Search Results

Search found 23309 results on 933 pages for 'bit operations'.

Page 881/933 | < Previous Page | 877 878 879 880 881 882 883 884 885 886 887 888  | Next Page >

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • Approach for authentication and storing user details.

    - by cappuccino
    Hey folks, I am using the Zend Framework but my question is broadly about sessions / databases / auth (PHP MySQL). Currently this is my approach to authentication: 1) User signs in, the details are checked in database. - Standard stuff really. 2) If the details are correct only the user's unique ID is stored in the session and a security token (user unique ID + IP + Browser info + salt). The session in written to the filesystem. I've been reading around and many are saying that storing stuff in sessions is not a good idea, and that you should really only write a unique ID which refers back to the user's details and a security token to prevent session hijacking. So this is the approach i've taken, i use to write the user's details in session, but i've moved that out. Wanted to know your opinions on this. I'm keeping sessions in the filesystem since i don't run on multiple servers, and since i'm only writting a tiny tiny bit of data to sessions, i thought that performance would be greater keeping sessions in the filesystem to reduce load on the database. Once the session is written on authentication, it really is only read-only from then on. 3) The rest of the user's details (like subscription details, permissions, account info etc) are cached in the filesystem (this can always be easily moved to memory if i wanted even more performance). So rather than keeping the user's details in session, the user's details are cached in the file system. I'm using Zend_Cache and the unique cache id is something like md5(/cache/auth/2892), the number is the unique id of the user. I guess the benefit of this method is that once the user is logged in, there is essentially not database queries being run to get the user's details. Just wonder if this approach is better than keeping the whole lot in session... 4) As the user moves throughout the site the only thing that is checked is the ID in the session and the security token. So, overall the first question is 1) is the filesystem more efficient than a database for this purpose 2) have i taken enough security precautions 3) is separating user detail's from the session into a cached file a pointless task? Thanks.

    Read the article

  • Calling cdecl Functions That Have Different Number of Arguments

    - by KlaxSmashing
    I have functions that I wish to call based on some input. Each function has different number of arguments. In other words, if (strcmp(str, "funcA") == 0) funcA(a, b, c); else if (strcmp(str, "funcB") == 0) funcB(d); else if (strcmp(str, "funcC") == 0) funcC(f, g); This is a bit bulky and hard to maintain. Ideally, these are variadic functions (e.g., printf-style) and can use varargs. But they are not. So exploiting the cdecl calling convention, I am stuffing the stack via a struct full of parameters. I'm wondering if there's a better way to do it. Note that this is strictly for in-house (e.g., simple tools, unit tests, etc.) and will not be used for any production code that might be subjected to malicious attacks. Example: #include <stdio.h> typedef struct __params { unsigned char* a; unsigned char* b; unsigned char* c; } params; int funcA(int a, int b) { printf("a = %d, b = %d\n", a, b); return a; } int funcB(int a, int b, const char* c) { printf("a = %d, b = %d, c = %s\n", a, b, c); return b; } int funcC(int* a) { printf("a = %d\n", *a); *a *= 2; return 0; } typedef int (*f)(params); int main(int argc, char**argv) { int val; int tmp; params myParams; f myFuncA = (f)funcA; f myFuncB = (f)funcB; f myFuncC = (f)funcC; myParams.a = (unsigned char*)100; myParams.b = (unsigned char*)200; val = myFuncA(myParams); printf("val = %d\n", val); myParams.c = (unsigned char*)"This is a test"; val = myFuncB(myParams); printf("val = %d\n", val); tmp = 300; myParams.a = (unsigned char*)&tmp; val = myFuncC(myParams); printf("a = %d, val = %d\n", tmp, val); return 0; } Output: gcc -o func func.c ./func a = 100, b = 200 val = 100 a = 100, b = 200, c = This is a test val = 200 a = 300 a = 600, val = 0

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • What alternatives do I have for source control and does GIT does that?

    - by RubberDuck
    I work as a freelancer programmer for some clients and also create apps for myself. When I work for myself, obviously I work alone. I generally don't work in a linear way. My big problems today are: I have a lot of apps that use the same classes I have developed; In the past, I put all these common classes on a directory outside all projects and included them on my apps using absolute paths, but this method sucks because by accident (if you forget) you may change a path or the disk and all projects are broken. Then I decided to copy those classes to my projects every time. Because the majority of these classes do not change frequently, I am relatively ok, but when they change, I am in hell; When I change one of these classes I have to propagate the changes to all other apps using copies of them. I have also tried to create frameworks but thanks to Apple, I cannot create frameworks for iOS and have to create libraries and bundles and create a nightmare of paths from one to the other and to the project to make that sh!t works. So, I am done with frameworks/libraries on Xcode until Xcode is a decent IDE. So, I see I need something better to manage my source code. What I need is this (I never used GIT on Xcode. I have read Apple docs but I still have these points): does git locally on Xcode allows me to deal with assets or just code? Can I have the equivalent of a "framework" (code + assets) managed by git locally? Can an entire xcodeproj be managed as a unity? I mean, Suppose I have a xcodeproj created and want GIT to manage it. How do I enable git on a project that was created without it and start designating files for management. (I have enabled git on Xcode's preferences, but all source control menu is grayed out). Is git the best option? Do I have another? Remember that my main condition is that the files should stay on the local computer. Please save me (I am a bit dramatic today). Thanks.

    Read the article

  • Mootools 1.2.4 delegation not working in IE8...?

    - by michael
    Hey there everybody-- So I have a listbox next to a form. When the user clicks an option in the select box, I make a request for the related data, returned in a JSON object, which gets put into the form elements. When the form is saved, the request goes thru and the listbox is rebuilt with the updated data. Since it's being rebuilt I'm trying to use delegation on the listbox's parent div for the onchange code. The trouble I'm having is with IE8 (big shock) not firing the delegated event. I have the following HTML: <div id="listwrapper" class="span-10 append-1 last"> <select id="list" name="list" size="20"> <option value="86">Adrian Franklin</option> <option value="16">Adrian McCorvey</option> <option value="196">Virginia Thomas</option> </select> </div> and the following script to go with it: window.addEvent('domready', function() { var jsonreq = new Request.JSON(); $('listwrapper').addEvent('change:relay(select)', function(e) { alert('this doesn't fire in IE8'); e.stop(); var status= $('statuswrapper').empty().addClass('ajax-loading'); jsonreq.options.url = 'de_getformdata.php'; jsonreq.options.method = 'post'; jsonreq.options.data = {'getlist':'<?php echo $getlist ?>','pkey':$('list').value}; jsonreq.onSuccess = function(rObj, rTxt) { status.removeClass('ajax-loading'); for (key in rObj) { status.set('html','You are currently editing '+rObj['cname']); if ($chk($(key))) $(key).value = rObj[key]; } $('lalsoaccomp-yes').set('checked',(($('naccompkey').value > 0)?'true':'false')); $('lalsoaccomp-no').set('checked',(($('naccompkey').value > 0)?'false':'true')); } jsonreq.send(); }); }); (I took out a bit of unrelated stuff). So this all works as expected in firefox, but IE8 refuses to fire the delegated change event on the select element. If I attach the change function directly to the select, then it works just fine. Am I missing something? Does IE8 just not like the :relay? Sidenote: I'm very new to mootools and javascripting, etc, so if there's something that can be improved code-wise, please let me know too.. Thanks!

    Read the article

  • Android - cant read TXT files from SDcard on real mashine?

    - by JustMe
    Hello! When I run the code bellow in the virtual android (1.5) it works well, TextSwitcher shows first 80 chars from each txt file from /sdcard/documents/ , but when I run it on my Samsung Galaxy i7500 (1.6) there are no contents in TextSwitcher, however in LogCat there are FileNames of txt files. My Code: public void getTxtFiles(){ //Scan /sdcard/documents and put .txt files in array File TxtFiles[] String path = Environment.getExternalStorageDirectory().toString()+"/documents/"; String files; File folder = new File(path); if(folder.exists()==false){if (!folder.mkdirs()) { Log.e("TAG", "Create dir in sdcard failed"); return; }} else{ File listOfFiles[] = folder.listFiles(); for (int i = 0; i < listOfFiles.length; i++) { if (listOfFiles[i].isFile()) { files = listOfFiles[i].getName(); if (files.endsWith(".txt") || files.endsWith(".TXT")) { if((files.length()-1)>i){resizeArray(TxtFiles, files.length()+10);} TxtFiles[i]=listOfFiles[i]; System.out.println(TxtFiles[i]); } } }} } private void updateCounter(int Pozicija) { if(Pozicija<0){Toast.makeText(getApplicationContext(), R.string.LastTxt, 5).show(); mCounter++;} else if(TxtFiles[mCounter]!=null){ TextToShow = getContents(TxtFiles[mCounter]); if(TextToShow.length()>80)TextToShow=TextToShow.substring(0, 80); mSwitcher.setText(TextToShow); System.out.println(Pozicija); } else mCounter--; } static public String getContents(File aFile) { //...checks on aFile are elided StringBuilder contents = new StringBuilder(); try { //use buffering, reading one line at a time //FileReader always assumes default encoding is OK! BufferedReader input = new BufferedReader(new FileReader(aFile)); try { String line = null; //not declared within while loop /* * readLine is a bit quirky : * it returns the content of a line MINUS the newline. * it returns null only for the END of the stream. * it returns an empty String if two newlines appear in a row. */ while (( line = input.readLine()) != null){ contents.append(line); contents.append(System.getProperty("line.separator")); } } finally { input.close(); } } catch (IOException ex){ ex.printStackTrace(); } return contents.toString(); } And I am able to write contents of those files though LogCat! Any ideas?

    Read the article

  • Implementing a scalable and high-performing web app

    - by Christopher McCann
    I have asked a few questions on here before about various things relating to this but this is more of a consolidation question as I would like to check I have got the gist of everything. I am in the middle of developing a social media web app and although I have a lot of experience coding in Java and in PHP I am trying things a bit different this time. I have modularised each component of the application. So for example one component of the application allows users to private message each other and I have split this off into its own private messaging service. I have also created a user data service the purpose of which is to return data about the user for example their name, address, age etc etc from the database. Their is also another service, the friends service, which will work off the neo4j database to create a social graph. My reason for doing all this is to allow me up to update seperate modules when I need to - so while they mostly all run off MySQL right now I could move one to Cassandra later if I thought it approriate. The actual code of the web app is really just used for the final construction. The modules behind it dont really follow any strict REST or SOAP protocol. Basically each method on our API is turned into a PHP procedural script. This then may make calls to other back-end code which tends to be OO. The web app makes CURL requests to these pages and POSTs data to them or GETs data from them. These pages then return JSON where data is required. I'm still a little mixed up about how I actually identify which user is logged in at that moment. Do I just use sessions for that? Like if we called the get-messages.php script which equates to the getMessages() method for that user - returning all the private messages for that user - how would the back-end code know which user it is as posting the users ID to the script would not be secure. Anyone could do that and get all the messages. So I thought I would use sessions for it. Am I correct on this? Can anyone spot any other problems with what I am doing here? Thanks

    Read the article

  • clarification on the concept of "web service"

    - by udit
    Im a little confused on the varying definitions and implementations of web services available as implementations. Need some clarification please. Ones I have used till now: If a vendor gives me a specific format of XML that I can send populated with data to request and I make a simple HTTP POST over the internet passing in the XML String as the payload, is this a web service call ? If so, is there a specific name to it, this kind of web service ? Because obviously, it does not use anything like Axis, WSDL or SOAP to establish this connection. A variant of this is If the vendor gives me an XSD, I use JAXB to make a java class out of it and pass in the serialized version of the object, which eventually works out to be the same as option 1. RESTful web service: Vendor gives me a URL like http://restfulservice/products and I can make HTTP Requests to the URL and depending on what HTTP verb I use, the appropropriate action is called and the response sent over the wire. Ones I have only read about\ have a vague idea about SOAP. How does this work?.. Ive read the W3Schools tutorial and I undertsand that there is a very specific form of XML that is standardized according to W3C standards that we use to pass the same kind of messages as we did in option 1. But how does this work in real life? Vendor sends me what? Do I generate classes? Do I serialize some objects and http post them over to an address? Or do the generated objects themselves have connection methods that will do them for me? What about WSDL? When does a vendor send me WSDL and what do I do with it ? I guess I can generate classes from it. If yes, then what do I do with the generated classes ? When do I need that axis jar to generate classes from something that the vendor sends ? As you can see, I have some clear and other mostly vague ideas about the different kinds of web services available. would help if someone ould clarify and\or point to more real-world resources. I've looked a little bit into Java Web Services on the internet and the numerous four letter acronyms that get thrown at me make me dizzy. Thanks

    Read the article

  • SEO Help with Pages Indexed by Google

    - by Joe Majewski
    I'm working on optimizing my site for Google's search engine, and lately I've noticed that when doing a "site:www.joemajewski.com" query, I get results for pages that shouldn't be indexed at all. Let's take a look at this page, for example: http://www.joemajewski.com/wow/profile.php?id=3 I created my own CMS, and this is simply a breakdown of user id #3's statistics, which I noticed is indexed by Google, although it shouldn't be. I understand that it takes some time before Google's results reflect accurately on my site's content, but this has been improperly indexed for nearly six months now. Here are the precautions that I have taken: My robots.txt file has a line like this: Disallow: /wow/profile.php* When running the url through Google Webmaster Tools, it indicates that I did, indeed, correctly create the disallow command. It did state, however, that a page that doesn't get crawled may still get displayed in the search results if it's being linked to. Thus, I took one more precaution. In the source code I included the following meta data: <meta name="robots" content="noindex,follow" /> I am assuming that follow means to use the page when calculating PageRank, etc, and the noindex tells Google to not display the page in the search results. This page, profile.php, is used to take the $_GET['id'] and find the corresponding registered user. It displays a bit of information about that user, but is in no way relevant enough to warrant a display in the search results, so that is why I am trying to stop Google from indexing it. This is not the only page Google is indexing that I would like removed. I also have a WordPress blog, and there are many category pages, tag pages, and archive pages that I would like removed, and am doing the same procedures to attempt to remove them. Can someone explain how to get pages removed from Google's search results, and possibly some criteria that should help determine what types of pages that I don't want indexed. In terms of my WordPress blog, the only pages that I truly want indexed are my articles. Everything else I have tried to block, with little luck from Google. Can someone also explain why it's bad to have pages indexed that don't provide any new or relevant content, such as pages for WordPress tags or categories, which are clearly never going to receive traffic from Google. Thanks!

    Read the article

  • jQuery Validator's "required" not working when value is set at statup

    - by nandrew
    Hello, I have a problem with jQuery Validator. I want to use "required" property on a text input. It doesn't work when input has set value attribute by HTML code (tested on Firefox (3.5), and on IE 8 - on IE it works a bit better). Story: 1. Page loads; 2. value is cleared; 3. focus is changed. 4. Nothing happens but the error message should be displayed; 5. getting back to the field and typing some characters. 6. changing focus; 7. getting back to the field; 8. clearing the field. 9. Error is displayed even before leaving the field. The HTML code: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <head> <script src="Web/Scripts/jquery-1.3.2.min.js" type="text/javascript"></script> <script src="Web/Scripts/jquery.validate.js" type="text/javascript"></script> </head> <body> <form id="form1"> <input type="text" id="name1" name="name1" value="test" /><br /> <input type="text" /> </form> <script type="text/javascript"> $(document).ready(function() { var validator = $("form").validate({ rules: { name1: { required: true, minlength: 2 } }, messages: { name1: "bad name" }, }); }); </script> </body> </html>

    Read the article

  • Check my anagram code from a job interview in the past.

    - by Michael Dorgan
    Had the following as an interview question a while ago and choked so bad on basic syntax that I failed to advance (once the adrenalin kicks in, coding goes out the window.) Given a list of string, return a list of sets of strings that are anagrams of the input set. i.e. "dog","god", "foo" should return {"dog","god"}. Afterward, I created the code on my own as a sanity check and it's been around now for a bit. I'd welcome input on it to see if I missed anything or if I could have done it much more efficiently. Take it as a chance to improve myself and learn other techniques: void Anagram::doWork(list input, list &output) { typedef list SortType; SortType sortedInput; // sort each string and pair it with the original for(list<string>::iterator i = input.begin(); i != input.end(); ++i) { string tempString(*i); std::sort(tempString.begin(), tempString.end()); sortedInput.push_back(make_pair(*i, tempString)); } // Now step through the new sorted list for(SortType::iterator i = sortedInput.begin(); i != sortedInput.end();) { set<string> newSet; // Assume (hope) we have a match and pre-add the first. newSet.insert(i->first); // Set the secondary iterator one past the outside to prevent // matching the original SortType::iterator j = i; ++j; while(j != sortedInput.end()) { if(i->second == j->second) { // If the string matches, add it to the set and remove it // so that future searches need not worry about it newSet.insert(j->first); j = sortedInput.erase(j); } else { // else, next element ++j; } } // If size is bigger than our original push, we have a match - save it to the output if(newSet.size() > 1) { output.push_back(newSet); } // erase this element and update the iterator i = sortedInput.erase(i); } }

    Read the article

  • Looking for an Open Source Project in need of help

    - by hvidgaard
    Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

    Read the article

  • How to find the one Label in DataList that is set to True

    - by Doug
    In my .aspx page I have my DataList: <asp:DataList ID="DataList1" runat="server" DataKeyField="ProductSID" DataSourceID="SqlDataSource1" onitemcreated="DataList1_ItemCreated" RepeatColumns="3" RepeatDirection="Horizontal" Width="1112px"> <ItemTemplate> ProductSID: <asp:Label ID="ProductSIDLabel" runat="server" Text='<%# Eval("ProductSID") %>' /> <br /> ProductSKU: <asp:Label ID="ProductSKULabel" runat="server" Text='<%# Eval("ProductSKU") %>' /> <br /> ProductImage1: <asp:Label ID="ProductImage1Label" runat="server" Text='<%# Eval("ProductImage1") %>' /> <br /> ShowLive: <asp:Label ID="ShowLiveLabel" runat="server" Text='<%# Eval("ShowLive") %>' /> <br /> CollectionTypeID: <asp:Label ID="CollectionTypeIDLabel" runat="server" Text='<%# Eval("CollectionTypeID") %>' /> <br /> CollectionHomePage: <asp:Label ID="CollectionHomePageLabel" runat="server" Text='<%# Eval("CollectionHomePage") %>' /> <br /> <br /> </ItemTemplate> </asp:DataList> And in my code behind using the ItemCreated event to find and set the label.backcolor property. (Note:I'm using a recursive findControl class) protected void DataList1_ItemCreated(object sender, DataListItemEventArgs e) { foreach (DataListItem item in DataList1.Items) { if (e.Item.ItemType == ListItemType.Item || e.Item.ItemType == ListItemType.AlternatingItem) { Label itemLabel = form1.FindControlR("CollectionHomePageLabel") as Label; if (itemLabel !=null || itemLabel.Text == "True") { itemLabel.BackColor = System.Drawing.Color.Yellow; } } When I run the page, the itemLabel is found, and the color shows. But it sets the itemLabel color to the first instance of the itemLabel found in the DataList. Of all the itemLabels in the DataList, only one will have it's text = True - and that should be the label picking up the backcolor. Also: The itemLabel is picking up a column in the DB called "CollectionHomePage" which is True/False bit data type. I must be missing something simple... Thanks for your ideas.

    Read the article

  • How to stream semi-live audio over internet

    - by Thomas Tempelmann
    I want to write something like Skype, i.e. I have a constant audio stream on one computer and then recompress it in a format that's suitable for a latent internet connection, receive it on the other end and play it. Let's also assume that the internet connection is fairly modern and fast, i.e. DSL or alike, no slow connections over phone and such. The involved computers will also be rather modern (Dual Core Intel CPUs at 2GHz or more). I know how to handle the audio on the machines. What I don't know is how to transmit the audio in an efficient way. The challenges are: I'd like get good audio quality across the line. The stream should be received without drops. The stream may, however, be received with a little delay (a second delay is acceptable). I imagine that the transport software could first determine the average (and max) latency, then start the stream and tell the receiver to wait for that max latency before starting to play the audio. With that, if the latency doesn't get any higher, the entire stream will be playable on the other side without stutter or drops. If, due to unexpected IP latencies or blockages, the stream does get cut off, I want to be able to notice this so that I can take actions (e.g. abort the stream) and eventually start a new transmission. What are my options if I want do use ready-made software for the compression and tranmission? I have no intention to write my own audio compression engine, really. OTOH, I plan to sell the solution in a vertical market, meaning I can afford a few dollars of license fees per copy, but not $100s. I guess the simplest solution would be to just open a TCP stream, send a few packets back and forth to determine their running time (or even use UDP for that), then use the results as the guide for my max latency value, then simply fire the audio data in its raw form (uncompressed 16 bit stereo), along with a timing code over the TCP connection. The receiver reads the data and plays it with the pre-determined delay. That might just work with the type of fast connection I expect. I just wonder if there are better solutions to reach this goal, with better performance (lower latency) and less data (compressed). BTW, I first try to implement this on OS X, but might want to do it on Windows, too, if it proves successful.

    Read the article

  • jQuery: form input values turns up undefined

    - by Seerumi
    Having problem with this bit of code qith jQuery. it should pick the values from current form and then submit them, but when I try to get them with jQuery they always turn up undefined. I know the SQL results are fine since they show correctly in HTML table, so it must be my inferior javascript skills. New with jQuery and I'm at loss :( PHP/HTML: echo "<table>\n" while ($row = odbc_fetch_array($query)) { echo "<form class='catForm'>\n"; echo "<input type=hidden class='catID' name='catID' value='".$row['running_id']."'/>\n"; echo "<tr>\n"; echo "<td>".$row['running_id']."</td>\n"; echo "<td>".$row['site_id']."</td>\n"; echo "<td>".$row['main_category']."</td>\n"; echo "<td>".$row['map_name']."</td>\n"; echo "<td><input type=textfield class='bCatID' value='".$row['mapping_id']."' size=6/></td>\n"; echo "<td><input type=submit class='saveCat' value='Save'/></td>\n"; echo "<td><input type=submit class='killCat' value='Delete' /></td>\n"; echo "</tr>\n"; echo "</form>\n"; } echo "</table>"; jQuery: $(".catForm").submit(function () { var id = $(this).find('.catID').val(); var bCatID = $(this).find('.bCatID').val(); var dataString = 'id='+id+'&bCatID='+bCatID; $.ajax({ type: "POST", url: 'adminUI/bin/updateSCategories.php', dataType : 'json', data: dataString, success: function(data) { if (data.error == true) $('.failure').html("Error, save failed.").show().fadeOut(2000); if (data.error == false) $('.success').html("Saved succesfully").show().fadeOut(2000); }, error: function(XMLHttpRequest, textStatus, errorThrown) { $('.failure').html("Error, save failed.").show().fadeOut(2000); } }); return false; }); RESULT: id: undefined bCatID: undefined

    Read the article

  • Rails populate edit form for non-column attributes

    - by Rabbott
    I have the following form: <% form_for(@account, :url => admin_accounts_path) do |f| %> <%= f.error_messages %> <%= render :partial => 'form', :locals => {:f => f} %> <h2>Account Details</h2> <% f.fields_for :customer do |customer_fields| %> <p> <%= customer_fields.label :company %><br /> <%= customer_fields.text_field :company %> </p> <p> <%= customer_fields.label :first_name %><br /> <%= customer_fields.text_field :first_name %> </p> <p> <%= customer_fields.label :last_name %><br /> <%= customer_fields.text_field :last_name %> </p> <p> <%= customer_fields.label :phone %><br /> <%= customer_fields.text_field :phone %> </p> <% end %> <p> <%= f.submit 'Create' %> </p> <% end %> As well as attr_accessor :customer And I have a before_create method for the account model which does not store the customer_fields, but instead uses them to submit data to an API.. The only thing I store are in the form partial.. The problem I'm running into is that when a validation error gets thrown, the page renders the new action (expected) but none of the non-column attributes within the Account Detail form will show? Any ideas as to how I can change this code around a bit to make this work me?? This same solution may be the help I need for the edit form, I have a getter for the data which it asks the API for, but without place a :value = "asdf" within each text box, it doesn't populate the fields either..

    Read the article

  • Opening Macro definitions: tdfx_span.c: lvalue required as left operand of assignment

    - by anttir
    Hi, I'm trying to compile X11R6-7.0 under Ubuntu maverick and got some weird compilation errors I'm unable to resolve myself. I needed X11R6-7.0 as ati catalyst drivers don't support newer xorg and oss drivers don't support 3d acceleration of my hardware. Anyone know what this error message means? I know some C but I got a bit confused. Does it mean GET_FB_DATA macro returned NULL or some method/property not set? Any further insight how to "debug" preprocessor definitions at this point would be great. I don't think I can print anything useful with #error. The error I get: tdfx_span.c: In function ‘tdfxDDWriteDepthPixels’: tdfx_span.c:976: error: lvalue required as left operand of assignment tdfx_span.c:1008: error: lvalue required as left operand of assignment tdfx_span.c: In function ‘write_stencil_pixels’: tdfx_span.c:1242: error: lvalue required as left operand of assignment the Code: 958- switch (depth_size) { 959- case 16: 960- GetBackBufferInfo(fxMesa, &backBufferInfo); 961- /* 962- * Note that the _LOCK macro adds a curly brace, 963- * and the UNLOCK macro removes it. 964- */ 965- WRITE_FB_SPAN_LOCK(fxMesa, info, 966- GR_BUFFER_AUXBUFFER, GR_LFBWRITEMODE_ANY); 967- { 968- LFBParameters ReadParams; 969- GetFbParams(fxMesa, &info, &backBufferInfo, 970- &ReadParams, sizeof(GLushort)); 971- for (i = 0; i < n; i++) { 972- if (mask[i] && visible_pixel(fxMesa, x[i], y[i])) { 973- xpos = x[i] + fxMesa->x_offset; 974- ypos = bottom - y[i]; 975- d16 = depth[i]; 976: PUT_FB_DATA(&ReadParams, GLushort, xpos, ypos, d16); 977- } 978- } 979- } 980- WRITE_FB_SPAN_UNLOCK(fxMesa, GR_BUFFER_AUXBUFFER); 981- break; 982- case 24: And relative macros: #define GET_FB_DATA(ReadParamsp, type, x, y) \ (((x) < (ReadParamsp)->firstWrappedX) \ ? (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) \ : (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)])) #define GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbPtr)) \ [(y) * ((ReadParamsp)->LFBStrideInElts) \ + (x)]) #define GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) \ (((type *)((ReadParamsp)->lfbWrapPtr)) \ [((y)) * ((ReadParamsp)->LFBStrideInElts) \ + ((x) - (ReadParamsp)->firstWrappedX)]) #define PUT_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_ORDINARY_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_ORDINARY_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) #define PUT_WRAPPED_FB_DATA(ReadParamsp, type, x, y, value) \ (GET_WRAPPED_FB_DATA(ReadParamsp, type, x, y) = (type)(value)) The LFBParameters Struct 483-typedef struct 484-{ 485- void *lfbPtr; 486- void *lfbWrapPtr; 487- FxU32 LFBStrideInElts; 488- GLint firstWrappedX; 489-} 490:LFBParameters; Thanks for looking.

    Read the article

  • OpenGL ES functions not accepting values originating outside of it's view

    - by Josh Elsasser
    I've been unable to figure this out on my own. I currently have an Open GLES setup where a view controller both updates a game world (with a dt), fetches the data I need to render, passes it off to an EAGLView through two structures (built of Apple's ES1Renderer), and draws the scene. Whenever a value originates outside of the Open GL view, it can't be used to either translate objects using glTranslatef, or set up the scene using glOrthof. If I assign a new value to something, it will work - even if it is the exact same number. The two structures I have each contain a variety of floating-point numbers and booleans, along with two arrays. I can log the values from within my renderer - they make it there - but I receive errors from OpenGL if I try to do anything with them. No crashes result, but the glOrthof call doesn't work if I don't set the camera values to anything different. Code used to set up scene: [EAGLContext setCurrentContext:context]; glBindFramebufferOES(GL_FRAMEBUFFER_OES, viewFramebuffer); //clears the color buffer bit glClear(GL_COLOR_BUFFER_BIT); glMatrixMode(GL_PROJECTION); //sets up the scene w/ ortho projection glViewport(0, 0, 320, 480); glLoadIdentity(); glOrthof(320, 0, dynamicData.cam_x2, dynamicData.cam_x1, 1.0, -1.0); glClearColor(1.0, 1.0, 1.0, 1.0); /*error checking code here*/ "dynamicData" (which is replaced every frame) is created within my game simulation. From within my controller, I call a method (w/in my simulation) that returns it, and pass the result on to the EAGLView, which passes it on to the renderer. I haven't been able to come up with a better solution for this - suggestions in this regard would be greatly appreciated as well. Also, this function doesn't work as well (values originate in the same place): glTranslatef(dynamicData.ship_x, dynamicData.ship_y, 0.0); Thanks in advance. Additional Definitions: Structure (declared in a separate header): typedef struct { float ship_x, ship_y; float cam_x1, cam_x2; } dynamicRenderData; Render data getter (and builder) (every frame) - (dynamicData)getDynRenderData { //d_rd is an ivar, zeroed on initialization d_rd.ship_x = mainShip.position.x; d_rd.ship_y = mainShip.position.y; d_rd.cam_x1 = d_rd.ship_x - 30.0f; d_rd.cam_x2 = d_rd.cam_x1 + 480.0f; return d_rd; } Zeroed at start. (d_rd.ship_x = 0;, etc…) Setting up the view. Prototype (GLView): - (void)draw: (dynamicRenderData)dynamicData Prototype (Renderer): - (void)drawView: (dynamicRenderData)dynamicData How it's called w/in the controller: //controller [glview draw: [world getDynRenderData]]; //glview (within draw) [renderer drawView: dynamicData];

    Read the article

  • OpenGL Shader Compile Error

    - by Tomas Cokis
    I'm having a bit of a problem with my code for compiling shaders, namely they both register as failed compiles and no log is received. This is the shader compiling code: /* Make the shader */ Uint size; GLchar* file; loadFileRaw(filePath, file, &size); const char * pFile = file; const GLint pSize = size; newCashe.shader = glCreateShader(shaderType); glShaderSource(newCashe.shader, 1, &pFile, &pSize); glCompileShader(newCashe.shader); GLint shaderCompiled; glGetShaderiv(newCashe.shader, GL_COMPILE_STATUS, &shaderCompiled); if(shaderCompiled == GL_FALSE) { ReportFiler->makeReport("ShaderCasher.cpp", "loadShader()", "Shader did not compile", "The shader " + filePath + " failed to compile, reporting the error - " + OpenGLServices::getShaderLog(newCashe.shader)); } And these are the support functions: bool loadFileRaw(string fileName, char* data, Uint* size) { if (fileName != "") { FILE *file = fopen(fileName.c_str(), "rt"); if (file != NULL) { fseek(file, 0, SEEK_END); *size = ftell(file); rewind(file); if (*size > 0) { data = (char*)malloc(sizeof(char) * (*size + 1)); *size = fread(data, sizeof(char), *size, file); data[*size] = '\0'; } fclose(file); } } return data; } string OpenGLServices::getShaderLog(GLuint obj) { int infologLength = 0; int charsWritten = 0; char *infoLog; glGetShaderiv(obj, GL_INFO_LOG_LENGTH,&infologLength); if (infologLength > 0) { infoLog = (char *)malloc(infologLength); glGetShaderInfoLog(obj, infologLength, &charsWritten, infoLog); string log = infoLog; free(infoLog); return log; } return "<Blank Log>"; } and the shaders I'm loading: void main(void) { gl_FragColor = vec4(1.0, 0.0, 0.0, 1.0); } void main(void) { gl_Position = ftransform(); } In short I get From: ShaderCasher.cpp, In: loadShader(), Subject: Shader did not compile Message: The shader Data/Shaders/Standard/standard.vs failed to compile, reporting the error - <Blank Log> for every shader I compile I've tried replacing the file reading with just a hard coded string but I get the same error so there must be something wrong with how I'm compiling them. I have run and compiled example programs with shaders, so I doubt my drivers are the issue, but in any case I'm on a Nvidia 8600m GT. Can anyone help?

    Read the article

  • GCC problem with raw double type comparisons

    - by Monomer
    I have the following bit of code, however when compiling it with GCC 4.4 with various optimization flags I get some unexpected results when its run. #include <iostream> int main() { const unsigned int cnt = 10; double lst[cnt] = { 0.0 }; const double v[4] = { 131.313, 737.373, 979.797, 731.137 }; for(unsigned int i = 0; i < cnt; ++i) { lst[i] = v[i % 4] * i; } for(unsigned int i = 0; i < cnt; ++i) { double d = v[i % 4] * i; if(lst[i] != d) { std::cout << "error @ : " << i << std::endl; return 1; } } return 0; } when compiled with: "g++ -pedantic -Wall -Werror -O1 -o test test.cpp" I get the following output: "error @ : 3" when compiled with: "g++ -pedantic -Wall -Werror -O2 -o test test.cpp" I get the following output: "error @ : 3" when compiled with: "g++ -pedantic -Wall -Werror -O3 -o test test.cpp" I get no errors when compiled with: "g++ -pedantic -Wall -Werror -o test test.cpp" I get no errors I do not believe this to be an issue related to rounding, or epsilon difference in the comparison. I've tried this with Intel v10 and MSVC 9.0 and they all seem to work as expected. I believe this should be nothing more than a bitwise compare. If I replace the if-statement with the following: if (static_cast<long long int>(lst[i]) != static_cast<long long int>(d)), and add "-Wno-long-long" I get no errors in any of the optimization modes when run. If I add std::cout << d << std::endl; before the "return 1", I get no errors in any of the optimization modes when run. Is this a bug in my code, or is there something wrong with GCC and the way it handles the double type?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Need help simplifying my php table

    - by user342391
    I am relatively new to php and have a feeling that I am going the long way round when displaying data from mysql. I have a table a I want to show a few fields from my database. How would I achieve this without having to echo every bit of the table??? Here is the code: <?php $query1 = mysql_send("SELECT firstname, lastname, email, user, country FROM customers WHERE id='".$_COOKIE['custid']."'"); while ($row = mysql_fetch_array($query1)) { echo ' <table id="account_table" style="width:550px; border:none; "> <tr> <td width="155">Contact Name</td>'; echo '<td width="335">'; echo $row['firstname'] ; echo '&nbsp;'; echo $row['lastname']; echo '</td> </tr> <tr> <td>Email Address</td> <td>'; echo $row['email']; echo ' </td> </tr> <tr> <td>Username</td> <td>' ; echo $row['user']; echo '</td> </tr> <tr> <td>Country</td> <td>'; echo $row['country']; echo '</td> </tr> <tr> <td>Time Zone</td> <td>GMT+1</td> </tr> <tr> <td>Activated</td> <td>16 Dec 2009</td> </tr> </table>'; } ?>

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • HTTP Post requests using HttpClient take 2 seconds, why?

    - by pableu
    Update: You might better hold off this for a bit, I just noticed I could be my fault after all. Working on this all afternoon, and then I find a flaw ten minutes after posting here, ts. Hi, I'am currently coding an android app that submits stuff in the background using HTTP Post and AsyncTask. I use the org.apache.http.client Package for this. I based my code on this example. Basically, my code looks like this: public void postData() { // Create a new HttpClient and Post Header HttpClient httpclient = new DefaultHttpClient(); HttpPost httppost = new HttpPost("http://192.168.1.137:8880/form"); try { List<NameValuePair> nameValuePairs = new ArrayList<NameValuePair>(2); nameValuePairs.add(new BasicNameValuePair("id", "12345")); nameValuePairs.add(new BasicNameValuePair("stringdata", "AndDev is Cool!")); httppost.setEntity(new UrlEncodedFormEntity(nameValuePairs)); // Execute HTTP Post Request HttpResponse response = httpclient.execute(httppost); } catch (ClientProtocolException e) { Log.e(TAG,e.toString()); } catch (IOException e) { Log.e(TAG,e.toString()); } } The problem is that the httpclient.execute(..) line takes around 1.5 to 3 seconds, and I do not understand why. Just requesting a page with HTTP Get takes around 80 ms or so, so the problem doesn't seem to be the network latency itself. The problem doesn't seem to be on the server side either, I have also tried POSTing data to http://www.disney.com/ with similarly slow results. And Firebug shows 1 ms response time when POSTing data to my server locally. This happens on the Emulator and with my Nexus One (both with Android 2.2). If you want to look at the complete code, I've put it on GitHub. It's just a dummy program to do HTTP Post in the background using AsyncTask on the push of a button. It's my first Android app, and my first java code for a long time. And incidentially, also my first question on Stackoverflow ;-) Any ideas why httpclient.execute(httppost) takes so long?

    Read the article

< Previous Page | 877 878 879 880 881 882 883 884 885 886 887 888  | Next Page >