Search Results

Search found 24935 results on 998 pages for 'test utilities'.

Page 939/998 | < Previous Page | 935 936 937 938 939 940 941 942 943 944 945 946  | Next Page >

  • How can I embed a conditional comment for IE with innerHTML?

    - by Samuel Charpentier
    Ok so I want to conditionally add this line of code; <!--[if ! IE]> <embed src="logo.svg" type="image/svg+xml" /> <![endif]--> Using: document.getElementById("logo") .innerHTML='...'; In a if()/else() statement and it don't write it! If i get rid of the selective comment ( <!--[if ! IE]><![endif]-->) and only put the SVG ( <embed src="logo.svg" type="image/svg+xml" /> ) it work! what should I do? I found a way around but i think in the Android browser the thing will pop up twice. here's what I've done ( and its Validated stuff!); <!DOCTYPE html> <html> <head> <META CHARSET="UTF-8"> <title>SVG Test</title> <script type="text/javascript"> //<![CDATA[ onload=function() { var ua = navigator.userAgent.toLowerCase(); var isAndroid = ua.indexOf("android") > -1; //&& ua.indexOf("mobile"); if(isAndroid) { document.getElementById("logo").innerHTML='<img src="fin_palais.png"/>'; } } //]]> </script> </head> <body> <div id="logo"> <!--[if lt IE 9]> <img src="fin_palais.png"/> <![endif]--> <!--[if gte IE 9]><!--> <embed src="fin_palais.svg" type="image/svg+xml" /> <!--<![endif]--> </div> </body>

    Read the article

  • ReadFile doesn't work asynchronously on Win7 and Win2k8

    - by f0b0s
    According to MSDN ReadFile can read data 2 different ways: synchronously and asynchronously. I need the second one. The folowing code demonstrates usage with OVERLAPPED struct: #include <windows.h> #include <stdio.h> #include <time.h> void Read() { HANDLE hFile = CreateFileA("c:\\1.avi", GENERIC_READ, 0, NULL, OPEN_EXISTING, FILE_FLAG_OVERLAPPED, NULL); if ( hFile == INVALID_HANDLE_VALUE ) { printf("Failed to open the file\n"); return; } int dataSize = 256 * 1024 * 1024; char* data = (char*)malloc(dataSize); memset(data, 0xFF, dataSize); OVERLAPPED overlapped; memset(&overlapped, 0, sizeof(overlapped)); printf("reading: %d\n", time(NULL)); BOOL result = ReadFile(hFile, data, dataSize, NULL, &overlapped); printf("sent: %d\n", time(NULL)); DWORD bytesRead; result = GetOverlappedResult(hFile, &overlapped, &bytesRead, TRUE); // wait until completion - returns immediately printf("done: %d\n", time(NULL)); CloseHandle(hFile); } int main() { Read(); } On Windows XP output is: reading: 1296651896 sent: 1296651896 done: 1296651899 It means that ReadFile didn't block and returned imediatly at the same second, whereas reading process continued for 3 seconds. It is normal async reading. But on windows 7 and windows 2008 I get following results: reading: 1296661205 sent: 1296661209 done: 1296661209. It is a behavior of sync reading. MSDN says that async ReadFile sometimes can behave as sync (when the file is compressed or encrypted for example). But the return value in this situation should be TRUE and GetLastError() == NO_ERROR. On Windows 7 I get FALSE and GetLastError() == ERROR_IO_PENDING. So WinApi tells me that it is an async call, but when I look at the test I see that it is not! I'm not the only one who found this "bug": read the comment on ReadFile MSDN page. So what's the solution? Does anybody know? It is been 14 months after Denis found this strange behavior.

    Read the article

  • Unsure how to design JavaScript / jQuery functionality which uses XML to create HTML objects

    - by Jack Roscoe
    Hi, I'm using JavScript and jQuery to read an XML document and subsequently use the information from the XML to create HTML objects. The main 'C' nodes in the XML document all have a type attribute, and depending on the type I want to run a function which will create a new html object using the other attributes assigned to that particular 'C' node node. Currently, I have a for loop which extracts each 'C' node from the XML and also it's attributes (e.g. width, height, x, y). Also inside the for loop, I have an if statement which checks the 'type' attribute of the current 'C' node being processed, and depending on the type it will run a different function which will then create a new HTML object with the attributes which have been drawn from the XML. The problem is that there may be more than one 'C' node of the same type, so for example when I'm creating the function that will run when a 'C' node of 'type=1' is detected, I cannot use the 'var p = document.createElement('p')' because if a 'C' node of the same type comes up later in the loop it will clash and override that element with that variable that has just been created. I'm not really sure how to approach this? Here is my entire script. If you need me to elaborate on any parts please ask, I'm sure it's not written in the nicest possible way: var arrayIds = new Array(); $(document).ready(function(){ $.ajax({ type: "GET", url: "question.xml", dataType: "xml", success: function(xml) { $(xml).find("C").each(function(){ arrayIds.push($(this).attr('ID')); }); var svgTag = document.createElement('SVG'); // Create question type objects function ctyp3(x,y,width,height,baC) { alert('test'); var r = document.createElement('rect'); r.x = x; r.y = y; r.width = width; r.height = height; r.fillcolor = baC; svgTag.appendChild(r); } // Extract question data from XML var questions = []; for (j=0; j<arrayIds.length; j++) { $(xml).find("C[ID='" + arrayIds[j] + "']").each(function(){ // pass values questions[j] = { typ: $(this).attr('typ'), width: $(this).find("I").attr('wid'), height: $(this).find("I").attr('hei'), x: $(this).find("I").attr('x'), y: $(this).find("I").attr('x'), baC: $(this).find("I").attr('baC'), boC: $(this).find("I").attr('boC'), boW: $(this).find("I").attr('boW') } alert($(this).attr('typ')); if ($(this).attr('typ') == '3') { ctyp3(x,y,width,height,baC); // alert('pass'); } else { // Add here // alert('fail'); } }); } } }); });

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • How to list all duplicated rows which may include NULL columns?

    - by Yousui
    Hi guys, I have a problem of listing duplicated rows that include NULL columns. Lemme show my problem first. USE [tempdb]; GO IF OBJECT_ID(N'dbo.t') IS NOT NULL BEGIN DROP TABLE dbo.t END GO CREATE TABLE dbo.t ( a NVARCHAR(8), b NVARCHAR(8) ); GO INSERT t VALUES ('a', 'b'); INSERT t VALUES ('a', 'b'); INSERT t VALUES ('a', 'b'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('e', NULL); INSERT t VALUES (NULL, NULL); INSERT t VALUES (NULL, NULL); INSERT t VALUES (NULL, NULL); INSERT t VALUES (NULL, NULL); GO Now I want to show all rows that have other rows duplicated with them, I use the following query. SELECT a, b FROM dbo.t GROUP BY a, b HAVING count(*) > 1 which will give us the result: a b -------- -------- NULL NULL a b c d Now if I want to list all rows that make contribution to duplication, I use this query: WITH duplicate (a, b) AS ( SELECT a, b FROM dbo.t GROUP BY a, b HAVING count(*) > 1 ) SELECT dbo.t.a, dbo.t.b FROM dbo.t INNER JOIN duplicate ON (dbo.t.a = duplicate.a AND dbo.t.b = duplicate.b) Which will give me the result: a b -------- -------- a b a b a b c d c d c d c d As you can see, all rows include NULLs are filtered. The reason I thought is that I use equal sign to test the condition(dbo.t.a = duplicate.a AND dbo.t.b = duplicate.b), and NULLs cannot be compared use equal sign. So, in order to include rows that include NULLs in it in the last result, I have change the aforementioned query to WITH duplicate (a, b) AS ( SELECT a, b FROM dbo.t GROUP BY a, b HAVING count(*) > 1 ) SELECT dbo.t.a, dbo.t.b FROM dbo.t INNER JOIN duplicate ON (dbo.t.a = duplicate.a AND dbo.t.b = duplicate.b) OR (dbo.t.a IS NULL AND duplicate.a IS NULL AND dbo.t.b = duplicate.b) OR (dbo.t.b IS NULL AND duplicate.b IS NULL AND dbo.t.a = duplicate.a) OR (dbo.t.a IS NULL AND duplicate.a IS NULL AND dbo.t.b IS NULL AND duplicate.b IS NULL) And this query will give me the answer as I wanted: a b -------- -------- NULL NULL NULL NULL NULL NULL NULL NULL a b a b a b c d c d c d c d Now my question is, as you can see, this query just include two columns, in order to include NULLs in the last result, you have to use many condition testing statements in the query. As the column number increasing, the condition testing statements you need in your query is increasing astonishingly. How can I solve this problem? Great thanks.

    Read the article

  • Stuck in Infinite Loop while PostInvalidating

    - by Nicholas Roge
    I'm trying to test something, however, the loop I'm using keeps getting stuck while running. It's just a basic lock thread while doing something else before continuing kind of loop. I've double checked that I'm locking AND unlocking the variable I'm using, but regardless it's still stuck in the loop. Here are the segments of code I have that cause the problem: ActualGame.java: Thread thread=new Thread("Dialogue Thread"){ @Override public void run(){ Timer fireTimer=new Timer(); int arrowSequence=0; gameHandler.setOnTouchListener( new OnTouchListener(){ @Override public boolean onTouch(View v, MotionEvent me) { //Do something. if(!gameHandler.fireTimer.getActive()){ exitLoop=true; } return false; } } ); while(!exitLoop){ while(fireTimer.getActive()||!gameHandler.drawn); c.drawBitmap(SpriteSheet.createSingleBitmap(getResources(), R.drawable.dialogue_box,240,48),-48,0,null); c.drawBitmap(SpriteSheet.createSingleBitmap(getResources(),R.drawable.dialogue_continuearrow,32,16,8,16,arrowSequence,0),-16,8,null); gameHandler.drawn=false; gameHandler.postInvalidate(); if(arrowSequence+1==4){ arrowSequence=0; exitLoop=true; }else{ arrowSequence++; } fireTimer.startWait(100); } gameHandler.setOnTouchListener(gameHandler.defaultOnTouchListener); } }; thread.run(); And the onDraw method of GameHandler: canvas.scale(scale,scale); canvas.translate(((screenWidth/2)-((terrainWidth*scale)/2))/scale,((screenHeight/2)-((terrainHeight*scale)/2))/scale); canvas.drawColor(Color.BLACK); for(int layer=0;layer(less than)tiles.length;layer++){ if(layer==playerLayer){ canvas.drawBitmap(playerSprite.getCurrentSprite(), playerSprite.getPixelLocationX(), playerSprite.getPixelLocationY(), null); continue; } for(int y=0;y(less than)tiles[layer].length;y++){ for(int x=0;x(less than)tiles[layer][y].length;x++){ if(layer==0&&tiles[layer][y][x]==null){ tiles[layer][y][x]=nullTile; } if(tiles[layer][y][x]!=null){ runningFromTileEvent=false; canvas.drawBitmap(tiles[layer][y][x].associatedSprite.getCurrentSprite(),x*tiles[layer][y][x].associatedSprite.spriteWidth,y*tiles[layer][y][x].associatedSprite.spriteHeight,null); } } } } for(int i=0;i(less than)canvasEvents.size();i++){ if(canvasEvents.elementAt(i).condition(this)){ canvasEvents.elementAt(i).run(canvas,this); } } Log.e("JapaneseTutor","Got here.[1]"); drawn=true; Log.e("JapaneseTutor","Got here.[2]"); If you need to see the Timer class, or the full length of the GameHandler or ActualGame classes, just let me know.

    Read the article

  • XML pass values to timer, AS3

    - by VideoDnd
    My timer has three variables that I can trace to the output window, but don't know how to pass them to the timer. How to I pass the XML values to my timer? Purpose I want to test with an XML document, before I try connecting it to an XML socket. myXML <?xml version="1.0" encoding="utf-8"?> <SESSION> <TIMER TITLE="speed">100</TIMER> <COUNT TITLE="starting position">-77777</COUNT> <FCOUNT TITLE="ramp">1000</FCOUNT> </SESSION> myFlash //myTimer 'instance of mytext on stage' /* fields I want to change with XML */ //CHANGE TO 100 var timer:Timer = new Timer(10); //CHANGE TO -77777 var count:int = 0; //CHANGE TO 1000 var fcount:int = 0; timer.addEventListener(TimerEvent.TIMER, incrementCounter); timer.start(); function incrementCounter(event:TimerEvent) { count++; fcount=int(count*count/1000);//starts out slow... then speeds up mytext.text = formatCount(fcount); } function formatCount(i:int):String { var fraction:int = i % 100; var whole:int = i / 100; return ("0000000" + whole).substr(-7, 7) + "." + (fraction < 10 ? "0" + fraction : fraction); } //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.ROGUE.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.TIMER.*; text.textColor = 0xFF0000; addChild(text); } RESOURCES OReilly's ActionScript 3.0 Cookbook, Chapter 12 Strings, Chapter 20 XML

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • jQuery Validator's "required" not working when value is set at statup

    - by nandrew
    Hello, I have a problem with jQuery Validator. I want to use "required" property on a text input. It doesn't work when input has set value attribute by HTML code (tested on Firefox (3.5), and on IE 8 - on IE it works a bit better). Story: 1. Page loads; 2. value is cleared; 3. focus is changed. 4. Nothing happens but the error message should be displayed; 5. getting back to the field and typing some characters. 6. changing focus; 7. getting back to the field; 8. clearing the field. 9. Error is displayed even before leaving the field. The HTML code: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <head> <script src="Web/Scripts/jquery-1.3.2.min.js" type="text/javascript"></script> <script src="Web/Scripts/jquery.validate.js" type="text/javascript"></script> </head> <body> <form id="form1"> <input type="text" id="name1" name="name1" value="test" /><br /> <input type="text" /> </form> <script type="text/javascript"> $(document).ready(function() { var validator = $("form").validate({ rules: { name1: { required: true, minlength: 2 } }, messages: { name1: "bad name" }, }); }); </script> </body> </html>

    Read the article

  • Problem Fetching JSON Result with jQuery in Firefox and Chrome (IE8 Works)

    - by senfo
    I'm attempting to parse JSON using jQuery and I'm running into issues. Using the code below, the data keeps coming back null: <!DOCTYPE html> <html> <head> <title>JSON Test</title> </head> <body> <div id="msg"></div> <script src="http://code.jquery.com/jquery-latest.js"></script> <script> $.ajax({ url: 'http://datawarehouse.hrsa.gov/ReleaseTest/HGDWDataWebService/HGDWDataService.aspx?service=HC&zip=20002&radius=10&filter=8357&format=JSON', type: 'GET', dataType: 'json', success: function(data) { $('#msg').html(data[0].title); // Always null in Firefox/Chrome. Works in IE8. }, error: function(data) { alert(data); } }); </script> </body> </html> The JSON results look like the following: {"title":"HEALTHPOINT TYEE CAMPUS","link":"http://www.healthpointchc.org","id":"tag:datawarehouse.hrsa.gov,2010-04-29:/8357","org":"HEALTHPOINT TYEE CAMPUS","address":{"street-address":"4424 S. 188TH St.","locality":"Seatac","region":"Washington","postal-code":"98188-5028"},"tel":"206-444-7746","category":"Service Delivery Site","location":"47.4344818181818 -122.277672727273","update":"2010-04-28T00:00:00-05:00"} If I replace my URL with the Flickr API URL (http://api.flickr.com/services/feeds/photos_public.gne?tags=cat&tagmode=any&format=json&jsoncallback=?), I get back a valid JSON result that I am able to make use of. I have successfully validated my JSON at JSONLint, so I've run out of ideas as to what I might be doing wrong. Any thoughts? Update: I had the client switch the content type to application/json. Unfortunately, I'm still experiencing the exact same problem. I also updated my HTML and included the live URL I've been working with. Update 2: I just gave this a try in IE8 and it works fine. For some reason, it doesn't work in either Firefox 3.6.3 or Chrome 4.1.249.1064 (45376). I did notice a mistake with the data being returned (the developer is returning a collection of data, even for queries that will always return a single record), but it still baffles me why it doesn't work in other browsers. It might be important to note that I am working from an HTML file on my local file system. I thought it might be a XSS issue, but that doesn't explain why Flickr works.

    Read the article

  • mysql timeout - c/C++

    - by user1262876
    Guys i'm facing a problem with this code, the problem is the timeout by timeout i mean the time it takes the program to tell me if the server is connected or not. If i use my localhost i get the answer fast, but when i connect to outside my localhost it takes 50sc - 1.5 min to response and the program frezz until it done. HOw can i fix the frezzing, or make my own timeout, like if still waiting after 50sc, tell me connection failed and stop? please use codes as help, becouse i would understand it better, thanks for any help i get PS: USING MAC #include "mysql.h" #include <stdio.h> #include <stdlib.h> // Other Linker Flags: -lmysqlclient -lm -lz // just going to input the general details and not the port numbers struct connection_details { char *server; char *user; char *password; char *database; }; MYSQL* mysql_connection_setup(struct connection_details mysql_details) { // first of all create a mysql instance and initialize the variables within MYSQL *connection = mysql_init(NULL); // connect to the database with the details attached. if (!mysql_real_connect(connection,mysql_details.server, mysql_details.user, mysql_details.password, mysql_details.database, 0, NULL, 0)) { printf("Conection error : %s\n", mysql_error(connection)); exit(1); } return connection; } MYSQL_RES* mysql_perform_query(MYSQL *connection, char *sql_query) { // send the query to the database if (mysql_query(connection, sql_query)) { printf("MySQL query error : %s\n", mysql_error(connection)); exit(1); } return mysql_use_result(connection); } int main() { MYSQL *conn; // the connection MYSQL_RES *res; // the results MYSQL_ROW row; // the results row (line by line) struct connection_details mysqlD; mysqlD.server = (char*)"Localhost"; // where the mysql database is mysqlD.user = (char*)"root"; // the root user of mysql mysqlD.password = (char*)"123456"; // the password of the root user in mysql mysqlD.database = (char*)"test"; // the databse to pick // connect to the mysql database conn = mysql_connection_setup(mysqlD); // assign the results return to the MYSQL_RES pointer res = mysql_perform_query(conn, (char*) "SELECT * FROM me"); printf("MySQL Tables in mysql database:\n"); while ((row = mysql_fetch_row(res)) !=NULL) printf("%s - %s\n", row[0], row[1], row[2]); // <-- Rows /* clean up the database result set */ mysql_free_result(res); /* clean up the database link */ mysql_close(conn); return 0; }

    Read the article

  • how to get $form_state outside of FAPI's functions?

    - by logii
    I'm writing a custom module and I'd like to use $form_state of the current form in another non-form api function - custom_facet_view_build(). any help is appreciated :) <?php /** * Implementation of hook_perm(). */ function custom_facet_perm() { return array( 'access foo content', 'access baz content', ); } /** * Implementation of hook_menu(). */ function custom_facet_menu() { $items['faceted-search'] = array( 'title' => 'Faceted Search', 'page callback' => 'drupal_get_form', 'access arguments' => array(), ); $items['facet-search-test'] = array( 'page callback' => 'drupal_get_form', 'page arguments' => array('custom_facet_form'), 'access callback' => TRUE, 'type' => MENU_CALLBACK, ); return $items; } /** * Form definition; ahah_helper_demo form. */ function custom_facet_form($form_state) { $form = array(); ahah_helper_register($form, $form_state); if (isset($form_state['storage']['categories'])) { $categories_default_value = $form_state['storage']['categories']["#value"]; } $form['facet_search_form'] = array( '#type' => 'fieldset', '#title' => t('Faceted Search'), '#prefix' => '<div id="billing-info-wrapper">', // This is our wrapper div. '#suffix' => '</div>', '#tree' => TRUE, // Don't forget to set #tree! ); $form['facet_search_form']['categories'] = array( '#type' => 'select', '#title' => t('Category'), '#options' => _custom_facet_taxonomy_query(1), '#multiple' => TRUE, '#default_value' => $categories_default_value, ); $form['save'] = array( '#type' => 'submit', '#value' => t('Save'), ); return $form; } /** * Validate callback for the form. */ function custom_facet_form_validate($form, &$form_state) { } /** * Submit callback for the form. */ function custom_facet_form_submit($form, &$form_state) { drupal_set_message('nothing done'); $form_state['storage']['categories'] = $form['facet_search_form']['categories']; // dpm($form_state); // There's a value returned in form_state['storage] within this function } /** * Implementation of hook_views_api(). */ function custom_facet_views_api() { return array( 'api' => 2, ); } function custom_facet_view_build(&$view) { dpm($form_state); // form_state['storage] remains NULL even though there's a value on previous submission }

    Read the article

  • Output on namespaced xpath

    - by user347928
    Hi there, I have the following code and have had some trouble with a specific field and it's output. The namespace is connected but doesn't seem to be outputting on the required field. Any info on this would be great. import org.w3c.dom.Document; import org.xml.sax.SAXException; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.parsers.DocumentBuilder; import javax.xml.parsers.ParserConfigurationException; import javax.xml.xpath.XPathFactory; import javax.xml.xpath.XPath; import javax.xml.xpath.XPathExpressionException; import java.io.ByteArrayInputStream; import java.io.IOException; public class test { public static void main(String args[]) { String xmlStr = "<aws:UrlInfoResponse xmlns:aws=\"http://alexa.amazonaws.com/doc/2005-10-05/\">\n" + " <aws:Response xmlns:aws=\"http://awis.amazonaws.com/doc/2005-07-11\">\n" + " <aws:OperationRequest>\n" + " <aws:RequestId>blah</aws:RequestId>\n" + " </aws:OperationRequest>\n" + " <aws:UrlInfoResult>\n" + " <aws:Alexa>\n" + " <aws:TrafficData>\n" + " <aws:DataUrl type=\"canonical\">harvard.edu/</aws:DataUrl>\n" + " <aws:Rank>1635</aws:Rank>\n" + " </aws:TrafficData>\n" + " </aws:Alexa>\n" + " </aws:UrlInfoResult>\n" + " <aws:ResponseStatus xmlns:aws=\"http://alexa.amazonaws.com/doc/2005-10-05/\">\n" + " <aws:StatusCode>Success</aws:StatusCode>\n" + " </aws:ResponseStatus>\n" + " </aws:Response>\n" + "</aws:UrlInfoResponse>"; DocumentBuilderFactory xmlFact = DocumentBuilderFactory.newInstance(); xmlFact.setNamespaceAware(true); DocumentBuilder builder = null; try { builder = xmlFact.newDocumentBuilder(); } catch (ParserConfigurationException e) { e.printStackTrace(); } Document doc = null; try { doc = builder.parse( new ByteArrayInputStream( xmlStr.getBytes())); } catch (SAXException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } System.out.println(doc.getDocumentElement().getNamespaceURI()); System.out.println(xmlFact.isNamespaceAware()); String xpathStr = "//aws:OperationRequest"; XPathFactory xpathFact = XPathFactory.newInstance(); XPath xpath = xpathFact.newXPath(); String result = null; try { result = xpath.evaluate(xpathStr, doc); } catch (XPathExpressionException e) { e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates. } System.out.println("XPath result is \"" + result + "\""); } } Thanks Tony

    Read the article

  • Voicexml how to store input into a global variable

    - by Tyzak
    Hello, I'm creating a voicexml appliacation. I want to store an user input into a global variable. I wondered, the input should be stored in the fieldvar. shouldn't it? After I tried it with this, i tried to store it in an global variable: <assign name="myvar" expr="'myinput'"/> but somehow it didn't work. I used value expr="var" as expr. <?xml version="1.0" encoding="UTF-8"?> <vxml xmlns="http://www.w3.org/2001/vxml" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.w3.org/2001/vxml http://www.w3.org/TR/voicexml20/vxml.xsd" version="2.0"> <var name="myProdukt" /> <form id="test"> <field name="var"> <prompt bargein="true" bargeintype="hotword" >Sagen Sie ein Produkt</prompt> <grammar root="main" version="1.0" xml:lang="de-DE"> <rule id="main" scope="public"> <one-of> <item> p1 </item> <item> p2 </item> <item> p3 </item> <item> p4 </item> </one-of> </rule> </grammar> <filled> <assign name="myProdukt" expr="<value expr="var"/>"/> </filled> </field> </form> <<!--[...] Here i want to use the input.--> </vxml> thanks in advance

    Read the article

  • Google Maps API 3 How to call initialize without putting it in Body onload

    - by Bex
    Hi I am using the google maps API and have copied the examples and have ended up with a function called "initialize" that is called from the body onload. I am using the maps in a few different user controls, which are placed within content place holders, so the body tag is in the master page. Is there a way of calling initialize directly in the usercontrol rather than having to place an onload on the masterpage? Ideally I want my user control to be a stand alone control that I can just slot into pages without trying to access the master page body onload. I have tried calling the Initialize function from my page load of the user control (by adding a start up script), but the map doesn't appear. Any suggestions? My code: <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=false">/script> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript"> var map; var geocoder; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(51.8052184317649, -4.965819906250006); var myOptions = { zoom: 8, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); $.ajax({ type: "POST", url: "/GoogleMapsService.asmx/GetPointers", contentType: "application/json; charset=utf-8", dataType: "json", beforeSend: function () { $(".loadingData").html("<p>Loading data..</p>"); }, complete: function () { $(".loadingData").html(""); }, cache: true, success: mapPoints, error: onError }); } function onError(xhr, ajaxOptions, thrownError) { alert(xhr.status); alert(xhr.responseText); } function mapPoints(response) { if (response.d != null) { if (response.d.length > 0) { for (var i = 0; i < response.d.length; i++) { plotOnMap(response.d[i].Id, response.d[i].Name, response.d[i].Lat, response.d[i].Long, response.d[i].ShortDesc) } } } } and on my test master page: <body onload="initialize()"> <form runat="server"> <asp:ScriptManager ID="ScriptManager1" runat="server" EnablePageMethods="true"></asp:ScriptManager> <asp:ContentPlaceHolder ID="MainContent" runat="server"> </asp:ContentPlaceHolder> </form> </body>

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • sending email in .NET

    - by VP
    I am getting the following error when I try to send an email in my C# program. I am using Visual Studio 2008 on windows 7. I would paste my code first and then the error: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO; using System.Net; using System.Net.Mail; using System.Net.Mime; using System.Net.Sockets; using System.Web; class email_log_files { private string login_username = "my_gmail_id"; private string login_password = "my_gmail_password"; public void send_email() { string src_address = "[email protected]"; string dest_address = "[email protected]"; try { MailMessage email_msg = new MailMessage(); SmtpClient email_client = new SmtpClient(); email_msg.From = new MailAddress(src_address); email_msg.Sender = new MailAddress(src_address); email_msg.ReplyTo = new MailAddress(src_address); email_msg.To.Add(dest_address); email_msg.Subject = "Test"; email_msg.Body = "Body of the message"; NetworkCredential credentials = new NetworkCredential(login_username, login_password); email_client.Credentials = credentials; email_client.Host = "smtp.gmail.com"; email_client.Port = 465; email_client.EnableSsl = true; email_client.Send(email_msg); Console.WriteLine("Message Sent Successfully!!"); Console.ReadLine(); } catch (Exception ex) { Console.WriteLine(ex.Message.ToString()); Console.WriteLine(ex.InnerException); Console.WriteLine(ex.Source); Console.WriteLine(ex.Data); Console.ReadLine(); } } } And the error message is as follows: The operation has timed out. System System.Collections.ListDictionaryInternal Why is it always timing out? I am sure that I have the correct smtp server address and port number for gmail as I have configured my outlook with the same. Any help or ideas?

    Read the article

  • Stepping into Ruby Meta-Programming: Generating proxy methods for multiple internal methods

    - by mstksg
    Hi all; I've multiply heard Ruby touted for its super spectacular meta-programming capabilities, and I was wondering if anyone could help me get started with this problem. I have a class that works as an "archive" of sorts, with internal methods that process and output data based on an input. However, the items in the archive in the class itself are represented and processed with integers, for performance purposes. The actual items outside of the archive are known by their string representation, which is simply number_representation.to_s(36). Because of this, I have hooked up each internal method with a "proxy method" that converts the input into the integer form that the archive recognizes, runs the internal method, and converts the output (either a single other item, or a collection of them) back into strings. The naming convention is this: internal methods are represented by _method_name; their corresponding proxy method is represented by method_name, with no leading underscore. For example: class Archive ## PROXY METHODS ## ## input: string representation of id's ## output: string representation of id's def do_something_with id result = _do_something_with id.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_pair id_1,id_2 result = _do_something_with_pair id_1.to_i(36), id_2.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_these ids result = _do_something_with_these ids.map { |n| n.to_i(36) } return nil if result == nil return result.to_s(36) end def get_many_from id result = _get_many_from id return nil if result == nil # no sparse arrays returned return result.map { |n| n.to_s(36) } end ## INTERNAL METHODS ## ## input: integer representation of id's ## output: integer representation of id's def _do_something_with id # does something with one integer-represented id, # returning an id represented as an integer end def do_something_with_pair id_1,id_2 # does something with two integer-represented id's, # returning an id represented as an integer end def _do_something_with_these ids # does something with multiple integer ids, # returning an id represented as an integer end def _get_many_from id # does something with one integer-represented id, # returns a collection of id's represented as integers end end There are a couple of reasons why I can't just convert them if id.class == String at the beginning of the internal methods: These internal methods are somewhat computationally-intensive recursive functions, and I don't want the overhead of checking multiple times at every step There is no way, without adding an extra parameter, to tell whether or not to re-convert at the end I want to think of this as an exercise in understanding ruby meta-programming Does anyone have any ideas? edit The solution I'd like would preferably be able to take an array of method names @@PROXY_METHODS = [:do_something_with, :do_something_with_pair, :do_something_with_these, :get_many_from] iterate through them, and in each iteration, put out the proxy method. I'm not sure what would be done with the arguments, but is there a way to test for arguments of a method? If not, then simple duck typing/analogous concept would do as well.

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • Wordpress pages address rewrite

    - by kemp
    UPDATE I tried using the internal wordpress rewrite. What I have to do is an address like this: http://example.com/galleria/artist-name sent to the gallery.php page with a variable containing the artist-name. I used these rules as per Wordpress' documentation: // REWRITE RULES (per gallery) {{{ add_filter('rewrite_rules_array','wp_insertMyRewriteRules'); add_filter('query_vars','wp_insertMyRewriteQueryVars'); add_filter('init','flushRules'); // Remember to flush_rules() when adding rules function flushRules(){ global $wp_rewrite; $wp_rewrite->flush_rules(); } // Adding a new rule function wp_insertMyRewriteRules($rules) { $newrules = array(); $newrules['(galleria)/(.*)$'] = 'index.php?pagename=gallery&galleryname=$matches[2]'; return $newrules + $rules; } // Adding the id var so that WP recognizes it function wp_insertMyRewriteQueryVars($vars) { array_push($vars, 'galleryname'); return $vars; } what's weird now is that on my local wordpress test install, that works fine: the gallery page is called and the galleryname variable is passed. On the real site, on the other hand, the initial URL is accepted (as in it doesn't go into a 404) BUT it changes to http://example.com/gallery (I mean it actually changes in the browser's address bar) and the variable is not defined in gallery.php. Any idea what could possibly cause this different behavior? Alternatively, any other way I couldn't think of which could achieve the same effect described in the first three lines is perfectly fine. Old question What I need to do is rewriting this address: (1) http://localhost/wordpress/fake/text-value to (2) http://localhost/wordpress/gallery?somevar=text-value Notes: the remapping must be transparent: the user always has to see address (1) gallery is a permalink to a wordpress page, not a real address I basically need to rewrite the address first (to modify it) and then feed it back to mod rewrite again (to let wordpress parse it its own way). Problems if I simply do RewriteRule ^fake$ http://localhost/wordpress/gallery [L] it works but the address in the browser changes, which is no good, if I do RewriteRule ^fake$ /wordpress/gallery [L] I get a 404. I tried different flags instead of [L] but to no avail. How can I get this to work? EDIT: full .htaccess # BEGIN WordPress <IfModule mod_rewrite.c> RewriteEngine On RewriteRule ^fake$ /wordpress/gallery [R] RewriteBase /wordpress/ RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule . /wordpress/index.php [L] </IfModule> # END WordPress

    Read the article

< Previous Page | 935 936 937 938 939 940 941 942 943 944 945 946  | Next Page >