Search Results

Search found 21524 results on 861 pages for 'multiple matches'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 345/861 | < Previous Page | 341 342 343 344 345 346 347 348 349 350 351 352  | Next Page >

  • Exact matching of strings in SPARQL?

    - by Taz
    I have this query. It match anything which has "South in its Name". But I only want the one whose foaf:name exactly matches "South" SELECT Distinct ?TypeLabel Where { ?a foaf:name "South". ?a rdf:type ?Type. ?Type rdfs:label ?TypeLabel. }

    Read the article

  • Asynchronous Webcrawling F#, something wrong ?

    - by jlezard
    Not quite sure if it is ok to do this but, my question is: Is there something wrong with my code ? It doesn't go as fast as I would like, and since I am using lots of async workflows maybe I am doing something wrong. The goal here is to build something that can crawl 20 000 pages in less than an hour. open System open System.Text open System.Net open System.IO open System.Text.RegularExpressions open System.Collections.Generic open System.ComponentModel open Microsoft.FSharp open System.Threading //This is the Parallel.Fs file type ComparableUri ( uri: string ) = inherit System.Uri( uri ) let elts (uri:System.Uri) = uri.Scheme, uri.Host, uri.Port, uri.Segments interface System.IComparable with member this.CompareTo( uri2 ) = compare (elts this) (elts(uri2 :?> ComparableUri)) override this.Equals(uri2) = compare this (uri2 :?> ComparableUri ) = 0 override this.GetHashCode() = 0 ///////////////////////////////////////////////Funtions to retreive html string////////////////////////////// let mutable error = Set.empty<ComparableUri> let mutable visited = Set.empty<ComparableUri> let getHtmlPrimitiveAsyncDelay (delay:int) (uri : ComparableUri) = async{ try let req = (WebRequest.Create(uri)) :?> HttpWebRequest // 'use' is equivalent to ‘using’ in C# for an IDisposable req.UserAgent<-"Mozilla" //Console.WriteLine("Waiting") do! Async.Sleep(delay * 250) let! resp = (req.AsyncGetResponse()) Console.WriteLine(uri.AbsoluteUri+" got response after delay "+string delay) use stream = resp.GetResponseStream() use reader = new StreamReader(stream) let html = reader.ReadToEnd() return html with | _ as ex -> Console.WriteLine( ex.ToString() ) lock error (fun () -> error<- error.Add uri ) lock visited (fun () -> visited<-visited.Add uri ) return "BadUri" } ///////////////////////////////////////////////Active Pattern Matching to retreive href////////////////////////////// let (|Matches|_|) (pat:string) (inp:string) = let m = Regex.Matches(inp, pat) // Note the List.tl, since the first group is always the entirety of the matched string. if m.Count > 0 then Some (List.tail [ for g in m -> g.Value ]) else None let (|Match|_|) (pat:string) (inp:string) = let m = Regex.Match(inp, pat) // Note the List.tl, since the first group is always the entirety of the matched string. if m.Success then Some (List.tail [ for g in m.Groups -> g.Value ]) else None ///////////////////////////////////////////////Find Bad href////////////////////////////// let isEmail (link:string) = link.Contains("@") let isMailto (link:string) = if Seq.length link >=6 then link.[0..5] = "mailto" else false let isJavascript (link:string) = if Seq.length link >=10 then link.[0..9] = "javascript" else false let isBadUri (link:string) = link="BadUri" let isEmptyHttp (link:string) = link="http://" let isFile (link:string)= if Seq.length link >=6 then link.[0..5] = "file:/" else false let containsPipe (link:string) = link.Contains("|") let isAdLink (link:string) = if Seq.length link >=6 then link.[0..5] = "adlink" elif Seq.length link >=9 then link.[0..8] = "http://adLink" else false ///////////////////////////////////////////////Find Bad href////////////////////////////// let getHref (htmlString:string) = let urlPat = "href=\"([^\"]+)" match htmlString with | Matches urlPat urls -> urls |> List.map( fun href -> match href with | Match (urlPat) (link::[]) -> link | _ -> failwith "The href was not in correct format, there was more than one match" ) | _ -> Console.WriteLine( "No links for this page" );[] |> List.filter( fun link -> not(isEmail link) ) |> List.filter( fun link -> not(isMailto link) ) |> List.filter( fun link -> not(isJavascript link) ) |> List.filter( fun link -> not(isBadUri link) ) |> List.filter( fun link -> not(isEmptyHttp link) ) |> List.filter( fun link -> not(isFile link) ) |> List.filter( fun link -> not(containsPipe link) ) |> List.filter( fun link -> not(isAdLink link) ) let treatAjax (href:System.Uri) = let link = href.ToString() let firstPart = (link.Split([|"#"|],System.StringSplitOptions.None)).[0] new Uri(firstPart) //only follow pages with certain extnsion or ones with no exensions let followHref (href:System.Uri) = let valid2 = set[".py"] let valid3 = set[".php";".htm";".asp"] let valid4 = set[".php3";".php4";".php5";".html";".aspx"] let arrLength = href.Segments |> Array.length let lastExtension = (href.Segments).[arrLength-1] let lengthLastExtension = Seq.length lastExtension if (lengthLastExtension <= 3) then not( lastExtension.Contains(".") ) else //test for the 2 case let last4 = lastExtension.[(lengthLastExtension-1)-3..(lengthLastExtension-1)] let isValid2 = valid2|>Seq.exists(fun validEnd -> last4.EndsWith( validEnd) ) if isValid2 then true else if lengthLastExtension <= 4 then not( last4.Contains(".") ) else let last5 = lastExtension.[(lengthLastExtension-1)-4..(lengthLastExtension-1)] let isValid3 = valid3|>Seq.exists(fun validEnd -> last5.EndsWith( validEnd) ) if isValid3 then true else if lengthLastExtension <= 5 then not( last5.Contains(".") ) else let last6 = lastExtension.[(lengthLastExtension-1)-5..(lengthLastExtension-1)] let isValid4 = valid4|>Seq.exists(fun validEnd -> last6.EndsWith( validEnd) ) if isValid4 then true else not( last6.Contains(".") ) && not(lastExtension.[0..5] = "mailto") //Create the correct links / -> add the homepage , make them a comparabel Uri let hrefLinksToUri ( uri:ComparableUri ) (hrefLinks:string list) = hrefLinks |> List.map( fun link -> try if Seq.length link <4 then Some(new Uri( uri, link )) else if link.[0..3] = "http" then Some(new Uri(link)) else Some(new Uri( uri, link )) with | _ as ex -> Console.WriteLine(link); lock error (fun () ->error<-error.Add uri) None ) |> List.filter( fun link -> link.IsSome ) |> List.map( fun o -> o.Value) |> List.map( fun uri -> new ComparableUri( string uri ) ) //Treat uri , removing ajax last part , and only following links specified b Benoit let linksToFollow (hrefUris:ComparableUri list) = hrefUris |>List.map( treatAjax ) |>List.filter( fun link -> followHref link ) |>List.map( fun uri -> new ComparableUri( string uri ) ) |>Set.ofList let needToVisit uri = ( lock visited (fun () -> not( visited.Contains uri) ) ) && (lock error (fun () -> not( error.Contains uri) )) let getLinksToFollowAsyncDelay (delay:int) ( uri: ComparableUri ) = async{ let! links = getHtmlPrimitiveAsyncDelay delay uri lock visited (fun () ->visited<-visited.Add uri) let linksToFollow = getHref links |> hrefLinksToUri uri |> linksToFollow |> Set.filter( needToVisit ) |> Set.map( fun link -> if uri.Authority=link.Authority then link else link ) return linksToFollow } //Add delays if visitng same authority let getDelay(uri:ComparableUri) (authorityDelay:Dictionary<string,int>) = let uriAuthority = uri.Authority let hasAuthority,delay = authorityDelay.TryGetValue(uriAuthority) if hasAuthority then authorityDelay.[uriAuthority] <-delay+1 delay else authorityDelay.Add(uriAuthority,1) 0 let rec getLinksToFollowFromSetAsync maxIteration ( uris: seq<ComparableUri> ) = let authorityDelay = Dictionary<string,int>() if maxIteration = 100 then Console.WriteLine("Finished") else //Unite by authority add delay for those we same authority others ignore let stopwatch= System.Diagnostics.Stopwatch() stopwatch.Start() let newLinks = uris |> Seq.map( fun uri -> let delay = lock authorityDelay (fun () -> getDelay uri authorityDelay ) getLinksToFollowAsyncDelay delay uri ) |> Async.Parallel |> Async.RunSynchronously |> Seq.concat stopwatch.Stop() Console.WriteLine("\n\n\n\n\n\n\nTimeElapse : "+string stopwatch.Elapsed+"\n\n\n\n\n\n\n\n\n") getLinksToFollowFromSetAsync (maxIteration+1) newLinks getLinksToFollowFromSetAsync 0 (seq[ComparableUri( "http://twitter.com/" )]) Console.WriteLine("Finished") Some feedBack would be great ! Thank you (note this is just something I am doing for fun)

    Read the article

  • Does REGEX differ from PHP to Python

    - by daemonfire300
    hi there, I found this post: http://stackoverflow.com/questions/118143/python-regex-vs-php-regex but I actually did not get if Python's REGEX syntax matches PHP's REGEX syntax. I started to convert some of my old PHP code to python (due to g's appengine etc.), and now I would like to know whether the regex is 100% convertable, by simple copy & paste. regards,

    Read the article

  • How to optimize Core Data query for full text search

    - by dk
    Can I optimize a Core Data query when searching for matching words in a text? (This question also pertains to the wisdom of custom SQL versus Core Data on an iPhone.) I'm working on a new (iPhone) app that is a handheld reference tool for a scientific database. The main interface is a standard searchable table view and I want as-you-type response as the user types new words. Words matches must be prefixes of words in the text. The text is composed of 100,000s of words. In my prototype I coded SQL directly. I created a separate "words" table containing every word in the text fields of the main entity. I indexed words and performed searches along the lines of SELECT id, * FROM textTable JOIN (SELECT DISTINCT textTableId FROM words WHERE word BETWEEN 'foo' AND 'fooz' ) ON id=textTableId LIMIT 50 This runs very fast. Using an IN would probably work just as well, i.e. SELECT * FROM textTable WHERE id IN (SELECT textTableId FROM words WHERE word BETWEEN 'foo' AND 'fooz' ) LIMIT 50 The LIMIT is crucial and allows me to display results quickly. I notify the user that there are too many to display if the limit is reached. This is kludgy. I've spent the last several days pondering the advantages of moving to Core Data, but I worry about the lack of control in the schema, indexing, and querying for an important query. Theoretically an NSPredicate of textField MATCHES '.*\bfoo.*' would just work, but I'm sure it will be slow. This sort of text search seems so common that I wonder what is the usual attack? Would you create a words entity as I did above and use a predicate of "word BEGINSWITH 'foo'"? Will that work as fast as my prototype? Will Core Data automatically create the right indexes? I can't find any explicit means of advising the persistent store about indexes. I see some nice advantages of Core Data in my iPhone app. The faulting and other memory considerations allow for efficient database retrievals for tableview queries without setting arbitrary limits. The object graph management allows me to easily traverse entities without writing lots of SQL. Migration features will be nice in the future. On the other hand, in a limited resource environment (iPhone) I worry that an automatically generated database will be bloated with metadata, unnecessary inverse relationships, inefficient attribute datatypes, etc. Should I dive in or proceed with caution?

    Read the article

  • Server unable to find public folder in rails 3 production environment

    - by James
    Hi, I'm using the latest rails 3 beta. The app works fine in development mode, but when I start the server in production mode via rails server -e production, it seems that the public folder can't be found. I get error messages like: ActionController::RoutingError (No route matches "/javascripts/jquery.js"): And similar messages for everything that should be in the public folder. I've tried this with both mongrel and webrick. I'd appreciate any help.

    Read the article

  • How to quickly search an array of objects in Objective-C

    - by randombits
    Is there a way in Objective-C to search an array of objects by the contained object's properties if the properties are of type string? For instance, I have an NSArray of Person objects. Person has two properties, NSString *firstName and NSString *lastName. What's the best way to search through the array to find everyone who matches 'Ken' anywhere in the firstName OR lastName properties?

    Read the article

  • find words in a hashset or treeset?

    - by icelated
    I am piping in a file and storing it into a treeset. I am trying to count unique words.. I am placing words that i dont want into a hashset. "a","the", "and" I want to check to see if the file contains those words, before i place them into the TreeSet.. i know i need some sort of if(word == find) ? i just dont know how to do it.. Sorry about formatting. its hard to get it correct after you paste. this is what i have.. import java.util.Scanner; import java.util.ArrayList; import java.util.TreeSet; import java.util.Iterator; import java.util.HashSet; public class Project1 { public static void main(String[] args) { Scanner sc = new Scanner(System.in); String word; String grab; int count = 0; int count2 =0; int count3 =0; int count4 =0; int number; TreeSet<String> a = new TreeSet<String>(); HashSet<String> find = new HashSet<String>(); System.out.println("Project 1\n"); find.add("a"); find.add("and"); find.add("the"); while (sc.hasNext()) { word = sc.next(); word = word.toLowerCase(); for(int i = 0; i < word.length(); i++ ) { if(Character.isDigit(word.charAt(i))) { count3++; } } //if( a.contains("a") ) //|| word.matches("and") || word.matches("the")|| word.contains("$")) //{ // count2++; // } a.add(word); if (word.equals("---")) { break; } } System.out.println("a size"); System.out.println(a.size()); // count = count2 - count; System.out.println("unique words"); System.out.println(a.size() - count2 - count3); System.out.println("\nbye..."); } }

    Read the article

  • NSPredicate and simple Regular Expression problem

    - by rjstelling
    I'm having problems with simple NSPredicates and regular expressions: NSString *mystring = @"file://questions/123456789/desc-text-here"; NSString *regex = @"file://questions+"; NSPredicate *regextest = [NSPredicate predicateWithFormat:@"SELF MATCHES %@", regex]; BOOL isMatch = [regextest evaluateWithObject:mystring]; In the above example isMatch is is always false/NO. What am I missing? I can't seem to find a regular expression that will match file://questions.

    Read the article

  • Regular expressions and the question mark

    - by James P.
    I'm having trouble finding a regular expression that matches the following String. Korben;http://feeds.feedburner.com/KorbensBlog-UpgradeYourMind?format=xml;1 One problem is escaping the question mark. Java's pattern matcher doesn't seem to accept \? as a valid escape sequence but it also fails to work with the tester at myregexp.com. Here's what I have so far: ([a-zA-Z0-9])+;http://([a-zA-Z0-9./-]+);[0-9]+ Any suggestions?

    Read the article

  • LINQ Next Item in List

    - by griegs
    Taking a look at my question HERE, I now want to return the next recommendation object (after) the one that matches the criteria. So say I found item 6 out of 10, I'd like the query to return item 7 instead. Or is there a better way?

    Read the article

  • Blackberry storm - update layout on tilt

    - by sujithRavindran
    Hi, have developed an app for BB storm while tilting the device the background image of the app screen does not matches with the screen size, i have tried with the sublayout method public void sublayout(int width, int height) { //update scrren layout based on orientation if(Display.getOrientation()== Display.ORIENTATION_LANDSCAPE) { invalidate(); } else if(Display.getOrientation()== Display.ORIENTATION_PORTRAIT) { invalidate(); } super.sublayout(width, height); } Still not successfull can any one help to sort out this tilt issue in BB storm Thanks SujithRavindran Rapidvaluesolutions

    Read the article

  • How to match filetype with regular expression?

    - by Sanarothe
    Hi. I'm stuck trying to get a regex to match a filetype in a sorting script. Dir.foreach(savedirs[0]) do |x| puts "Matching " + x + " against filetypes." case x when x.match(/^.*\.exe$/i) then puts x when x.match(/\.jpe?g$/) then FileUtils.move(x, sortpath[".exe"], :verbose => true) when x =~ /\.jpg$/ then FileUtils.move(x, sortpath[".jpg"]) end end I can't get any of these to match on in windows. All I need is to confirm that a given filename matches against compatible filetypes.

    Read the article

  • Regex for finding an unterminated string

    - by Austin Hyde
    I need to search for lines in a CSV file that end in an unterminated, double-quoted string. For example: 1,2,a,b,"dog","rabbit would match whereas 1,2,a,b,"dog","rabbit","cat bird" 1,2,a,b,"dog",rabbit would not. I have very limited experience with regular expressions, and the only thing I could think of is something like "[^"]*$ However, that matches the last quote to the end of the line. How would this be done?

    Read the article

  • ruby recursive regex

    - by Reed Debaets
    So why is this not working? I'm creating a regex that will match a formula (which is then part of a larger standard description). But I'm stuck here, as it doesn't appear to want to match embedded formulas within a formula. stat = /(Stat3|Stat2|Stat1)/ number_sym = /[0-9]*/ formula_sym = /((target's )?#{stat}|#{number_sym}|N#{number_sym})\%?/ math_sym = /(\+|\-|\*|\/|\%)/ formula = /^\((#{formula}|#{formula_sym}) (#{math_sym} (#{formula}|#{formula_sym}))?\)$/ p "(target's Stat2 * N1%)".match(formula).to_s #matches p "((target's Stat2 * N1%) + 3)".match(formula).to_s #no match p "(Stat1 + ((target's Stat2 * N1%) + 3))".match(formula).to_s #no match

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • Regex to exclude 1 word out of a regex code.

    - by Mech Software
    I need a regex expert to help out on this one. Examples I've found on here and the net I cant seem to get right. I'm using PHP and I have the following regex expression /([^a-zA-Z0-9])GC([A-Z0-9]+)/ This matches items like GCABCD GC123A, etc. What i need to do is EXCLUDE GCSTATS from this. So basically I want it to work just as it has, except, ignore GCSTATS in the regex.

    Read the article

  • Help with Oracle Query

    - by Gnaniyar Zubair
    I want to delete all the records where field name class="10010" from Table A and AentryId = BentryId from Table B. if i delete the entryId 12 which matches className=10010 from Table A and the same time that same id should delete from Table B also. Table A: AentryId className 12 10010 13 10011 14 10010 15 10011 Table B: BentryId name 12 xyz 13 abc 14 aaa

    Read the article

  • Regex validate dates like "Sun, 20 Jun 10"

    - by Trindaz
    Hi, I'm working on a regular expression that will only return true when a date string is in a format something like 'ddd, dd mmm yy'. Valid matches would be values like "Sun, 20 Jun 10" or "Mon, 21 Jun 10" but not "Sunday, 20 Jun 10" or "20 Jun 10". This will be used with mb_ereg in PHP. My attempts so far have only got me half way there. Any help appreciated! Thanks, Dave

    Read the article

  • Java Google App Engine Datastore: 'IN' operator available on JDO query filters, as with Python?

    - by Jim Blackler
    This page describes an 'IN' operator that can be used in GAE Datastore to compare a field against a list of possible matches, not just a single value: However this is for Python. In Java (App Engine 1.2.5), trying query.setFilter("someField IN param"); on my javax.jdo.query fires a JDOUserException 'Portion of expression could not be parsed: IN param'. Is there a way this can be done?

    Read the article

  • LINQ - array property contains element from another array

    - by Rob
    I have a object (product), with a property of type 'array' e.g. product.tags = {"tag1","tag2","tag9"} I have an array of input tags to filter on. ... but this is not quite working: List<string> filterTags = new List<string>() { "tag1", "tag3" }; var matches = from p in products where p.Tags.Contains(filterTags) select p; Any recommendations? Thanks.

    Read the article

  • JQUERY Effect highlight, control the Start & End colors

    - by nobosh
    I have the following: $(".notifycell_email_dailydigest").effect('highlight'); The element I want to highlight is over a gray background. Problem is the highlight goes from Yellow to white, and has this ugly slow pause at the end on the white which makes the animation look horrible. How can I modify the highlighy to start with the yellow but end on the gray so it matches the background? Thanks

    Read the article

  • PHP regular expression find and append to string

    - by Gary
    I'm trying to use regular expressions (preg_match and preg_replace) to do the following: Find a string like this: {%title=append me to the title%} Then extract out the title part and the append me to the title part. Which I can then use to perform a str_replace(), etc. Given that I'm terrible at regular expressions, my code is failing... preg_match('/\{\%title\=(\w+.)\%\}/', $string, $matches); What pattern do I need? :/

    Read the article

  • Slow (to none) performance on SQL 2005 after attaching SQL 2000 database

    - by ploft
    Issue: Using the detach/attach SQL database from a SQL 2000 SP4 instance to a much beefier SQL 2005 SP2 server. Run reindex, reorganize and update statistics a couple of times, but without any success. Queries on SQL 2000 took about 1-2 sec. to complete, now the same queries take 2-3 min on the SQL 2005 (and even 2008 - tested it there also). Have looked at the execution plans and the overall percent matches or are alike on each server.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 341 342 343 344 345 346 347 348 349 350 351 352  | Next Page >