Search Results

Search found 21524 results on 861 pages for 'multiple matches'.

Page 347/861 | < Previous Page | 343 344 345 346 347 348 349 350 351 352 353 354  | Next Page >

  • regular expression help

    - by hao
    <li class="zk_list_c2 f_l"><a title="abc" target="_blank" href="link"> abc </a>&nbsp;</li> how would i extract abc and link? $pattern="/<li class=\"zk_list_c2 f_l\"><a title=\"(.*)\" target=\"_blank\" href=\"(.*)\">\s*(.*)\s*<\/a>&nbsp;<\/li>/m"; preg_match_all($pattern, $content, $matches); the one i have right now doesnt seems to work

    Read the article

  • SED: Matching on 2 patterns on the same line

    - by Brian Knott
    Hi I want to delete a line using sed if it matches 2 regular expressions in the same line. EG the line starts with /* and end with */ (comment). The following script will do most of that. sed -e '/^\/*/ d' -e '/*\/$/ d' filename This script will remove all lines that start with * and end with */. I want it to remove the line only if is meets both criteria not one.

    Read the article

  • What color to use in owner-draw Windows List Control background?

    - by Mark Ransom
    I have an owner-drawn list control in my Windows program. I use CListCtrl::GetBkColor to get the background color, and for a selected item I use GetSysColor(COLOR_HIGHLIGHT). This matches what Windows uses for non owner drawn list controls, except for the case where the control doesn't have focus - then the background is replaced with gray. Does Windows use one of the GetSysColor constants for the selected but unfocused background? If so, which one?

    Read the article

  • Autocomplete server-side implementation

    - by toluju
    What is a fast and efficient way to implement the server-side component for an autocomplete feature in an html input box? I am writing a service to autocomplete user queries in our web interface's main search box, and the completions are displayed in an ajax-powered dropdown. The data we are running queries against is simply a large table of concepts our system knows about, which matches roughly with the set of wikipedia page titles. For this service obviously speed is of utmost importance, as responsiveness of the web page is important to the user experience. The current implementation simply loads all concepts into memory in a sorted set, and performs a simple log(n) lookup on a user keystroke. The tailset is then used to provide additional matches beyond the closest match. The problem with this solution is that it does not scale. It currently is running up against the VM heap space limit (I've set -Xmx2g, which is about the most we can push on our 32 bit machines), and this prevents us from expanding our concept table or adding more functionality. Switching to 64-bit VMs on machines with more memory isn't an immediate option. I've been hesitant to start working on a disk-based solution as I am concerned that disk seek time will kill performance. Are there possible solutions that will let me scale better, either entirely in memory or with some fast disk-backed implementations? Edits: @Gandalf: For our use case it is important the the autocompletion is comprehensive and isn't just extra help for the user. As for what we are completing, it is a list of concept-type pairs. For example, possible entries are [("Microsoft", "Software Company"), ("Jeff Atwood", "Programmer"), ("StackOverflow.com", "Website")]. We are using Lucene for the full search once a user selects an item from the autocomplete list, but I am not yet sure Lucene would work well for the autocomplete itself. @Glen: No databases are being used here. When I'm talking about a table I just mean the structured representation of my data. @Jason Day: My original implementation to this problem was to use a Trie, but the memory bloat with that was actually worse than the sorted set due to needing a large number of object references. I'll read on the ternary search trees to see if it could be of use.

    Read the article

  • How do you code up a pattern matching code block in scala?

    - by egervari
    How do you code a function that takes in a block of code as a parameter that contains case statements? For instance, in my block of code, I don't want to do a match or a default case explicitly. I am looking something like this myApi { case Whatever() => // code for case 1 case SomethingElse() => // code for case 2 } And inside of my myApi(), it'll actually execute the code block and do the matches. Help?

    Read the article

  • What method should be used for searching this mysql dataset?

    - by GeoffreyF67
    I've got a mysql dataset that contains 86 million rows. I need to have a relatively fast search through this data. The data I'll be searching through is all strings. I also need to do partial matches. Now, if I have 'foobar' and search for '%oob%' I know it'll be really slow - it has to look at every row to see if there is a match. What methods can be used to speed queries like this up? G-Man

    Read the article

  • java filenames filter pattern

    - by Sergey
    Hello, I need to implement File[] files = getFiles( String folderName, String ptrn ); Where ptrn is a command prompt style pattern like "*2010*.txt" I'm familar with FilenameFilter class, but can't implement public boolean accept(File dir, String filename) because String.matches() doesn't accept such patterns. Thanks!

    Read the article

  • Custom dynamic error pages in Ruby on Rails not working

    - by PlanetMaster
    Hi, I'm trying to implement custom dynamic error pages following this post: http://www.perfectline.co.uk/blog/custom-dynamic-error-pages-in-ruby-on-rails I did exactly what the blog post says. I included config.action_controller.consider_all_requests_local = false in my environment.rb. But is not working. My browser shows: Routing Error No route matches "/555" with {:method=>:get} So, it looks like the rescues are not fired. I get the following in my log file: ActionController::RoutingError (No route matches "/555" with {:method=>:get}): Rendering rescues/layout (not_found) Is there some routing interfering with the code? I'm not sure what to look for. I'm running rails 2.3.5. Here is the routes.rb file: ActionController::Routing::Routes.draw do |map| # routing van property-url map.connect 'buy/:property_type_plural/:province/:city/:address/:house_number', :controller => 'properties' , :action => 'show', :id => 'whatever' map.myimmonatie 'myimmonatie' , :controller => 'myimmonatie/properties', :action => 'index' map.login "login", :controller => "user_sessions", :action => "create", :conditions => {:method => :post} map.login "login", :controller => "user_sessions", :action => "new" map.logout "logout", :controller => "user_sessions", :action => "destroy" map.buy "buy", :controller => 'buy' map.sell "sell", :controller => 'sell' map.home "home", :controller => 'home' map.disclaimer "disclaimer", :controller => 'disclaimer' map.sign_up "sign_up", :controller => 'users', :action => :new map.contact "contact", :controller => 'contact' map.resources :user_sessions map.resources :contact map.resources :password_resets map.resources :messages map.resources :users, :only => [:index,:new,:create,:activate,:edit,:profile,:password] map.resources :images map.resources :activation , :only => [:new,:resend] map.resources :email map.resources :properties, :except => [:index,:destroy] map.namespace :admin do |admin| admin.resources :users admin.resources :properties admin.resources :order_items, :as => :orders admin.resources :blog_posts, :as => :blog end map.connect 'myimmonatie/:action' , :controller => 'users', :id => 'current', :requirements => {:action => /(profile)|(password)|(email)/} map.namespace :myimmonatie do |myimmonatie| myimmonatie.resources :messages, :controller => 'messages' myimmonatie.resources :password, :as => "password", :controller => 'users', :action => 'password' myimmonatie.resources :properties , :controller => 'properties' myimmonatie.resources :orders , :only => [:index,:show,:create,:new] end map.root :controller => "home" map.connect ':controller/:action' map.connect ':controller/:action/:id' map.connect ':controller/:action/:id.:format' end ActionController::Routing::Translator.translate_from_file('config','i18n-routes.yml')

    Read the article

  • Google App Engine and SQL LIKE

    - by jb
    Is there any way to query GAE datastore with filter similar to SQL LIKE statement? For example, if a class has a string field, and I want to find all classes that have some specific keyword in that string, how can I do that? It looks like JDOQL's matches() don't work... Am I missing something? Any comments, links or code fragments are welcome

    Read the article

  • Regex to match all of a set except certain ones

    - by Davy8
    I'm sure this has been asked before, but I can't seem to find it (or know the proper wording to search for) Basically I want a regex that matches all non-alphanumeric except hyphens. So basically match \W+ except exclude '-' I'm not sure how to exclude specific ones from a premade set.

    Read the article

  • Regular Expression for CSV with numbers

    - by Bernie Perez
    I'm looking for some regular expression to help parse my CSV file. The file has lines of number,number number,number Comment I want to skip number,number number,number Ex: 319,5446 564425,87 Text to skip 27,765564 I read each line into a string and I wanted to use some regular express to make sure the line matches the pattern of (number,number). If not then don't use the line.

    Read the article

  • use split() for splitting a string

    - by Hamed
    Hi again... Guys I'd asked 2 questions before and I'd said that I want to split a string like below: Input string: a=aa|b=b||b|c=cc and the output: a=aa b=b||b c=cc some guys answer my question but they use .Match(): var matches = "a=aa|b=b||b|c=cc".match(/(?:[^|]|\|\|)+/g) but I need to use the .split() method and store the outputs in an array. please help me guys... It's so critical... Thanks...

    Read the article

  • Chrome extension Page Action JS

    - by Radek Šimko
    I'm trying to create an extension using this docs: http://code.google.com/chrome/extensions/content_scripts.html I want a part of JS code to run when document is ready (loaded). This is my manifest.json: { "name": "OwnExtension", "version": "0.1", "content_scripts": [ { "matches": ["https://my.site.eu/*"], "css": ["styles.css"], "js": ["main.js"] } ] } This is my main.js: alert(10); Am I doing sth wrong, that nothing happend when page https://my.site.eu/ loaded in browser?

    Read the article

  • Rails Pretty URL with Decimals

    - by Kevin Sylvestre
    I have a rails application that allows searches using longitude and latitude. I have added a 'pretty' route with: map.connect 'stores/near/:longitude/:latitude', :controller => 'stores', :action => 'index' This works for integer latitude and longitude values (http://localhost:3000/stores/near/-88/49) but fails for decimal values (http://localhost:3000/stores/near/-88.341/49.123) giving: Routing Error No route matches "/stores/near/-88/49.0" with {:method=>:get} Any ideas how to use pretty URLs in rails with decimals?

    Read the article

  • php search function

    - by Luke
    I am attempting to create a search function for user profiles on my site. $search= $_POST['search']; $res=mysql_query("SELECT * FROM ".TBL_USERS." WHERE username LIKE '$search%'"); This is the code I use. This will only work if you search something that matches the start of the result. Is there any way I can return values that have what i type as part of the username regardingless of upper or lower cases? Thankyou

    Read the article

  • Flatten date range memberships retaining only the highest priority membership (TRANSACT-SQL)

    - by shadowranger
    Problem statement: A table contains an item_id, a category_id and a date range (begin_date and end_date). No item may be in more than one category on any given date (in general; during daily rebuilding it can be in an invalid state temporarily). By default, all items are added (and re-added if removed) to a category (derived from outside data) automatically on a daily basis, and their membership in that category matches the lifespan of the item (items have their own begin and end date, and usually spend their entire lives in the same category, which is why this matches). For items in category X, it is occasionally desirable to override the default category by adding them to category Y. Membership in category Y could entirely replace membership in category X (that is, the begin and end dates for membership in category Y would match the begin and end dates of the item itself), or it could override it for an arbitrary period of time (at the beginning, middle or end the item's lifespan, possibly overriding for short periods at multiple times). Membership in category Y is not renewed automatically and additions to that category is done by manual data entry. Every day, when category X is rebuilt, we get an overlap, where any item in category Y will now be in category X as well (which is forbidden, as noted previously). Goal: After each repopulation of category X (which is done in a rather complicated and fragile manner, and ideally would be left alone), I'm trying to find an efficient means of writing a stored procedure that: Identifies the overlaps Changes existing entries, adds new ones where necessary (such as in the case where an item starts in category X, switches to category Y, then eventually switches back to category X before ending), or removes entries (when an item is in category Y for its entire life) such that every item remains in category Y (and only Y) where specified, while category X membership is maintained when not overridden by category Y. Does not affect memberships of categories A, B, C, Z, etc., which do not have override categories and are built separately, by completely different rules. Note: It can be assumed that X membership covers the entire lifespan of the item before this procedure is called, so it is unnecessary to query any data outside this table. Bonus credit: If for some reason there are two adjacent or overlapping memberships in for the same item in category Y, stitching them together into a single entry is appreciated, but not necessary. Example: item_id category_id begin_date end_date 1 X 20080101 20090628 1 Y 20090101 20090131 1 Y 20090601 20090628 2 X 20080201 20080731 2 Y 20080201 20080731 Should become: item_id category_id begin_date end_date 1 X 20080101 20081231 1 Y 20090101 20090131 1 X 20090201 20090531 1 Y 20090601 20090628 2 Y 20080201 20080731 If it matters, this needs to work on SQL Server 2005 and SQL Server 2008

    Read the article

  • find the all the stored procedures and jobs in sql server 2000

    - by kumar
    Hi, In SQL SERVER 2005 This query works fine : Select * from sys.procedures where object_definition(object_id) like '%J%' SELECT * FROM MSDB.DBO.SYSJOBS WHERE NAME LIKE '%J%' but in sql server 2000 it is not working. Here i need to find the all the stored procedures and jobs which matches my string ? how to find in sql server 2000 ? regards, kumar

    Read the article

  • Match Regex across newlines?

    - by Jörg Battermann
    I have a regex ( "(&lt;lof&lt;).*?(&gt;&gt;)" ) that works and matches perfectly on single line input. However, if the input contains newlines between the two () parts it does not match at all. What's the best way to ignore any newlines at all in that case?

    Read the article

  • Regular expressions

    - by Infinity
    Hello guys! I need a regular expression for findin a pattern. This is the pattern: id|name|code|mobile I created a pattern for this if I want to search by id (if id = 1): .*1.*|.*|.*|.* But it matches every pattern that contains number 1. What's the problem with it?

    Read the article

  • XY-Scatter Chart In SSRS Won't Display Points

    - by Dalin Seivewright
    I'm a bit confused with this one. I have a Dataset with a BackupDate and a BackupTime as well as a BackupType. The BackupDate is comprised of 12 characters from the left of a datetime string within a table. The BackupTime is comprised of 8 characters from the right of that same datetime string. So for example: BackupDate would be 'December 12 2008' and the BackupTime would be '12:53PM.' I have added an XY-scatter chart to the report. I've added a 'series' value for the BackupType (so one can distinguish between a Full/Incr/Log backup). I've added a category value of BackupDate and set the Scale for the X-axis from the Min of BackupDate to the Max of BackupDate. I've then added an item to the Values with the Y variable set to BackupTime and the X variable set to BackupDate. The interval for the Y-axis is 12:00AM to 11:59PM and the formatting for the labels is 'hh:mmtt'. The BackupTime matches the format of the Y-axis. The BackupDate matches the format of the X-axis. 10 entries are retrieved by my Dataset and the Legend is properly populated by the BackupType field. No points are being plotted on the graph and no markers/pointers are shown if they are enabled. There should be a point on the graph for every point in time of each day there is a backup of a specific type. Am I missing something? Does anyone know of a good tutorial dealing specifically with XY-scatter graphs and using them in a way I intend? I am using the 2005 version of SSRS rather than the 2008 version. Screenshot of what my chart currently looks like: In case it could be dataset related: SELECT TOP (10) backup_type, LTRIM(RTRIM(LEFT(backup_finish_date, 12))) AS BackupDate, LTRIM(RTRIM(RIGHT(backup_finish_date, 8))) AS BackupTime FROM DBARepository.Backup_History As requested, here are the results of this query. There is a Where clause to constrain the results to a specific database of a specific server that was not included in the above SQL Query. Log Dec 26 2008 12:00PM Log Dec 27 2008 4:00AM Log Dec 27 2008 8:00AM Log Dec 27 2008 12:00PM Log Dec 27 2008 4:00PM Log Dec 27 2008 8:00PM Database Dec 27 2008 10:01PM Log Dec 28 2008 12:00AM Log Dec 28 2008 4:00AM Log Dec 28 2008 8:00AM

    Read the article

  • Using \b in C# regular expressions doesn't work?

    - by Nikhil
    I am wondering why the following regex does not match. string query = "\"1 2\" 3"; string pattern = string.Format(@"\b{0}\b", Regex.Escape("\"1 2\"")); string repl = Regex.Replace(query, pattern, "", RegexOptions.CultureInvariant); Note that if I remove the word boundary characters (\b) from pattern, it matches fine. Is there something about '\b' that might be tripping this up?

    Read the article

  • How to compare arrays in Perl?

    - by devtech
    I have two arrays A & B. I want to do a compare among the elements of the two arrays. my @a = qw"abc def efg ghy klm ghn"; my @b = qw"def ghy jgk lom com klm"; If any element matches then set a flag. Is there any simple way to do this? Please advise.

    Read the article

  • using regular expression in Java

    - by Mrityunjay
    Hi, i need to check a string that should contain only ABCDEFG characters, in any sequence and with only 7 characters. Please let me know the correct way of using regular expression. as corrently i am using String abs = "ABPID"; if(!Pattern.matches("[[ABCDEFG]", abs)) System.out.println("Error"); i am using the following code which works when i use the String abcdefg but for other cases it fails. please help me out.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

< Previous Page | 343 344 345 346 347 348 349 350 351 352 353 354  | Next Page >