Search Results

Search found 21331 results on 854 pages for 'require once'.

Page 803/854 | < Previous Page | 799 800 801 802 803 804 805 806 807 808 809 810  | Next Page >

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • markdown to HTML with customised WMD editor

    - by spirytus
    For my application I customized slightly the way WMD behaves so when user enters empty lines, these are reflected in HTML output as <br />'s. Now I came to a point when I should store it somewhere at backend and so after going thru SO posts for a while I'm not sure what is the best way to do it. I have few options and if you could point out which their pros/cons that would be much appreciated. send to server and store as markdown rather than HTML. To me obvious advantage would be keeping exactly same formatting as user originally entered. But then how can I convert it back to HTML for display to a client? It seems very troublesome to convert it on client side as even if it would be possible what would happen if JS would be disabled? If I wanted to do it on the server, then standard server side implementations of markup to HTML might be resource expensive. Would that be an issue in your opinion? Even if it wouldn't be the case then as I mentioned my WMD implementation is customised and those server side solutions wouldn't probably do the right conversion to markdown anyway and there always would be a risk that something would convert wrong. Send to server as converted HTML. Same as above.. conversion on client side would be difficult, server side same with possibility of getting it wrong. send original markdown and converted HTML and store both. No performance issues related to converting markdown to HTML on client side, nor on server side. Users would have always same markdown they originally entered and same HTML they originally saw in preview (possibly sanitized in php though). It would have to take twice that much storage space though and that is my biggest worry. I tend to lean towards 3rd solution as it seems simplest, but there is a worry of doubled storage space needed for this solution. Please bear in mind that my implementation of WMD is slightly modified and also I'm going with PHP/MySql server side implementation. So apart from 3 options I listed above, are there any other possible solutions to my problem? Did I miss anything important that would make one of the options above better then the rest? And what other pros/cons would apply to each solution I listed? Also how is it implemented on SO? I read somwhere that they using option 3, and so if its good enough for SO would be good enough for me :) but not sure if its true anyway, so how is it done? Also please forgive me, but at least for once I got to say that StackOverflow IS THE BEST DAMN RESOURCE ON THE WEB and I truly appreciate all the people trying to help others here! The site and users here are simply amazing!

    Read the article

  • Bad_alloc exception when using new for a struct c++

    - by bsg
    Hi, I am writing a query processor which allocates large amounts of memory and tries to find matching documents. Whenever I find a match, I create a structure to hold two variables describing the document and add it to a priority queue. Since there is no way of knowing how many times I will do this, I tried creating my structs dynamically using new. When I pop a struct off the priority queue, the queue (STL priority queue implementation) is supposed to call the object's destructor. My struct code has no destructor, so I assume a default destructor is called in that case. However, the very first time that I try to create a DOC struct, I get the following error: Unhandled exception at 0x7c812afb in QueryProcessor.exe: Microsoft C++ exception: std::bad_alloc at memory location 0x0012f5dc.. I don't understand what's happening - have I used up so much memory that the heap is full? It doesn't seem likely. And it's not as if I've even used that pointer before. So: first of all, what am I doing that's causing the error, and secondly, will the following code work more than once? Do I need to have a separate pointer for each struct created, or can I re-use the same temporary pointer and assume that the queue will keep a pointer to each struct? Here is my code: struct DOC{ int docid; double rank; public: DOC() { docid = 0; rank = 0.0; } DOC(int num, double ranking) { docid = num; rank = ranking; } bool operator>( const DOC & d ) const { return rank > d.rank; } bool operator<( const DOC & d ) const { return rank < d.rank; } }; //a lot of processing goes on here; when a matching document is found, I do this: rank = calculateRanking(table, num); //if the heap is not full, create a DOC struct with the docid and rank and add it to the heap if(q.size() < 20) { doc = new DOC(num, rank); q.push(*doc); doc = NULL; } //if the heap is full, but the new rank is greater than the //smallest element in the min heap, remove the current smallest element //and add the new one to the heap else if(rank > q.top().rank) { q.pop(); cout << "pushing doc on to queue" << endl; doc = new DOC(num, rank); q.push(*doc); } Thank you very much, bsg.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Implementing hoverIntent for Drop Down Menu (coming from click_event)

    - by stormeTrooper
    I've just recently started programming, I was hoping for some help. I have a drop down menu that was originally activated by click_event, however I want to now implement hoverIntent in order to make the menu drop. The issue I am having now is being able to use the menu, because whenever I invoke the menu now, once I leave the area that activates the menu, the menu closes. If you could explain to me like I'm five, I'd appreciate it, thanks :) The code I am using as follows: JavaScript: function setupUserConfigMenu() { $('.user_profile_btn').hoverIntent( function (event) { $('#user_settings_dropdown').animate({height:['toggle', 'swing'] }, 225); }, function (event) { $('#user_settings_dropdown').animate({height:['toggle', 'swing'] }, 225); }) } HTML: <li> <a href="<%= "#" %>" class="user_profile_btn" title="Your profile page"><%= truncate(current_user.full_name || current_user.name, :length => 28) %> <div class="arrow_down"></div></a> <ul id="user_settings_dropdown"> <li> <a href="<%= current_user.get_url(true) %>"> <%= image_tag current_user.get_thumb_url, :size => "30x30" %> <div> <%= truncate(current_user.full_name || current_user.name, :length => 40) %> <br> View profile </div> </a> </li> <div class="grey_line"></div> <li class="settings_list_item"> <%= link_to "Settings", edit_user_registration_path %> </li> <li class="settings_list_item"> <%= link_to "About", "/about" %> </li> <li class="settings_list_item"> <%= link_to "Logout", destroy_user_session_path, :method => :delete %> </li> </ul> </li>

    Read the article

  • What makes great software?

    - by VirtuosiMedia
    From the perspective of an end user, what makes a software great rather than just good or functional? What are some fundamental principles that can shift the way a software is used and perceived? What are some of the little finishing touches that help put an application over the top? I'm in the later stages of developing a web app and I'm looking for ideas or concepts that I may have missed. If you have specific examples of software or apps that you absolutely love, please share the reasons or features that make it special. Keep in mind that I'm looking for examples that directly affect the end user, but not necessarily just UI suggestions. Here are some of the principles and little touches I'm trying to use: Keep the UI as simple as possible. Remove absolutely everything that isn't necessary. Use progressive disclosure when more information can be needed sometimes but isn't needed all the time. Provide inline help and useful error messages. Verbs on buttons wherever possible. Make anything that's clickable obvious. Fast, responsive UI. Accessibility (this is a work in progress). Reusable UI patterns. Once a user learns a skill, they will be able to use it in multiple places. Intelligent default settings. Auto-focusing forms when filling out the form is the primary action to be taken on the page. Clear metaphors (like tabs) and headings indicating location within the app. Automating repetitive tasks (with the ability to disable the automation). Use standardized or accepted metaphors for icons (like an "x" for delete). Larger text sizes for improved readability. High contrast so that each section is distinct. Making sure that it's obvious on every page what the user is supposed to do by establishing a clear information hierarchy and drawing the eye to the call to action. Most deletions can be undone. Discoverability - Make it easy to learn how to do new tasks. Group similar elements together.

    Read the article

  • vb6 ADODB TSQL procedure call quit working after database migration

    - by phill
    This code was once working on sql server 2005. Now isolated in a visual basic 6 sub routine using ADODB to connect to a sql server 2008 database it throws an error saying: "Login failed for user 'admin' " I have since verified the connection string does work if i replace the body of this sub with the alternative code below this sub. When I run the small program with the button, it stops where it is marked below the asterisk line. Any ideas? thanks in advance. Private Sub Command1_Click() Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset Dim dStartDateIn As Date dStartDateIn = "2010/05/01" cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" 'On Error GoTo GetUnconvertedInvoices_Err With cmdGetInvoices .CommandType = adCmdStoredProc .CommandText = "_sp_cwm5_GetUnCvtdInv" .Name = "_sp_cwm5_GetUnCvtdInv" Set oParm1 = .CreateParameter("@StartDate", adDate, adParamInput) .Parameters.Append oParm1 oParm1.Value = dStartDateIn .ActiveConnection = cSQLConn End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic .CursorType = adOpenKeyset '.CursorType = adOpenStatic .CacheSize = 5000 '***************************Debug stops here .Open cmdGetInvoices End With If myRs.State = adStateOpen Then Set GetUnconvertedInvoices = myRs Else Set GetUnconvertedInvoices = Nothing End If End Sub Here is the code which validates the connection string is working. Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" With cmdGetInvoices .ActiveConnection = cSQLConn .CommandText = "SELECT top 5 * FROM tarInvoice;" .CommandType = adCmdText End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic '.CursorType = adOpenKeyset .CursorType = adOpenStatic '.CacheSize = 5000 .Open cmdGetInvoices End With If myRs.EOF = False Then myRs.MoveFirst Do MsgBox "Record " & myRs.AbsolutePosition & " " & _ myRs.Fields(0).Name & "=" & myRs.Fields(0) & " " & _ myRs.Fields(1).Name & "=" & myRs.Fields(1) myRs.MoveNext Loop Until myRs.EOF = True End If

    Read the article

  • Check my anagram code from a job interview in the past.

    - by Michael Dorgan
    Had the following as an interview question a while ago and choked so bad on basic syntax that I failed to advance (once the adrenalin kicks in, coding goes out the window.) Given a list of string, return a list of sets of strings that are anagrams of the input set. i.e. "dog","god", "foo" should return {"dog","god"}. Afterward, I created the code on my own as a sanity check and it's been around now for a bit. I'd welcome input on it to see if I missed anything or if I could have done it much more efficiently. Take it as a chance to improve myself and learn other techniques: void Anagram::doWork(list input, list &output) { typedef list SortType; SortType sortedInput; // sort each string and pair it with the original for(list<string>::iterator i = input.begin(); i != input.end(); ++i) { string tempString(*i); std::sort(tempString.begin(), tempString.end()); sortedInput.push_back(make_pair(*i, tempString)); } // Now step through the new sorted list for(SortType::iterator i = sortedInput.begin(); i != sortedInput.end();) { set<string> newSet; // Assume (hope) we have a match and pre-add the first. newSet.insert(i->first); // Set the secondary iterator one past the outside to prevent // matching the original SortType::iterator j = i; ++j; while(j != sortedInput.end()) { if(i->second == j->second) { // If the string matches, add it to the set and remove it // so that future searches need not worry about it newSet.insert(j->first); j = sortedInput.erase(j); } else { // else, next element ++j; } } // If size is bigger than our original push, we have a match - save it to the output if(newSet.size() > 1) { output.push_back(newSet); } // erase this element and update the iterator i = sortedInput.erase(i); } }

    Read the article

  • ASP.NET MVC 2: Linq to SQL entity w/ ForeignKey relationship and Default ModelBinder strangeness

    - by Simon
    Once again I'm having trouble with Linq to Sql and the MVC Model Binder. I have Linq to Sql generated classes, to illustrate them they look similar to this: public class Client { public int ClientID { get; set; } public string Name { get; set; } } public class Site { public int SiteID { get; set; } public string Name { get; set; } } public class User { public int UserID { get; set; } public string Name { get; set; } public int? ClientID { get; set; } public EntityRef<Client> Client { get; set; } public int? SiteID { get; set; } public EntityRef<Site> Site { get; set; } } The 'User' has a relationship with the 'Client' and 'Site . The User class has nullable ClientIDs and SiteIDs because the admin users are not bound to a Client or Site. Now I have a view where a user can edit a 'User' object, the view has fields for all the 'User' properties. When the form is submitted, the appropiate 'Save' action is called in my UserController: public ActionResult Save(User user, FormCollection form) { //form['SiteID'] == 1 //user.SiteID == 1 //form['ClientID'] == 1 //user.ClientID == null } The problem here is that the ClientID is never set, it is always null, even though the value is in the FormCollection. To figure out whats going wrong I set breakpoints for the ClientID and SiteID getters and setters in the Linq to Sql designer generated classes. I noticed the following: SiteID is being set, then ClientID is being set, but then the Client EntityRef property is being set with a null value which in turn is setting the ClientID to null too! I don't know why and what is trying to set the Client property, because the Site property setter is never beeing called, only the Client setter is being called. Manually setting the ClientID from the FormCollection like this: user.ClientID = int.Parse(form["ClientID"].ToString()); throws a 'ForeignKeyReferenceAlreadyHasValueException', because it was already set to null before. The only workaround I have found is to extend the generated partial User class with a custom method: Client = default(EntityRef<Client>) but this is not a satisfying solution. I don't think it should work like this? Please enlighten me someone. So far Linq to Sql is driving me crazy! Best regards

    Read the article

  • Changing an Action Type="click" to an auto action in SVG

    - by Dustin Myers
    I have a SVG document that I exported from Visio 2003 that would like to edit. This file has an action where you click a button it will navigate to a new screen. What I would like to do is have the navigation be based off of a data point rather than having to click the button. As an example I have a dynamic point data being brought into the SVG file and when that value changes from 0 to 1, I want this screen to automatically navigate to another screen. Below is the code I for clicking the button. <title content="structured text">Sheet.1107</title> <desc content="structured text">Button 1</desc> <v:custProps> <v:cp v:ask="false" v:langID="1033" v:invis="false" v:cal="0" v:val="VT4(Test Graphic 2)" v:type="0" v:prompt="" v:nameU="ObjRef" v:sortKey="" v:lbl="" v:format=""/> <v:cp v:ask="false" v:langID="1033" v:invis="false" v:cal="0" v:val="VT4(SF-S)" v:type="0" v:prompt="" v:nameU="DataPt" v:sortKey="" v:lbl="" v:format=""/> </v:custProps> <v:userDefs> <v:ud v:prompt="" v:nameU="NAVIGATE" v:val="VT4(NAVIGATE Test Graphic 2,&apos;&apos;,)"/> </v:userDefs> <v:textBlock v:margins="rect(4,4,4,4)"/> <v:textRect width="125.01" height="35" cx="62.5" cy="517.5"/> <rect x="0" width="125" y="500" height="35" class="st3"/> <text x="40.15" y="521.1" v:langID="1033" class="st4"><v:paragraph v:horizAlign="1"/><v:tabList/>Button 1</text> <jci:action type="click" count="1">if(evt.button == 0) nav(&apos;Test Graphic 2&apos;,&apos;&apos;,&apos;&apos;);</jci:action></g></a> In the above code I am bringing in the data value from SF-S. Once that value is equal to 1 I want this screen to automatically navigate to Test Graphic 2. I don't have any experience with coding so I am hoping someone here will be able to help me. Thanks, DMyers

    Read the article

  • Why isnt my data persisting with nskeyedarchiver?

    - by aking63
    Im just working on what should be the "finishing touches" of my first iPhone game. For some reason, when I save with NSKeyedArchiver/Unarchiver, the data seems to load once and then gets lost or something. Here's what I've been able to deduce: When I save in this viewController, pop to the previous one, and then push back into this one, the data is saved and prints as I want it to. But when I save in this viewController, then push a new one and pop back into this one, the data is lost. Any idea why this might be happening? Do I have this set up all wrong? I copied it from a book months ago. Here's the methods I use to save and load. - (void) saveGameData { NSLog(@"LS:saveGameData"); // SAVE DATA IMMEDIATELY NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *gameStatePath = [documentsDirectory stringByAppendingPathComponent:@"gameState.dat"]; NSMutableData *gameSave= [NSMutableData data]; NSKeyedArchiver *encoder = [[NSKeyedArchiver alloc] initForWritingWithMutableData:gameSave]; [encoder encodeObject:categoryLockStateArray forKey:kCategoryLockStateArray]; [encoder encodeObject:self.levelsPlist forKey:@"levelsPlist"]; [encoder finishEncoding]; [gameSave writeToFile:gameStatePath atomically:YES]; NSLog(@"encoded catLockState:%@",categoryLockStateArray); } - (void) loadGameData { NSLog(@"loadGameData"); // If there is a saved file, perform the load NSMutableData *gameData = [NSData dataWithContentsOfFile:[[NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES) objectAtIndex:0] stringByAppendingPathComponent:@"gameState.dat"]]; // LOAD GAME DATA if (gameData) { NSLog(@"-Loaded Game Data-"); NSKeyedUnarchiver *unarchiver = [[NSKeyedUnarchiver alloc] initForReadingWithData:gameData]; self.levelsPlist = [unarchiver decodeObjectForKey:@"levelsPlist"]; categoryLockStateArray = [unarchiver decodeObjectForKey:kCategoryLockStateArray]; NSLog(@"decoded catLockState:%@",categoryLockStateArray); } // CREATE GAME DATA else { NSLog(@"-Created Game Data-"); self.levelsPlist = [[NSMutableDictionary alloc] initWithContentsOfFile:[[NSBundle mainBundle] pathForResource:kLevelsPlist ofType:@"plist"]]; } if (!categoryLockStateArray) { NSLog(@"-Created categoryLockStateArray-"); categoryLockStateArray = [[NSMutableArray alloc] initWithCapacity:[[self.levelsPlist allKeys] count]]; for (int i=0; i<[[self.levelsPlist allKeys] count]; i++) { [categoryLockStateArray insertObject:[NSNumber numberWithBool:FALSE] atIndex:i]; } } // set the properties of the categories self.categoryNames = [self.levelsPlist allKeys]; NUM_CATEGORIES = [self.categoryNames count]; thisCatCopy = [[NSMutableDictionary alloc] initWithDictionary:[[levelsPlist objectForKey:[self.categoryNames objectAtIndex:pageControl.currentPage]] mutableCopy]]; NUM_FINISHED = [[thisCatCopy objectForKey:kNumLevelsBeatenInCategory] intValue]; }

    Read the article

  • getting Cannot identify image file when trying to create thumbnail in django

    - by Mo J. Mughrabi
    Am trying to create a thumbnail in django, am trying to build a custom class specifically to be used for generating thumbnails. As following from StringIO import StringIO from PIL import Image class Thumbnail(object): source = '' size = (50, 50) output = '' def __init__(self): pass @staticmethod def load(src): self = Thumbnail() self.source = src return self def generate(self, size=(50, 50)): if not isinstance(size, tuple): raise Exception('Thumbnail class: The size parameter must be an instance of a tuple.') self.size = size # resize properties box = self.size factor = 1 fit = True image = Image.open(self.source) # Convert to RGB if necessary if image.mode not in ('L', 'RGB'): image = image.convert('RGB') while image.size[0]/factor > 2*box[0] and image.size[1]*2/factor > 2*box[1]: factor *=2 if factor > 1: image.thumbnail((image.size[0]/factor, image.size[1]/factor), Image.NEAREST) #calculate the cropping box and get the cropped part if fit: x1 = y1 = 0 x2, y2 = image.size wRatio = 1.0 * x2/box[0] hRatio = 1.0 * y2/box[1] if hRatio > wRatio: y1 = int(y2/2-box[1]*wRatio/2) y2 = int(y2/2+box[1]*wRatio/2) else: x1 = int(x2/2-box[0]*hRatio/2) x2 = int(x2/2+box[0]*hRatio/2) image = image.crop((x1,y1,x2,y2)) #Resize the image with best quality algorithm ANTI-ALIAS image.thumbnail(box, Image.ANTIALIAS) # save image to memory temp_handle = StringIO() image.save(temp_handle, 'png') temp_handle.seek(0) self.output = temp_handle return self def get_output(self): return self.output.read() the purpose of the class is so i can use it inside different locations to generate thumbnails on the fly. The class works perfectly, I've tested it directly under a view.. I've implemented the thumbnail class inside the save method of the forms to resize the original images on saving. in my design, I have two fields for thumbnails. I was able to generate one thumbnail, if I try to generate two it crashes and I've been stuck for hours not sure whats the problem. Here is my model class Image(models.Model): article = models.ForeignKey(Article) title = models.CharField(max_length=100, null=True, blank=True) src = models.ImageField(upload_to='publication/image/') r128 = models.ImageField(upload_to='publication/image/128/', blank=True, null=True) r200 = models.ImageField(upload_to='publication/image/200/', blank=True, null=True) uploaded_at = models.DateTimeField(auto_now=True) Here is my forms class ImageForm(models.ModelForm): """ """ class Meta: model = Image fields = ('src',) def save(self, commit=True): instance = super(ImageForm, self).save(commit=True) file = Thumbnail.load(instance.src) instance.r128 = SimpleUploadedFile( instance.src.name, file.generate((128, 128)).get_output(), content_type='image/png' ) instance.r200 = SimpleUploadedFile( instance.src.name, file.generate((200, 200)).get_output(), content_type='image/png' ) if commit: instance.save() return instance the strange part is, when i remove the line which contains instance.r200 in the form save. It works fine, and it does the thumbnail and stores it successfully. Once I add the second thumbnail it fails.. Any ideas what am doing wrong here? Thanks Update: I tried earlier doing the following but I still got the same error class ImageForm(models.ModelForm): """ """ class Meta: model = Image fields = ('src',) def save(self, commit=True): instance = super(ImageForm, self).save(commit=True) instance.r128 = SimpleUploadedFile( instance.src.name, Thumbnail.load(instance.src).generate((128, 128)).get_output(), content_type='image/png' ) instance.r200 = SimpleUploadedFile( instance.src.name, Thumbnail.load(instance.src).generate((200, 200)).get_output(), content_type='image/png' ) if commit: instance.save() return instance

    Read the article

  • Mixing .NET versions between website and virtual directories and the "server application unavailable" error Message

    - by Doug Chamberlain
    Backstory Last month our development team created a new asp.net 3.5 application to place out on our production website. Once we had the work completed, we requested from the group that manages are server to copy the app out to our production site, and configure the virtual directory as a new application. On 12/27/2010, two public 'Gineau Pigs' were selected to use the app, and it worked great. On 12/30/2010, We received notification by internal staff, that when that staff member tried to access the application (this was the Business Process Owner) they recieved the 'Server Application Unavailable' message. When I called the group that does our server support, I was told that it probably failed, because I didn't close the connections in my code. However, the same group went in and then created a separate app pool for this Extension Request application. It has had no issues since. I did a little googling, since I do not like being blamed for things. I found that the 'Server Application Unavailable' message will also appear when you have multiple applications using different frameworks and you do not put them in different application pools. Technical Details - Tree of our website structure Main Website <-- ASP Classic +-Virtual Directory(ExtensionRequest) <-- ASP 3.5 From our server support group: 'Reviewed server logs and website setup in IIS. Had to reset the application pool as it was not working properly. This corrected the website and it is now back online. We went ahead and created a application pool for the extension web so it is isolated from the main site pool. In the past we have seen other application do this when there is a connection being left open and the pool fills up. Would recommend reviewing site code to make sure no connections are being left open.' The Real Question: What really caused the failure? Isn't the connection being left open issue an ASP Classic issue? Wouldn't the ExtensionRequest application have to be used (more than twice) in the first place to have the connections left open? Is it more likely the failure is caused by them not bothering to setup the new Application in it's own App Pool in the first place? Sorry for the long windedness

    Read the article

  • Need to know how to properly create a new object in another cpp file

    - by karikari
    I have a class. The problem now is, after a few attempt, I'm still in huge error. My problem is I don't know how to properly declare a new object for this class, inside another cpp file. I wanted to call/trigger the functions from this RebarHandler class from my other cpp file. I keep on getting problems like, 'used without being initialized', 'debug assertion failed' and so on. In the other cpp file, I include the RebarHandler.h and did like this: CRebarHandler *test=NULL; test->setButtonMenu2(); When compile, I does not give any error. But, when run time, it gives error and my IE crash. I need help. Below is the class I meant: #pragma once class CIEWindow; class CRebarHandler : public CWindowImpl<CRebarHandler>{ public: CRebarHandler(HWND hWndToolbar, CIEWindow *ieWindow); CRebarHandler(){}; ~CRebarHandler(); BEGIN_MSG_MAP(CRebarHandler) NOTIFY_CODE_HANDLER(TBN_DROPDOWN, onNotifyDropDown) NOTIFY_CODE_HANDLER(TBN_TOOLBARCHANGE, onNotifyToolbarChange) NOTIFY_CODE_HANDLER(NM_CUSTOMDRAW, onNotifyCustomDraw) NOTIFY_CODE_HANDLER(TBN_ENDADJUST, onNotifyEndAdjust) MESSAGE_HANDLER(WM_SETREDRAW, onSetRedraw) END_MSG_MAP() // message handlers LRESULT onNotifyDropDown(WPARAM wParam, LPNMHDR pNMHDR, BOOL& bHandled); LRESULT onNotifyToolbarChange(WPARAM wParam, LPNMHDR pNMHDR, BOOL& bHandled); LRESULT onNotifyCustomDraw(WPARAM wParam, LPNMHDR pNMHDR, BOOL& bHandled); LRESULT onNotifyEndAdjust(WPARAM wParam, LPNMHDR pNMHDR, BOOL& bHandled); LRESULT onSetRedraw(UINT uMsg, WPARAM wParam, LPARAM lParam, BOOL& bHandled); // manage the subclassing of the IE rebar void subclass(); void unsubclass(); void handleSettings(); void setButtonMenu2(); bool findButton(HWND hWndToolbar); private: // handles to the various things HWND m_hWnd; HWND m_hWndToolbar, m_hWndRebar, m_hWndTooltip; HMENU m_hMenu; int m_buttonID; int m_ieVer; CIEWindow *m_ieWindow; // toolbar finding functions void scanForToolbarSlow(); void getRebarHWND(); void setButtonMenu(); };

    Read the article

  • Jetty: Stopping programatically causes "1 threads could not be stopped"

    - by Ondra Žižka
    Hi, I have an embedded Jetty 6.1.26 instance. I want to shut it down by HTTP GET sent to /shutdown. So I created a JettyShutdownServlet: @Override protected void doGet(HttpServletRequest req, HttpServletResponse resp) throws ServletException, IOException { resp.setStatus(202, "Shutting down."); resp.setContentType("text/plain"); ServletOutputStream os = resp.getOutputStream(); os.println("Shutting down."); os.close(); resp.flushBuffer(); // Stop the server. try { log.info("Shutting down the server..."); server.stop(); } catch (Exception ex) { log.error("Error when stopping Jetty server: "+ex.getMessage(), ex); } However, when I send the request, Jetty does not stop - a thread keeps hanging in org.mortbay.thread.QueuedThreadPool on the line with this.wait(): // We are idle // wait for a dispatched job synchronized (this) { if (_job==null) this.wait(getMaxIdleTimeMs()); job=_job; _job=null; } ... 2011-01-10 20:14:20,375 INFO org.mortbay.log jetty-6.1.26 2011-01-10 20:14:34,756 INFO org.mortbay.log Started [email protected]:17283 2011-01-10 20:25:40,006 INFO org.jboss.qa.mavenhoe.MavenHoeApp Shutting down the server... 2011-01-10 20:25:40,006 INFO org.mortbay.log Graceful shutdown [email protected]:17283 2011-01-10 20:25:40,006 INFO org.mortbay.log Graceful shutdown org.mortbay.jetty.servlet.Context@1672bbb{/,null} 2011-01-10 20:25:40,006 INFO org.mortbay.log Graceful shutdown org.mortbay.jetty.webapp.WebAppContext@18d30fb{/jsp,file:/home/ondra/work/Mavenhoe/trunk/target/classes/org/jboss/qa/mavenhoe/web/jsp} 2011-01-10 20:25:43,007 INFO org.mortbay.log Stopped [email protected]:17283 2011-01-10 20:25:43,009 WARN org.mortbay.log 1 threads could not be stopped 2011-01-10 20:26:43,010 INFO org.mortbay.log Shutdown hook executing 2011-01-10 20:26:43,011 INFO org.mortbay.log Shutdown hook complete It blocks for exactly one minute, then shuts down. I've added the Graceful shutdown, which should allow me to shut the server down from a servlet; However, it does not work as you can see from the log. I've solved it this way: Server server = new Server( PORT ); server.setGracefulShutdown( 3000 ); server.setStopAtShutdown(true); ... server.start(); if( server.getThreadPool() instanceof QueuedThreadPool ){ ((QueuedThreadPool) server.getThreadPool()).setMaxIdleTimeMs( 2000 ); } setMaxIdleTimeMs() needs to be called after the start(), becase the threadPool is created in start(). However, the threads are already created and waiting, so it only applies after all threads are used at least once. I don't know what else to do except some awfulness like interrupting all threads or System.exit(). Any ideas? Is there a good way? Thanks, Ondra

    Read the article

  • SQL Native Client 10 Performance miserable (due to server-side cursors)

    - by namezero
    we have an application that uses ODBC via CDatabase/CRecordset in MFC (VS2010). We have two backends implemented. MSSQL and MySQL. Now, when we use MSSQL (with the Native Client 10.0), retrieving records with SELECT is dramatically slow via slow links (VPN, for example). The MySQL ODBC driver does not exhibit this nasty behavior. For example: CRecordset r(&m_db); r.Open(CRecordset::snapshot, L"SELECT a.something, b.sthelse FROM TableA AS a LEFT JOIN TableB AS b ON a.ID=b.Ref"); r.MoveFirst(); while(!r.IsEOF()) { // Retrieve CString strData; crs.GetFieldValue(L"a.something", strData); crs.MoveNext(); } Now, with the MySQL driver, everything runs as it should. The query is returned, and everything is lightning fast. However, with the MSSQL Native Client, things slow down, because on every MoveNext(), the driver communicates with the server. I think it is due to server-side cursors, but I didn't find a way to disable them. I have tried using: ::SQLSetConnectAttr(m_db.m_hdbc, SQL_ATTR_ODBC_CURSORS, SQL_CUR_USE_ODBC, SQL_IS_INTEGER); But this didn't help either. There are still long-running exec's to sp_cursorfetch() et al in SQL Profiler. I have also tried a small reference project with SQLAPI and bulk fetch, but that hangs in FetchNext() for a long time, too (even if there is only one record in the resultset). This however only happens on queries with LEFT JOINS, table-valued functions, etc. Note that the query doesn't take that long - executing the same SQL via SQL Studio over the same connection returns in a reasonable time. Question1: Is is possible to somehow get the native client to "cache" all results locally use local cursors in a similar fashion as the MySQL driver seems to do it? Maybe this is the wrong approach altogether, but I'm not sure how else to do this. All we want is to retrieve all data at once from a SELECT, then never talk the server again until the next query. We don't care about recordset updates, deletes, etc or any of that nonsense. We only want to retrieve data. We take that recordset, get all the data, and delete it. Question2: Is there a more efficient way to just retrieve data in MFC with ODBC?

    Read the article

  • Modify values on-the-fly during SqlAdapter.Fill( )

    - by Timothy
    What would the proper way be to modify values on the fly as they are loaded into a DataTable by SqlAdapter.Fill()? I have globalized my application's log messages. An integer indicating the event type and serialized data relevant to the event is stored in the database as show below. When I display the logged events through a DataGridView control to the user, I interpolate the data to a formatting string. event_type event_timestamp event_details ============================================ 3 2010-05-04 20:49:58 jsmith 1 2010-05-04 20:50:42 jsmith ... I am currently iterating through the DataTable's rows to format the messages. public class LogDataTable : DataTable { public LogDataTable() { Locale = CultureInfo.CurrentCulture; Columns.AddRange(new DataColumn[] { new DataColumn("event_type", typeof(Int32)), new DataColumn("event_timestamp", typeof(DateTime)), new DataColumn("event_details", typeof(String))}); } } ... using (SqlDataAdapter adapter = new SqlDataAdapter(...)) { adapter.SelectCommand.Parameters.AddRange(new Object[] { ... }); adapter.Fill(table); } foreach (DataRow row in table.Rows) { switch ((LogEventType)row["event_type"]) { case LogEventType.Create: row["event_details"] = String.Format(Resources.Strings.LogEventCreateMsg, row["event_details"]; break; case LogEventType.Create: row["event_details"] = String.Format(Resources.Strings.LogEventCreateMsg, row["event_details"]; break; ... The end result as displayed would resemble: Type Date and Time Details ==================================================================== [icon] 2010-05-04 20:49:58 Failed login attempt with username jsmith [icon] 2010-05-04 20:50:42 Successful login with username jsmith ... It seems wasteful to iterate the result set twice-- once as the table is filled by the adapter, and again to perform the replacements. I would really like to do the replacement on-the-fly in my LogDataTable class as it is being populated. I have tried overriding an OnRowChanging method in LogDataTable, which throws an InRowChangingEventException. protected override void OnRowChanging(DataRowChangeEventArgs e) { base.OnRowChanging(e); switch ((LogEventType)row["event_type"]) ... I have tried overriding an OnRowChanged method, which throws a StackOverflowException (I assume changing it re-triggers the method ad infinitum?). I have tried overriding an OnTableNewRow method, which does not throw an exception but appears not to be invoked (I assume only when a user adds a row in the view, which I've prevented). I'd greatly appreciate any assistance anyone can give me.

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • Loading images to UIScrollview crashes

    - by Icky
    Hello All. I have a Navigationcontroller pushing a UIViewController with a scrollview inside. Within the scrollview I download a certain number of images around 20 (sometimes more) each sized around 150 KB. All these images are added to the scrollview so that their origin is x +imageSize and the following is sorted right to the one before. All in all I think its a lot of data (3-4 MB). On an I pod Touch this sometimes crashes, the IPhone can handle it once, if it has to load the data again (some other images) , it crashes too. I guess its a memory issue but within my code, I download the image, save it to a file on the phone as NSData, read it again from file and add it to a UIImageview which I release. So I have freed the memory I allocated, nevertheless it still crashes. Can anyone help me out? Since Im new to this, I dont know the best way to handle the Images in a scrollview. Besides I create the controller at start from nib, which means I dont have to release it, since I dont use alloc - right? Code: In my rootviewcontroller I do: -(void) showImages { [[self naviController] pushViewController:imagesViewController animated:YES]; [imagesViewController viewWillAppear:YES]; } Then in my Controller handling the scroll View, this is the method to load the images: - (void) loadOldImageData { for (int i = 0; i < 40 ; i++) { NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectory stringByAppendingPathComponent:[NSString stringWithFormat:@"img%d.jpg", i]]; NSData *myImg = [NSData dataWithContentsOfFile:filePath]; UIImage *im = [UIImage imageWithData:myImg]; if([im isKindOfClass:[UIImage class]]) { NSLog(@"IM EXISTS"); UIImageView *imgView = [[UIImageView alloc] initWithImage:im]; CGRect frame = CGRectMake(i*320, 0, 320, 416); imgView.frame = frame; [myScrollView addSubview:imgView]; [imgView release]; //NSLog(@"Adding img %d", i); numberImages = i; NSLog(@"setting numberofimages to %d", numberImages); //NSLog(@"scroll subviews %d", [myScrollView.subviews count]); } } myScrollView.contentSize = CGSizeMake(320 * (numberImages + 1), 416); }

    Read the article

  • Getting instance crashes on IntelliJ IDEA with scala plugin.

    - by egervari
    I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

    Read the article

  • AJAX, same-origin Policy and working XML Requests

    - by Joern
    Hello guys, so, currently I develop Widgets for Smartphones and am going a bit more advanced into fields of data exchange between client and server applications. My problem is: For my current project I want my client file to request data from a PHP script with the help of AJAX XmlHttpRequest and the POST method: function xmlRequestNotes() { var parameter = 'p=1234'; xmlhttp = new XMLHttpRequest(); xmlhttp.open("POST", url, true); // Http Header xmlhttp.setRequestHeader("Content-Type", "application/x-www-form-urlencoded"); xmlhttp.setRequestHeader("Content-length", parameter.length); xmlhttp.setRequestHeader("Connection", "close"); xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { json = JSON.parse(xmlhttp.responseText); // Doing Stuff with the Response } }; xmlhttp.send(parameter); } This works perfectly fine on my local server set up in XAMPP and the local Widget emulator. But if it gets onto the device (also with access to the target network) I receive the 101 Network Error. And as far as I have read, this is due to the "Same-Origin Policy" of XmlHttpRequests? My problem is to really understand that. Although the idea of this policy is clear to me, I'm a bit confused by the fact that another XmlHttpRequest for a Yahoo Weather XML Feed works fine. Now, could anyone be so helpful to enlighten me? Here is the request that returns a city name from Yahoo's weather feed: function getCityName() { xmlhttp = new XMLHttpRequest(); xmlhttp.open("GET", "http://weather.yahooapis.com/forecastrss?w=645458&u=c", true); xmlhttp.onreadystatechange = function() { if (xmlhttp.readyState==4 && xmlhttp.status==200) { xmlhttp.responseXML; var yweather = "http://xml.weather.yahoo.com/ns/rss/1.0"; alert(xmlhttp.responseXML.getElementsByTagNameNS(yweather, "location")[0].getAttribute("city")); } }; xmlhttp.send(null); } Obvious differences are the POST and GET methods for once, but seeing that the Same-Origin Policy takes effect no matter what method, I can't really make much sense of it. Why does the latter request work but not the first? I would really appreciate some help here. Greetings and a merry Christmas to you guys!

    Read the article

  • Android Extend BaseExpandableListAdapter

    - by Robert Mills
    I am trying to extend the BaseExpandableListAdapter, however when once I view the list and I select one of the elements to expand, the order of the list gets reversed. For example, if I have a list with 4 elements and select the 1st element, the order (from top to bottom) is now 4, 3, 2, 1 with the 4th element (now at the top) expanded. If I unexpand the 4th element the order reverts to 1, 2, 3, 4 with no expanded elements. Here is my implementation:`public class SensorExpandableAdapter extends BaseExpandableListAdapter { private static final int FILTER_POSITION = 0; private static final int FUNCTION_POSITION = 1; private static final int NUMBER_OF_CHILDREN = 2; ArrayList mParentGroups; private Context mContext; private LayoutInflater mInflater; public SensorExpandableAdapter(ArrayList<SensorType> parentGroup, Context context) { mParentGroups = parentGroup; mContext = context; mInflater = LayoutInflater.from(mContext); } @Override public Object getChild(int groupPosition, int childPosition) { // TODO Auto-generated method stub if(childPosition == FILTER_POSITION) return "filter"; else return "function"; } @Override public long getChildId(int groupPosition, int childPosition) { return childPosition; } @Override public View getChildView(int groupPosition, int childPosition, boolean isLastChild, View convertView, ViewGroup parent) { if(convertView == null) { //do something convertView = (RelativeLayout)mInflater.inflate(R.layout.sensor_row_list_item, parent, false); if(childPosition == FILTER_POSITION) { ((CheckBox)convertView.findViewById(R.id.chkTextAddFilter)).setText("Add Filter"); } else { ((CheckBox)convertView.findViewById(R.id.chkTextAddFilter)).setText("Add Function"); ((CheckBox)convertView.findViewById(R.id.chkTextAddFilter)).setEnabled(false); } } return convertView; } @Override public int getChildrenCount(int groupPosition) { // TODO Auto-generated method stub return NUMBER_OF_CHILDREN; } @Override public Object getGroup(int groupPosition) { return mParentGroups.get(groupPosition); } @Override public int getGroupCount() { // TODO Auto-generated method stub return mParentGroups.size(); } @Override public long getGroupId(int groupPosition) { // TODO Auto-generated method stub return groupPosition; } @Override public View getGroupView(int groupPosition, boolean isExpanded, View convertView, ViewGroup parent) { if(convertView == null) { convertView = mInflater.inflate(android.R.layout.simple_expandable_list_item_1, parent, false); TextView tv = ((TextView)convertView.findViewById(android.R.id.text1)); tv.setText(mParentGroups.get(groupPosition).toString()); } return convertView; } @Override public boolean hasStableIds() { // TODO Auto-generated method stub return true; } @Override public boolean isChildSelectable(int groupPosition, int childPosition) { // TODO Auto-generated method stub return true; } } ` I just need to take a simple ArrayList of my own SensorType class. The children are the same for all classes, just two. Also, how do I go about making the parent in each group LongClickable? I have tried in my ExpandableListActivity with this getExpandableListView().setOnLongClickableListener() ... and on the parent TextView set its OnLongClickableListener but neither works. Any help on either of these is greatly appreciated!

    Read the article

  • C++ Undeclared Identifier (but it is declared?)

    - by Joshua
    I'm pretty sure I've included the qanda class, but when I try to declare a vector that contains it or a class of that type I get an error saying that qanda is undefined. Any idea what the problem might be? bot_manager_item.h #pragma once #include "../bot_packet/bot_packet.h" #include <vector> class bot_manager_item; #include "qanda.h" #include "bot_manager.h" class bot_manager_item { public: bot_manager_item(bot_manager* mngr, const char* name, const char* work_dir); ~bot_manager_item(); bool startup(); void cleanup(); void on_push_event(bot_exchange_format f); bool disable; private: void apply_changes(); bot_manager *_mngr; std::string _name; std::string _work_dir; std::string _message; std::string _message_copy; std::vector<qanda> games; qanda test; char _config_full_path[2600]; }; qanda.h #ifndef Q_AND_A #define Q_AND_A #include "users.h" #include "..\bot_packet\bot_packet.h" #include "bot_manager.h" #include <string> #include <algorithm> #include <map> #include <vector> #include <fstream> class qanda { public: qanda(bot_manager * manager, std::string name, std::string directory); ~qanda(){}; void room_message(std::string username, std::string user_message); void timer_tick(); private: // data members std::string question; std::string answer; std::string directory; std::string command_prefix; std::string name; Users users; std::map <std::string, std::string> questions_and_answers; int time_per_question; // seconds int time_between_questions; // seconds int timer; // milliseconds bool is_delayed; bool is_playing; bot_manager * manager; // functions void new_question(); void send_message(std::string msg); void announce_question(); void load_questions(); }; #endif

    Read the article

  • Any way to allow classes implementing IEntity and downcast to have operator == comparisons?

    - by George Mauer
    Basically here's the issue. All entities in my system are identified by their type and their id. new Customer() { Id = 1} == new Customer() {Id = 1}; new Customer() { Id = 1} != new Customer() {Id = 2}; new Customer() { Id = 1} != new Product() {Id = 1}; Pretty standard scenario. Since all Entities have an Id I define an interface for all entities. public interface IEntity { int Id { get; set;} } And to simplify creation of entities I make public abstract class BaseEntity<T> : where T : IEntity { int Id { get; set;} public static bool operator ==(BaseEntity<T> e1, BaseEntity<T> e2) { if (object.ReferenceEquals(null, e1)) return false; return e1.Equals(e2); } public static bool operator !=(BaseEntity<T> e1, BaseEntity<T> e2) { return !(e1 == e2); } } where Customer and Product are something like public class Customer : BaseEntity<Customer>, IEntity {} public class Product : BaseEntity<Product>, IEntity {} I think this is hunky dory. I think all I have to do is override Equals in each entity (if I'm super clever, I can even override it only once in the BaseEntity) and everything with work. So now I'm expanding my test coverage and find that its not quite so simple! First of all , when downcasting to IEntity and using == the BaseEntity< override is not used. So what's the solution? Is there something else I can do? If not, this is seriously annoying. Upadate It would seem that there is something wrong with my tests - or rather with comparing on generics. Check this out [Test] public void when_created_manually_non_generic() { // PASSES! var e1 = new Terminal() {Id = 1}; var e2 = new Terminal() {Id = 1}; Assert.IsTrue(e1 == e2); } [Test] public void when_created_manually_generic() { // FAILS! GenericCompare(new Terminal() { Id = 1 }, new Terminal() { Id = 1 }); } private void GenericCompare<T>(T e1, T e2) where T : class, IEntity { Assert.IsTrue(e1 == e2); } Whats going on here? This is not as big a problem as I was afraid, but is still quite annoying and a completely unintuitive way for the language to behave. Update Update Ah I get it, the generic implicitly downcasts to IEntity for some reason. I stand by this being unintuitive and potentially problematic for my Domain's consumers as they need to remember that anything happening within a generic method or class needs to be compared with Equals()

    Read the article

  • Rails, Edit page update in a window

    - by Mike
    I have my code working so that I have a table of businesses. There's a pencil icon you can click on the edit the business information. The edit information comes up in a partial inside of a modal pop up box. The only problem is that once they make the changes they want and click update, it sends them to the 'show' page for that business. What I want to happen is have the pop up box close and have it update the information. This is my update function in my controller. def update @business = Business.find(params[:id]) respond_to do |format| if @business.update_attributes(params[:business]) flash[:notice] = 'Business was successfully updated.' format.html { redirect_to(business_url(@business)) } format.js else format.html { render :action => "edit" } format.xml { render :xml => @business.errors, :status => :unprocessable_entity } end end end I tried following railscast 43 and i created an .rjs file but I couldn't get that to work at all. My update was still taking me to the show page. Any help would be appreciated. EDIT: Added some more code. <% form_for(@business) do |f| %> <%= f.error_messages %> <p> <%= f.label :name %><br /> <%= f.text_field :name %> </p> ... <%= f.label :business_category %><br /> <%= f.select :business_category_id, @business_categories_map, :selected => @business.business_category_id %> </p> <p> <%= f.label :description %><br /> <%= f.text_area :description %> </p> <p> <%= f.submit 'Update' %> </p> <% end %> This is my form inside of my edit page which is being called through the index in a pop up by: <div id="popupEdit<%=h business.id %>" class="popupContact"> <a class="popupClose<%=h business.id %>" id="popupClose">x</a> <% if business.business_category_id %> <% @business = business %> <%= render "business/edit" %> <% end %> </div>

    Read the article

< Previous Page | 799 800 801 802 803 804 805 806 807 808 809 810  | Next Page >