. Excel has a miserable UI, but at least it says up for longer than 10 seconds.

    Read the article

  • Recursive move utility on Unix?

    - by Thomas Vander Stichele
    Sometimes I have two trees that used to have the same content, but have grown out of sync (because I moved disks around or whatever). A good example is a tree where I mirror upstream packages from Fedora. I want to merge those two trees again by moving all of the files from tree1 into tree2. Usually I do this with: rsync -arv tree1/* tree2 Then delete tree1. However, this takes an awful lot of time and disk space, and it would be much easier to be able to do: mv -r tree1/* tree2 In other words, a recursive move. It would be faster because first of all it would not even copy, just move the inodes, and second I wouldn't need a delete at the end. Does this exist ? As a test case, consider the following sequence of commands: $ mkdir -p a/b $ touch a/b/c1 $ rsync -arv a/ a2 sending incremental file list created directory ./ b/ b/c1 b/c2 sent 173 bytes received 57 bytes 460.00 bytes/sec total size is 0 speedup is 0.00 $ touch a/b/c2 What command would now have the effect of moving a/b/c2 to a2/b/c2 and then deleting the a subtree (since everything in it is already in the destination tree) ?

    Read the article

  • Sparc v440 unable 2 boot after recommended patch install

    - by user100660
    After installing the October 2011 recommended patch bundle on a Solaris 10 the host fails to boot. The output is {0} ok boot SC Alert: Host System has Reset screen not found. keyboard not found. Keyboard not present. Using ttya for input and output. Sun Fire V440, No Keyboard Copyright 1998-2003 Sun Microsystems, Inc. All rights reserved. OpenBoot 4.10.10, 8192 MB memory installed, Serial #54744555. Ethernet address 0:3:ba:43:55:eb, Host ID: 834355eb. Rebooting with command: boot Boot device: /pci@1f,700000/scsi@2/disk@0,0:a File and args: \ Evaluating: Out of memory Warning: Fcode sequence resulted in a net stack depth change of 1 Evaluating: Evaluating: The file just loaded does not appear to be executable. {3} ok If I do a boot -F failsafe the host come up and I'm able to mount the root device (ufs on /dev/dsk/c1t0d0s0) and nothing appears broken, i.e I can see the logfiles from the patch install etc. Root device still have 1GB+ free. Only 2 kernel patches was installed from the patch bundle: 144500-19 & 147440-02. Any hints how to debug it further, etc.

    Read the article

  • BES Express - configure MDS to push messages from 3rd party web application

    - by Max Gontar
    Hi! I have developed IIS web service to send PAP messages using Blackberry Push API over MDS. And there is an application installed on device, configured to receive push messages on appropriate port. Everything works well on MDS simulator. But it's not working well in real environment: I have installed BES Express and register several devices. I can browse MDS url with appropriate port, so url is correct. Also port enabled for reliable pushes is used in push message and in device application. Here is MDS simulator log: <2011-01-12 14:00:03.456 EET>:[272]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = PapServlet: request from 0:0:0:0:0:0:0:1 564 bytes...> <2011-01-12 14:00:03.476 EET>:[273]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Mapping PAP request to push request for pushID:pushID:asdas> <2011-01-12 14:00:03.479 EET>:[274]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = PushServlet: POST request from [UNKNOWN @ 0:0:0:0:0:0:0:1] to [PAPDEST=WAPPUSH%3D2100000A%253A100%2FTYPE%3DUSER%40rim.net&PORT=100&REQUESTURI=/] : -1 bytes...> <2011-01-12 14:00:03.480 EET>:[275]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = submitting push message with id:pushID:asdas> <2011-01-12 14:00:03.482 EET>:[276]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Executing push submit command for pushID:pushID:asdas> <2011-01-12 14:00:03.483 EET>:[278]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Pushing message to: 2100000a> <2011-01-12 14:00:03.484 EET>:[279]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Number of active push connections:1> <2011-01-12 14:00:03.489 EET>:[280]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = added server-initiated connection = -872546301, push id = pushID:asdas> <2011-01-12 14:00:03.491 EET>:[281]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Available threads in DefaultJobPool = 9 running JobRunner: DefaultJobRunner-7> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION => <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Transmission Line Section]:> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = POST / HTTP/1.1> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Headers Section]: 8 headers> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Parameters Section]: 3 parameters> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION => <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Transmission Line Section]:> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = POST / HTTP/1.1> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Headers Section]: 9 headers> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Parameters Section]: 3 parameters> <2011-01-12 14:00:03.501 EET>:[284]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Finished JobRunner: DefaultJobRunner-7, available threads in DefaultJobPool = 10, time spent = 8ms> <2011-01-12 14:00:03.521 EET>:[287]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = CreatedSendingQueue, DEVICEPIN = 2100000a> <2011-01-12 14:00:03.526 EET>:[290]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = Sending, TAG = 1288699908, DEVICEPIN = 2100000a, VERSION = 16, CONNECTIONID = -872546301, SEQUENCE = 0, TYPE = NOTIFY-REQUEST, CONNECTIONHANDLER = http, PROTOCOL = TCP, PARAMETERS = [MGONTAR/10.10.0.35:100], SIZE = 339> <2011-01-12 14:00:03.531 EET>:[291]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Number of active push connections:0> <2011-01-12 14:00:03.591 EET>:[292]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = Notification, TAG = 1288699908, STATE = DELIVERED> <2011-01-12 14:00:03.600 EET>:[296]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Device connections: AVG latency (msecs)79> <2011-01-12 14:00:03.600 EET>:[297]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, Removed push connection:-872546301> <2011-01-12 14:00:07.015 EET>:[298]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = RemovedSendingQueue, DEVICEPIN = 2100000a> And here is real MDS log: <2011-01-12 11:35:02.763 GMT>:[3932]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, PapServlet: request from 192.168.1.241 583 bytes...> <2011-01-12 11:35:02.897 GMT>:[3933]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Mapping PAP request to push request for pushID:pushID:sdfsdfwerwer> <2011-01-12 11:35:02.909 GMT>:[3934]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, PushServlet: POST request from [UNKNOWN @ 192.168.1.241] to [PAPDEST=WAPPUSH%3D22D7F6BD%253A7874%2FTYPE%3DUSER%40rim.net&PORT=7874&REQUESTURI=/]> <2011-01-12 11:35:02.909 GMT>:[3934]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<push id: pushID:sdfsdfwerwer> <2011-01-12 11:35:02.910 GMT>:[3935]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, submitting push message with id:pushID:sdfsdfwerwer> <2011-01-12 11:35:02.910 GMT>:[3936]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Executing push submit command for pushID:pushID:sdfsdfwerwer> <2011-01-12 11:35:02.911 GMT>:[3937]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Pushing message to: 22d7f6bd> <2011-01-12 11:35:02.912 GMT>:[3938]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Number of active push connections:1> <2011-01-12 11:35:02.931 GMT>:[3939]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, added server-initiated connection = -1848311806, push id = pushID:sdfsdfwerwer> <2011-01-12 11:35:03.240 GMT>:[3940]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = CreatedSendingQueue, DEVICEPIN = 22d7f6bd, USERID = u3> <2011-01-12 11:35:03.241 GMT>:[3941]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = Sending, TAG = 536543251, DEVICEPIN = 22d7f6bd, USERID = u3, VERSION = 16, CONNECTIONID = -1848311806, SEQUENCE = 0, TYPE = NOTIFY-REQUEST, CONNECTIONHANDLER = http, PROTOCOL = TCP, PARAMETERS = [LDN-Server1/192.168.1.240:7874], SIZE = 383> <2011-01-12 11:35:03.241 GMT>:[3942]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Number of active push connections:0> <2011-01-12 11:35:03.253 GMT>:[3943]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SRP, SRPID = S27700165[LDN-SERVER1:3200], EVENT = Sending, VERSION = 1, COMMAND = SEND, TAG = 536543251, SIZE = 570> <2011-01-12 11:35:03.838 GMT>:[3944]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SRP, SRPID = S27700165[LDN-SERVER1:3200], EVENT = Receiving, VERSION = 1, COMMAND = STATUS, TAG = 536543251, SIZE = 10, STATE = DELIVERED> <2011-01-12 11:35:04.104 GMT>:[3945]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = Notification, TAG = 536543251, STATE = DELIVERED> <2011-01-12 11:35:04.121 GMT>:[3946]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Device connections: AVG latency (msecs)893> <2011-01-12 11:35:04.135 GMT>:[3947]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<INFO >:<LAYER = IPPP, DEVICEPIN = 22d7f6bd, DOMAINNAME = LDN-Server1/192.168.1.240, CONNECTION_TYPE = PUSH_CONN, ConnectionId = -1848311806, DURATION(ms) = 1151, MFH_KBytes = 0, MTH_KBytes = 0.374, MFH_PACKET_COUNT = 0, MTH_PACKET_COUNT = 1> <2011-01-12 11:35:04.144 GMT>:[3948]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, Removed push connection:-1848311806> <2011-01-12 11:35:09.264 GMT>:[3949]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = RemovedSendingQueue, DEVICEPIN = 22d7f6bd, USERID = u3> <2011-01-12 11:35:58.187 GMT>:[3950]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SRP, SRPID = S27700165[LDN-SERVER1:3200], EVENT = Sending, VERSION = 1, COMMAND = INFO, SIZE = 46> <2011-01-12 11:35:58.187 GMT>:[3951]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Sent health to S27700165[LDN-SERVER1:3200] Health=[0x 0000 0007 0000 0000],Mask=[0x 0000 0007 0000 0000],Load=[60]> As you can see, logs not really differs, message is marked as delivered. But my app on device not really gets this message (as it works in mds simulator) Please advice me, what may be wrong? Is there some certificate to install or security settings I should configure to make this push message came to device application? Thank you! same question on bbforums

    Read the article

  • General logging won't work in MySQL

    - by leonstr
    I saw on SF that there's an option in MySQL to log all queries. So, in my version (mysql-server-5.0.45-7.el5 on CentOS 5.2) this appears to be a case of enabling the 'log' option, so I edited /etc/my.cnf to add this: [mysqld] datadir=/var/lib/mysql socket=/var/lib/mysql/mysql.sock user=mysql old_passwords= log=/var/log/mysql-general.log [mysqld_safe] log-error=/var/log/mysqld.log pid-file=/var/run/mysqld/mysqld.pid I then created the file and set permissions: # touch /var/log/mysql-general.log # chown mysql. /var/log/mysql-general.log # ls -l /var/log/mysql-general.log -rw-r--r-- 1 mysql mysql 0 Jan 18 15:22 /var/log/mysql-general.log But when I start mysqld I get: 120118 15:24:18 mysqld started ^G/usr/libexec/mysqld: File '/var/log/mysql-general.log' not found (Errcode: 13) 120118 15:24:18 [ERROR] Could not use /var/log/mysql-general.log for logging (error 13). Turning logging off for the whole duration of the MySQL server process. To turn it on again: fix the cause, shutdown the MySQL server and restart it. 120118 15:24:18 InnoDB: Started; log sequence number 0 182917764 120118 15:24:18 [Note] /usr/libexec/mysqld: ready for connections. Can anyone suggest why this isn't working?

    Read the article

  • How to bypass resume from hibernate

    - by Daniel Trebbien
    I am attempting to resume a Windows Vista laptop from hibernate, but the resume process seems to be stuck in an endless loop in which Windows is repeatedly trying to read from the optical drive. When I press the Power On button on the laptop, the screen is black (not even the backlight turns on) and the following occurs in a loop: Five seconds pass and I hear the optical drive being accessed. (There's no disk in the drive, so it sounds like a short buzzing noise.) Two seconds pass and I hear the optical drive being accessed. Two seconds pass and I hear the optical drive being accessed. So it's three short buzzing noises in a row, over and over again. Eventually I have to abruptly power off the machine. I have tried inserting a data CD into the drive as well as a bootable CD (a live Linux distro boot disk). For both, the optical drive spins up for a bit, but stops after Windows decides that the disk is not what it is looking for. I have since lost the Windows Vista recovery DVD, but I don't know if inserting the recovery disk into the optical drive would have a different effect than the bootable CD. I have tried pressing F8 immediately after pressing the Power On button (hoping to enter System Restore), but that did not have an effect. Is there a special key sequence that will cause Windows to bypass resuming from hibernate, effectively ignoring hiberfil.sys?

    Read the article

  • Are web service handler chains possible under IIS / ASP.NET

    - by Mike
    I'm working with a client who wants me to implement a particular design in an IIS/ASP.NET environment. This design was already implemented in Java, but I am not sure it is possible using Microsoft technologies. In a Tomcat/Java environment one can create so call Handler Chains. In essence a handler runs on the server on which the web service is running and it intercepts the SOAP message coming to the web service. The handler can perform a number of tasks before passing control to the web service. Some of these tasks may refer to authentication and authorization. Moreover, one can create handler chains, such that the handlers can run in a particular sequence before passing control to the web service. This is a very elegant solution, as certain aspects of authentication and authorization can be automatically performed, without the developer of the client application and of the web service having to invest anything in it. The code for the client application and the web service is not affected. You may find a number of articles on internet on this subject by searching on Google for "web service handler chain". I performed searches for web service handlers in IIS or ASP.NET. I get some hits, but apparently handlers in IIS have another meaning than that described above. My question therefor is: Can handler chains (as available in Java and Tomcat) be created in IIS? If so, how (any article, book, forum...)? Either a negative or a positive answer will be greatly appreciated. Mike

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Boot loop that I cannot bypass

    - by lonewaft
    Recently, on a laptop that I've used for a while, I had a strange issue where OS files were corrupted (device manager) and Windows 8 was hung after the login screen, so I reinstalled Windows 7 over the existing Windows 8 installation, and it worked for a couple days. Today, when I tried to use my laptop, it was stuck on a boot loop. Right after the BIOS screen, it would show a flashing underscore, then restart the computer, again and again until I removed the battery. I tried booting to a windows 7 install CD, but the same flashing underscore - reboot sequence happened when I tried. I tried moving the boot priority around (HDD first, CD/DVD first, even USB first) but nothing changed. After about an hour of tinkering with it, I listened to the HDD sounds, and it sounded like the HDD was trying to spin up, but failing (whining noise increasing in frequency that stopped and started in sync with the system restarting). I am planning to replace the HDD, but I'm still confused as to why a faulty HDD would stop the laptop from booting to my install DVD (tried it on a different computer, it booted from that CD fine). Anybody here have any idea why this might be happening?

    Read the article

  • How do I fix a corrupt calendar cache?

    - by Blacklight Shining
    I was tailing /var/log/system.log and noticed a sudden wall of text. Looking closer, I saw it was an error CalendarAgent got while trying to save something: Nov 18 11:42:45 rainbow-dash.local CalendarAgent[12321]: CoreData: error: (11) Fatal error. The database at /Users/blackl/Library/Calendars/Calendar Cache is corrupted. SQLite error code:11, 'database disk image is malformed' Nov 18 11:42:45 rainbow-dash.local CalendarAgent[12321]: Core Data: annotation: -executeRequest: encountered exception = Fatal error. The database at /Users/blackl/Library/Calendars/Calendar Cache is corrupted. SQLite error code:11, 'database disk image is malformed' with userInfo = { NSFilePath = "/Users/blackl/Library/Calendars/Calendar Cache"; NSSQLiteErrorDomain = 11; } 2 messages repeated several times Nov 18 11:42:49 rainbow-dash.local CalendarAgent[12321]: [com.apple.calendar.store.log.subscription] [WARNING: CalSubscriptionSession :: persistError :: save failed] This entire sequence is repeated many times throughout the log. file said the file in question was a SQLite 3.x database, so I did a bit of searching and came up with a way to check those. blackl% cp -i ~/Library/Calendars/Calendar\ Cache /tmp blackl% sqlite3 /tmp/Calendar\ Cache SQLite version 3.7.12 2012-04-03 19:43:07 Enter ".help" for instructions Enter SQL statements terminated with a ";" sqlite> pragma integrity_check ; *** in database main *** Main freelist: Bad ptr map entry key=863 expected=(2,0) got=(5,21) On page 21 at right child: 2nd reference to page 863 This is followed by a few dozen lines like these: rowid <number> missing from index <name> and then: wrong # of entries in index <name> I'm at a bit of a loss as to what to do now—I couldn't find anything on how to fix the errors that I found. Also, it would probably be a good idea to disable Calendar Agent so it doesn't try to use the database while it's being fixed (that's why I copied it to /tmp before running sqlite3 on it.) How do I disable CalendarAgent and fix its cache?

    Read the article

  • SSD, AHCI and write performance

    - by Dan
    We've started to deploy SSD drives to our developers workstations. At this moment we're having the unpleasant surprise that the systems using the new SSDs often freeze, with the HDD activity led blinking or being continuously on. Benchmarks shows read speeds around 180 MB/s, but write speeds around 5 MB/s. All developers are using Windows 7 Enterprise, 64 bit, SP1. One of our developers suggested (based on his experience) the following sequence: backup the workstation use a tool to completely erase the SSD make sure AHCI is enabled in BIOS install Windows restore from backup So far, this procedure seems to work (we're still testing, but write speed seems to be 120 MB/s). There are some questions in this context: why do we have to completely reinstall Windows? Is it possible to clean the SSD without reinstalling Windows? Is there a reliable tool? If AHCI was disabled when Windows was installed and we enable it, shouldn't this be enough to correct the write performance issue? If we have to completely erase the SSDs, does this mean the SSDs we've received were used before (SH)? I'm wondering this because the package I've got was open (I didn't think about it at that time, as I considered one of my coworkers simply took a peek inside the package). Has anyone seen a similar problem before?

    Read the article

  • What's the difference between Host and HostName in SSH Config?

    - by Bill Jobs
    The man page says this: Host Host Restricts the following declarations (up to the next Host keyword) to be only for those hosts that match one of the patterns given after the keyword. If more than one pattern is provided, they should be separated by whitespace. A single `*' as a pattern can be used to provide global defaults for all hosts. The host is the hostname argument given on the command line (i.e. the name is not converted to a canonicalized host name before matching). A pattern entry may be negated by prefixing it with an exclamation mark (`!'). If a negated entry is matched, then the Host entry is ignored, regardless of whether any other patterns on the line match. Negated matches are therefore useful to provide exceptions for wildcard matches. See PATTERNS for more information on patterns. HostName HostName Specifies the real host name to log into. This can be used to specify nicknames or abbreviations for hosts. If the hostname contains the character sequence `%h', then this will be replaced with the host name specified on the command line (this is useful for manipulating unqualified names). The default is the name given on the com- mand line. Numeric IP addresses are also permitted (both on the command line and in HostName specifications). For example, when I want to create an SSH Config for GitHub, what should Host and HostName be respectively?

    Read the article

  • F5 Networks iRule/Tcl - Escaping UNICODE 6-character escape sequences so they are processed as and r

    - by openid.malcolmgin.com
    We are trying to get an F5 BIG-IP LTM iRule working properly with SharePoint 2007 in an SSL termination role. This architecture offloads all of the SSL processing to the F5 and the F5 forwards interactive requests/responses to the SharePoint front end servers via HTTP only (over a secure network). For the purposes of this discussion, iRules are parsed by a Tcl interpretation engine on the F5 Networks BIG-IP device. As such, the F5 does two things to traffic passing through it: Redirects any request to port 80 (HTTP) to port 443 (HTTPS) through HTTP 302 redirects and URL rewriting. Rewrites any response to the browser to selectively rewrite URLs embedded within the HTML so that they go to port 443 (HTTPS). This prevents the 302 redirects from breaking DHTML generated by SharePoint. We've got part 1 working fine. The main problem with part 2 is that in the response rewrite because of XML namespaces and other similar issues, not ALL matches for "http:" can be changed to "https:". Some have to remain "http:". Additionally, some of the "http:" URLs are difficult in that they live in SharePoint-generated JavaScript and their slashes (i.e. "/") are actually represented in the HTML by the UNICODE 6-character string, "\u002f". For example, in the case of these tricky ones, the literal string in the outgoing HTML is: http:\u002f\u002fservername.company.com\u002f And should be changed to: https:\u002f\u002fservername.company.com\u002f Currently we can't even figure out how to get a match in a search/replace expression on these UNICODE sequence string literals. It seems that no matter how we slice it, the Tcl interpreter is interpreting the "\u002f" string into the "/" translation before it does anything else. We've tried various combinations of Tcl escaping methods we know about (mainly double-quotes and using an extra "\" to escape the "\" in the UNICODE string) but are looking for more methods, preferably ones that work. Does anyone have any ideas or any pointers to where we can effectively self-educate about this? Thanks very much in advance.

    Read the article

  • New monitor connected to HDMI adaptor doesn't show output after booting

    - by Paul
    Hello out there in the multiple monitors’ world. I am a very old newbie in your world and need help. I just purchased a new Asus VH236H monitor and hooked it up the HDMI port of an ATI Radeon HD4300 / 4500 Series display adaptor. I left the old Princeton LCD19 (TMDS) hooked up to the DVI port of the same display adaptor. Both monitors displayed the boot sequence, after I fired good old Sarastro2 (Asus P5Q Pro Turbo – Dual Core E5300 – 2.60 GHz) up. The Asus lacked one half of a second behind the Princeton until the Windows 7 Ultimate SP 1 boot up was complete. Then the Asus displayed “HDMI NO SIGNAL” and went into hibernation. The Princeton stayed lit up as before. Both monitors are displayed on the “Screen Resolution Setup Display” and I plaid around with them for a while. The only thing I accomplished was to shove the desktop icons from the Princeton to the still hibernating Asus. The “Multiple displays:” is set to “Extend these displays”, the Orientation is “Landscape” and the Resolutions are set on both to the “recommended” one. Both monitors show that they work properly in the advanced Properties display. What am I doing wrong, what am I missing? Never mind the opinions about the different resolutions of the two monitors. I always can unhook the Princeton and give it to a Goodwill Store if I do not like the setup. I just would like to make it work. Any constructive help is very much appreciated, Thank you.

    Read the article

  • Why my hard disk can't boot from the BIOS?

    - by Mario
    I installed a new sata DVD burner. When I turned on the machine (windows 7) it didn't boot. It can boot from a lubuntu CD. There is an option on lubuntu to boot form the first hard disk. If I select it, the machine boots normally to windows 7. So from the CD I can boot but not from the BIOS. I checked all the options more than once: boot from HD, not boot from removable, boot from USB, boot from optical. The order of the boot sequence is HD then DVD. I tried booting only with the HD; I disconnected both DVDs. I even tried recovery of the MBR: bootsect, bootrec, fixmbr, buildbcd, nt60, etc. So, the question is, does this have a reason, what's the difference between booting from the BIOS (as I think) to from the DVD?. The BIOS is intel, it has BIOS codes on the right bottom corner, it stays at 5A for a while. 5A is "Resetting PATA/SATA bus and all devices".

    Read the article

  • How can I disable the CTRL-ALT-DEL key combination completely on XP/Vista/7?

    - by Travesty3
    I have been googling extensively to figure this out, and nobody seems to be able to give a direct answer. Let me start by saying that I'm NOT talking about requiring CTRL-ALT-DEL to enter logon information. I'm working on a golf simulator program which is used at golf centers. I need the ability to completely disable the CTRL-ALT-DEL key sequence so that the golf center customers can't get out of the program and access the computer at all. I realize there are other key combinations that need to be handled as well, we already have this entire feature working in XP, but we're going to be switching to Windows 7 soon, and CTRL-ALT-DEL is the only one that doesn't seem to work in Win7. I'd really like an all-around solution if at all possible. This same program may also be installed on a client's personal computer for an in-home golf simulator, but the computers that really need this feature (golf center computers) are provided to the golf center by us, so would the best option be to write a new shell? I don't know anything about that at all, other than others that suggest writing a new shell for kiosk mode. I'd really like a simpler option, like modifying the registry in some way. I have heard that you can remove some buttons from the menu screen that pops up, but unless I can remove pretty much all of them (including the shutdown/restart button in the bottom-right corner), this won't be enough of a solution for me. Thanks for taking the time to read this and thanks again for any help you could provide! -Travis

    Read the article

  • Speeding up Outlook Express on Windows XP over satellite

    - by John
    My brother is in the field with Doctors Without Borders. I'm posting this question on his behalf. We use outlook express (on a pc running windows XP) and a 9600 baud dial up satellite phone modem to get our email direct from the server in Paris. As this is a very expensive way to communicate (our satellite bill is $50K a year, no joke), it seems like trying to streamline is a good idea. Here's the question- when we connect, the sequence goes: Send outbox mails. This goes pretty quickly, probably 10-15 seconds for each email, up to maybe a couple minutes for an email of 150k or so). The status bar moves pretty quickly, according to the emails sent. The system then says "Checking for new messages on (our account name), and "Receiving list of messages from server". This takes a long time. Like 10-15 minutes. The status bar crawls along. Then it receives the messages. "Receiving messages from server". Again, each message takes 10-15 seconds, and this part moves along reasonably fast. I'm curious as to what is going on in the second part. It takes forever, and doesn't seem to be part of the sending or receiving messages themselves. Is there a way to speed up the process by changing a preference with communicating with the server or something? Does anyone have any advice for him speeding up what Outlooks Express is doing? Obviously his software is ancient and adding more software is not realistic based on the connection speed. Thanks!

    Read the article

  • How to bypass resume from hibernate [closed]

    - by Daniel Trebbien
    I am attempting to resume a Windows Vista laptop from hibernate, but the resume process seems to be stuck in an endless loop in which Windows is repeatedly trying to read from the optical drive. When I press the Power On button on the laptop, the screen is black (not even the backlight turns on) and the following occurs in a loop: Five seconds pass and I hear the optical drive being accessed. (There's no disk in the drive, so it sounds like a short buzzing noise.) Two seconds pass and I hear the optical drive being accessed. Two seconds pass and I hear the optical drive being accessed. So it's three short buzzing noises in a row, over and over again. Eventually I have to abruptly power off the machine. I have tried inserting a data CD into the drive as well as a bootable CD (a live Linux distro boot disk). For both, the optical drive spins up for a bit, but stops after Windows decides that the disk is not what it is looking for. I have since lost the Windows Vista recovery DVD, but I don't know if inserting the recovery disk into the optical drive would have a different effect than the bootable CD. I have tried pressing F8 immediately after pressing the Power On button (hoping to enter System Restore), but that did not have an effect. Is there a special key sequence that will cause Windows to bypass resuming from hibernate, effectively ignoring hiberfil.sys?

    Read the article

  • Give back full control to a user on a disk from another computer

    - by Foghorn
    I have my friend's hard drive mounted externally. After messing with the permissions with TAKEOWN so I could fix some viruses, I have full control over their drive. The problem is, now it's stuck in a "autochk not found" reboot sequence. I think the problem is that the boot sector is invisible to the drive now. So my question is, How can I use icacls to give back the full ownership, when the user I am giving it to is not on my machine? I ran the TAKEOWN command from my windows 7 laptop, their machine is a windows xp Professional with three partitions, I only altered the one that has the boot sector. Here is the permissions that icacls shows: (Where my computer is %System% my username is ME, and the drive is E:\ C:\Users\ME icacls E:\* E:\$RECYCLE.BIN %System%\ME:(OI)(CI)(F) Mandatory Label\Low Mandatory Level:(OI)(CI)(IO)(NW) E:\ALLDATAW %System%\ME:(I)(OI)(CI)(F) E:\alrt_200.data %System%\ME:(OI)(CI)(F) E:\AUTOEXEC.BAT %System%\ME:(OI)(CI)(F) E:\AZ Commercial %System%\ME:(I)(OI)(CI)(F) E:\boot.ini %System%\ME:(OI)(CI)(F) E:\Config.Msi %System%\ME:(I)(OI)(CI)(F) E:\CONFIG.SYS %System%\ME:(OI)(CI)(F) E:\Documents and Settings %System%\ME:(I)(OI)(CI)(F) E:\IO.SYS %System%\ME:(OI)(CI)(F) E:\Mitchell1 %System%\ME:(I)(OI)(CI)(F) E:\MSDOS.SYS %System%\ME:(OI)(CI)(F) E:\MSOCache %System%\ME:(I)(OI)(CI)(F) E:\NTDClient.log %System%\ME:(OI)(CI)(F) E:\NTDETECT.COM %System%\ME:(OI)(CI)(F) E:\ntldr %System%\ME:(OI)(CI)(F) E:\pagefile.sys %System%\ME:(OI)(CI)(F) E:\Program Files %System%\ME:(I)(OI)(CI)(F) E:\RECYCLER %System%\ME:(I)(OI)(CI)(F) E:\RHDSetup.log %System%\ME:(OI)(CI)(F) E:\System Volume Information %System%\ME:(I)(OI)(CI)(F) E:\WINDOWS %System%\ME:(I)(OI)(CI)(F) Successfully processed 22 files; Failed processing 0 files C:\Users\ME

    Read the article

  • Moving MySQL directory on an Amazon EC2 machine

    - by Traveling Tech Guy
    I'm trying to have MySQL point to a directory on an EBS volume I mounted on my EC2 machine. I took th following steps: Stopped MySQL (/etc/init.d/mysqld stop) - successful Created a MySQL directory on my volume, mounted on /vol (mkdir /vol/mysql) Copied the contents of /var/lib/mysql to /vol/mysql (cp -R /var/lib/mysql /vol/mysql) Chanded the owner and group of that directory to match the original (chown -R mysql:mysql /vol/mysql) - after this step, the 2 directories are identical. Edited the /etc/my.cnf file (commented 2 original lines): [mysqld] #datadir=/var/lib/mysql #socket=/var/lib/mysql/mysql.sock datadir=/vol/mysql socket=/vol/mysql/mysql.sock` Started MySQL (/etc/init.d/mysqld start) - FAILED The error file /var/log/mysqld.log contains the following lines: 100205 20:52:54 mysqld started 100205 20:52:54 InnoDB: Started; log sequence number 0 43665 100205 20:52:54 [Note] /usr/libexec/mysqld: ready for connections. Version: '5.0.45' socket: '/vol/mysql/mysql.sock' port: 3306 Source distribution No other errors are available. What am I doing wrong? Where can I find the error/s encountered by MySql? If I restore the original lines, MySQL starts, leading me to believe it may be a permissions issue - but permissions are the same for both directories? Thanks!

    Read the article

< Previous Page | 71 72 73 74 75 76 77 78 79 80 81 82  | Next Page >