Daily Archives

Articles indexed Tuesday September 25 2012

Page 1/18 | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Game login server

    - by Tar
    I have a setup like this: A website, with a database. This database houses accounts and all details. Password hashes/salts/join dates/etc. What I want to do is to be able to use this same database for our game database. The game will be on servers in the United States while the web server and web server database is in the Netherlands. I know there is a big problem with using remote SQL and we really don't want to do that as operation of the website is just as vital as operation of the game server. We had one solution that involved sending account details to another database hosted on the same server that the gameserver is hosted on, but that was incredibly unreliable because if the website was down, no new people could register to play the game. The solution that we want is to have a log in server that is used to check credentials for everything. Is this possible/viable and could anyone point in the right direction? So, in summation: 2 game servers 1 web servers 1 central database used for authorization. The game accounts and website accounts need to be one in the same.

    Read the article

  • MySQL binlogs seems incomplete?

    - by warl0ck
    I created a Database, a table and inserted some data, and found this binlog.0000001 in my log folder, but when I do mysqlbinlog binlog.0000001, it only shows stuff below, seems incomplete: (There's only two files in the log dir: binlog.000001 binlog.index) /*!40019 SET @@session.max_insert_delayed_threads=0*/; /*!50003 SET @[email protected]@COMPLETION_TYPE,COMPLETION_TYPE=0*/; DELIMITER /*!*/; # at 4 #120924 21:12:56 server id 1 end_log_pos 107 Start: binlog v 4, server v 5.5.24-0ubuntu0.12.04.1-log created 120924 21:12:56 at startup # Warning: this binlog is either in use or was not closed properly. ROLLBACK/*!*/; BINLOG ' GAVhUA8BAAAAZwAAAGsAAAABAAQANS41LjI0LTB1YnVudHUwLjEyLjA0LjEtbG9nAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAYBWFQEzgNAAgAEgAEBAQEEgAAVAAEGggAAAAICAgCAA== '/*!*/; DELIMITER ; # End of log file ROLLBACK /* added by mysqlbinlog */; /*!50003 SET [email protected]_COMPLETION_TYPE*/; If this warning was the cause: Warning: this binlog is either in use or was not closed properly.. How do I force close the log? EDIT After flush logs command, I see "0 rows" affected, and a few new files, binlog.000001 binlog.000002 binlog.000003 binlog.000004 binlog.index, the contents are nearly the same as binlog.000001. Now I dropped the database, and try restore it with mysqlbinlog binlog.0* | mysql -u root -p, but the database wasn't recovered. EDIT 2 [mysqld] user = mysql pid-file = /var/run/mysqld/mysqld.pid socket = /var/run/mysqld/mysqld.sock port = 3306 basedir = /usr datadir = /var/lib/mysql tmpdir = /tmp lc-messages-dir = /usr/share/mysql skip-external-locking log-bin=/var/log/mysql/binlog binlog-do-db=mydb bind-address = 127.0.0.1 key_buffer = 16M max_allowed_packet = 16M thread_stack = 192K thread_cache_size = 8 myisam-recover = BACKUP query_cache_limit = 1M query_cache_size = 16M expire_logs_days = 10 max_binlog_size = 100M P.S /var/log/mysql{.err,.log} are both empty

    Read the article

  • iptables forwarding between two interface

    - by broody
    So I have a linux box with two wireless interfaces, one is a station and the other an AP. wlan0 (station) - Connected to the internet connection wlan1 (AP) - Other clients connect to it. I would like for clients connected to wlan1 to be able to access the internet on wlan0. And I'd like to do this with iptables as my kernel doesn't have bridging support... Here's what I've tried so far with iptables but it's not working: iptables -A FORWARD -i wlan0 -o wlan1 -j ACCEPT iptables -A FORWARD -i wlan1 -o wlan0 -j ACCEPT I'd appreciate any help.

    Read the article

  • How to make sysctl network bridge settings persist after a reboot?

    - by user183394
    I am setting up a notebook for software demo purpose. The machine has 8GB RAM, a Core i7 Intel CPU, a 128GB SSD, and runs Ubuntu 12.04 LTS 64bit. The notebook is used as a KVM host and runs a few KVM guests. All such guests use the virbr0 default bridge. To enable them to communicate with each other using multicast, I added the following to the host's /etc/sysctl.conf, as shown below net.bridge.bridge-nf-call-ip6tables = 0 net.bridge.bridge-nf-call-iptables = 0 net.bridge.bridge-nf-call-arptables = 0 Afterwards, following man sysctl(8), I issued the following: sudo /sbin/sysctl -p /etc/sysctl.conf My understanding is that this should make these settings persist over reboots. I tested it, and was surprised to find out the following: [email protected] :/proc/sys/net/bridge# more *tables :::::::::::::: bridge-nf-call-arptables :::::::::::::: 1 :::::::::::::: bridge-nf-call-ip6tables :::::::::::::: 1 :::::::::::::: bridge-nf-call-iptables :::::::::::::: 1 All defaults are coming back! Yes. I can use some kludgy "get arounds" such as putting a /sbin/sysctl -p /etc/sysctl.conf into the host's /etc/rc.local but I would rather "do it right". Did I misunderstand the man page or is there something that I missed? Thanks for any hints. -- Zack

    Read the article

  • What are the advantages and disadvantages of the various virtual machine image formats?

    - by Matt
    Xen and Virtualbox etc both support a range of different virtual machine image formats. These are: vmdk, vdi, qcow & qcow2, hdd & vhd. Without any bias toward a particular product, I'm wanting to know what are the advantages and disadvantages of the various formats both from a features perspective, robustness and speed? One piece of info I discovered in a forum post was this: "The major difference is that VDI uses relatively large blocks (1MB) when growing an image, and thus has less overhead for block pointers etc. but isn't ultimately space efficient in the sense that if a single byte is non-zero in such a 1MB block the entire space is used. VMDK in contrast uses 64K blocks, and thus has more management overhead and generally a bit less disk space consumption What offsets this is that VDI is more efficient when it comes to snapshots." You might be thinking, I want to know this because I want to know which format to choose? Not exactly, I'm developing some software which utilises these formats and want to support one or more of them. Simplicity, large disks and ease of development are my main drivers.

    Read the article

  • Setting up dynamic DNS for linked router

    - by cherrun
    I have a 'main' router that receives the internet signal from the ISP and another one in my room, connected with a cable. The main router is running its original firmware and is very limited in its features, unfortunately I can not change this router, since my phone company has some hardcoded stuff in there and the internet will only work with this router. My second router is running DD-WRT firmware. Now I need to set up dynamic DNS, so I can access my NAS machine remotely, which is connected to the second router. As mentioned, this can't be done with the main router, due to its limited features. DHCP is turned off on the second router, since it gets its IP from the main one. Is there a possibility to set up dynamic DNS on the second router, without changing any (or much) on the main router? Maybe as a side note: I live in Germany, don't know if the set up of the routers are different in other countries.

    Read the article

  • Mac Websharing Off but Process Running

    - by benedict_w
    I have my mac setup to use php / mysql / apache via macports. Recently it has gone a bit pear shaped: it seems that the local mac versions of apache and mysql are running blocking the macports services: (48)Address already in use: make_sock: could not bind to address [::]:80 (48)Address already in use: make_sock: could not bind to address [::]:443 Web sharing in System preferences is off - How can I properly disable it? I tried turning it on an off again in System Preferences but it would not changed from off to on. Also if I kill the process it starts running again.

    Read the article

  • Make Virtualhost detect Wildcard with and without preceding www

    - by jasondavis
    In my Apache (Xampp) httpd-vhosts.conf file I have added this Virtualhost It allows me to use Wildcard names like testserver1.dev and testserver2.dev I just have to make sure to add the name to my Windows Hosts file. <VirtualHost *:80> VirtualDocumentRoot E:/Server/htdocs/projects/%1/www ServerAlias *.dev </VirtualHost> What I would like to do though is add to this funtionality and make it work if the name begins with a www so testserver1.dev would also work as www.testserver1.dev The way it currently is set up, if I tried to access that URL, it would look in a folder called www.testserver1 instead of the folder testserver1

    Read the article

  • Moving from ColdFusion 8 to ColdFusion 10 - Migration Fails

    - by XenoFoxx
    After having made several attempts to migrate from a ColdFusion 8 Standard server to a ColdFusion 10 Standard server, it feels like I am "almost" there. I'm using the 64 bit installer from Adobe's website. I'm using a Windows Server 2008 (64 bit) server with IIS 7.0. The installation itself goes smooth and the services start and are running. But at the end of the installation it says "ColdFusion Installed, but with errors" and it generates a log file. The log file reads: Migration Error: : Check that "C:\ColdFusion8" is a valid directory and is an installation of either ColdFusion MX 6 or ColdFusionMX 7 and further down says: Status: WARNING Additional Notes: WARNING - Could not migrate settings from previous version of ColdFusion Custom Action: com.macromedia.ia.action.MigrateColdFusionAction Status: ERROR Additional Notes: ERROR - class com.macromedia.ia.action.MigrateColdFusionAction NonfatalInstallException null The applicationHost.config file has new XML referencing the ColdFusion 10 directory, but IIS is still using ColdFusion 8. I'm also going to guess that the settings in the CF Administrator have not been migrated based on the message in the log above. I've followed the instructions on Adobe's site, including ensuring that ASP.NET, CGI, ISAPI Extensions, and ISAPI Filters are all enabled. I've also enabled IIS 6 Metabase Compatibility even though I don't think it's needed. Has anyone else had similar issues with ColdFusion 10 and IIS 7. Currently I have uninstalled CF 10 and reverted back to

    Read the article

  • Coldfusion 8 crash

    - by Denis Topa
    I have a very big problem with coldfusion 8 on Windows server 2008 with IIS7. They are in production server and sometimes the the site is not available, I have to manually end the jrun.exe process from task manager and then the site is available. I realize that the process jrun.exe has abut 1.3Gb of memory used at the time it crash's. It happens 2-3 times a day, I have looking in the coldfusion logs and I did not found anything strange beside some warnings that some job exceeded the 300 sec of time execution. I forgot to mention that coldfusion is a 32bit application but the windows is a 64bit, this may be the problem? I'm not such good in coldfusion, so If someone knows how to troubleshoot please let me know Thanks!

    Read the article

  • ProFTPd with sftp first login fails, seconds succeeds

    - by Nahrub
    We are working with ProFTPd and SFTP module enabled. We have a problem with using the sftp module. When we try to connect to server in FileZilla we need to enter the password to the server twice, upon connection and upon each file upload, which is very undesired. How can we help this? any idea's? suggestions? when we use the interactive login type in FileZilla, it works when we enter the username and password twice.

    Read the article

  • LDAP ACLs with ldapmodify & .ldif file grand user access only

    - by plaetzchen
    I want to change the settings my new LDAP server let only users of the server read entries and not anonymous. Currently my olcAccess looks like this: olcAccess: {0} to attrs=userPassword,shadowLastChange by self write by anonymous auth by dn="cn=admin,dc=example,dc=com" write by * none olcAccess: {1} to * by self write by dn="cn=admin,dc=example,dc=com" write by * read I tried to change it like so: olcAccess: {0}to attrs=userPassword,shadowLastChange by self write by anonymous auth by dn="cn=admin,dc=example,dc=com" write by * none olcAccess: {1} to * by self write by dn="cn=admin,dc=exampme,dc=com" write by users read But that gives me no access at all. Can someone help me on this? thanks UPDATE: This is the log read after the changes mentioned by userxxx Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 fd=28 ACCEPT from IP=87.149.169.6:64121 (IP=0.0.0.0:389) Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 op=0 do_bind: invalid dn (pbrechler) Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 op=0 RESULT tag=97 err=34 text=invalid DN Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 op=1 UNBIND Sep 30 10:47:21 j16354 slapd[11805]: conn=1437 fd=28 closed Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 fd=28 ACCEPT from IP=87.149.169.6:64122 (IP=0.0.0.0:389) Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 op=0 do_bind: invalid dn (pbrechler) Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 op=0 RESULT tag=97 err=34 text=invalid DN Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 op=1 UNBIND Sep 30 10:47:21 j16354 slapd[11805]: conn=1438 fd=28 closed pbrechler should be a valid user but has no system user (we don't need it) admin does't work also List item

    Read the article

  • phpMyAdmin says mcrypt is missing, but it's not; cannot log in

    - by GradysGhost
    I've just compiled a web stack on Solaris 10. This is a fairly standard Apache 2 / MySQL 5 / PHP 5 stack with all the most recent stable versions. I dropped phpMyAdmin on the server and set up httpd.conf to get that online. When I browse to the page, login fails, and a persistent message appears beneath the login form: The mcrypt extension is missing. Please check your PHP configuration. However, I compiled PHP with the --with-mcrypt flag. A file, info.php: <?php phpinfo(); ?> shows that mcrypt support is enabled. Running: php -m on the command line shows that mcrypt is loaded. Google hasn't been much help, and I was hoping someone around these parts could throw some help my way. If I need to provide any further detail, please let me know what you need to know.

    Read the article

  • Configuring jdbc-pool (tomcat 7)

    - by john
    i'm having some problems with tomcat 7 for configuring jdbc-pool : i`ve tried to follow this example: http://www.tomcatexpert.com/blog/2010/04/01/configuring-jdbc-pool-high-concurrency so i have: conf/server.xml <GlobalNamingResources> <Resource type="javax.sql.DataSource" name="jdbc/DB" factory="org.apache.tomcat.jdbc.pool.DataSourceFactory" driverClassName="com.mysql.jdbc.Driver" url="jdbc:mysql://localhost:3306/mydb" username="user" password="password" /> </GlobalNamingResources> conf/context.xml <Context> <ResourceLink type="javax.sql.DataSource" name="jdbc/LocalDB" global="jdbc/DB" /> <Context> and when i try to do this: Context initContext = new InitialContext(); Context envContext = (Context)initContext.lookup("java:/comp/env"); DataSource datasource = (DataSource)envContext.lookup("jdbc/LocalDB"); Connection con = datasource.getConnection(); i keep getting this error: javax.naming.NameNotFoundException: Name jdbc is not bound in this Context at org.apache.naming.NamingContext.lookup(NamingContext.java:803) at org.apache.naming.NamingContext.lookup(NamingContext.java:159) pls help tnx

    Read the article

  • Bad to be logged in as admin all the time?

    - by poke
    At the office where I work, three of the other members of the IT staff are logged into their computers all the time with accounts that are members of the domain administrators group. I have serious concerns about being logged in with admin rights (either local or for the domain). As such, for everyday computer use, I use an account that just has regular user privelages. I also have an different account that is part of the domain admins group. I use this account when I need to do something that requires elevated privilages on my computer, one of the servers, or on another user's computer. What is the best practice here? Should network admins be logged in with rights to the entire network all the time (or even their local computer for that matter)?

    Read the article

  • URL Rewrite in IIS7 Web Service - WebService.asmx => WebService in the SOAP doc

    - by Robert Kaucher
    I have an IIS7.5 (Server 2008 R2) based web service that I would like to make as independant on the current implementations technology as possible. I am using the URL rewrite module (http://learn.iis.net/page.aspx/734/url-rewrite-module/) to remove the .asmx portion of the URL and that is working fine for the HTTP request portion. However, I still see .asmx in the WSDL file when I access it. I was wondering if anyone has done this and if so, what advice could be offered. It doesn't seem like a hard problem to solve. But I have tries a number of things with "custom tags" and can't seem to get it working to save my life.

    Read the article

  • How to fade away the icon in the dock when close the program in Mac OSX

    - by Magic
    I'm using Mac OSX Mountain Lion. But some program in the dock confusing me. When I close some program(upper left close button). The icon in the dock fade away. That mean the process close. But some program doesn't fade away(mean the process still alive), And I don't select the "Show in Dock" option. Like Microsoft Office(Word, Excel). It's too annoying. What I want is when I click the upper left close button. The icon will fade away and the program close?

    Read the article

  • UPS: Do i require a special extension cord for power in?

    - by rism
    I have a couple of Tripplite UPS systems. The power in cables are bright orange and about 2 meters in length. I want to put the system on the other side of the room but for some reason the UPS keep "going off" over there. So I guess the wall power sockets on that side of the room are a little dodgy. So i figured Id just go online and get some replacement UPS power IN (from wall to UPS) cables of an appropriate length. But i cant find any anywhere. (auction sites, tripplite store, cable websites). So now I'm wondering if that's just because you can use a standard extension cord of an appropriate wattage? I thought the UPS power IN cables were "special". Is that not so?

    Read the article

  • SSH into VirtualBox Guest: Connection Refused

    - by Eric J.
    Setup Windows 7 64-bit host OS running VirtualBox 4.2, with Ubuntu 12.04 guest OS. OpenSSH server is installed and running (ssh -v localhost connects locally in the guest machine). Can SSH to external servers (no outbound Windows firewall rule blocking port 22) Can ping the IP of the guest (192.168.56.101) Problem Using PuTTY to SSH to the IP of the guest OS (192.168.56.101), PuTTY returns almost immediately with Network error: connection refused How can I diagnose & resolve this issue?

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • I want to change DPI with Imagemagick without changing the actual byte-size of the image data

    - by user1694803
    I feel so horribly sorry that I have to ask this question here, but after hours of researching how to do an actually very simple task I'm still failing... In Gimp there is a very simple way to do what I want. I only have the German dialog installed but I'll try to translate it. I'm talking about going to "Picture-PrintingSize" and then adjusting the Values "X-Resolution" and "Y-Resolution" which are known to me as so called DPI values. You can also choose the format which by default is "Pixel/Inch". (In German the dialog is "Bild-Druckgröße" and there "X-Auflösung" and "Y-Auflösung") Ok, the values there are often "72" by default. When I change them to e.g. "300" this has the effect that the image stays the same on the computer, but if I print it, it will be smaller if you look at it, but all the details are still there, just smaller - it has a higher resolution on the printed paper (but smaller size... which is fine for me). I am often doing that when I am working with LaTeX, or to be exact with the command "pdflatex" on a recent Ubuntu-Machine. When I'm doing the above process with Gimp manually everything works just fine. The images will appear smaller in the resulting PDF but with high printing quality. What I am trying to do is to automate the process of going into Gimp and adjusting the DPI values. Since Imagemagick is known to be superb and I used it for many other tasks I tried to achieve my goal with this tool. But it does just not do what I want. After trying a lot of things I think this actually is be the command that should be my friend: convert input.png -density 300 output.png This should set the DPI to 300, as I can read everywhere in the web. It seems to work. When I check the file it stays the same. file input.png output.png input.png: PNG image data, 611 x 453, 8-bit grayscale, non-interlaced output.png: PNG image data, 611 x 453, 8-bit grayscale, non-interlaced When I use this command, it seems like it did what I wanted: identify -verbose output.png | grep 300 Resolution: 300x300 PNG:pHYs : x_res=300, y_res=300, units=0 (Funny enough, the same output comes for input.png which confuses me... so this might be the wrong parameters to watch?) But when I now render my TeX with "pdflatex" the image is still big and blurry. Also when I open the image with Gimp again the DPI values are set to "72" instead of "300". So there actually was no effect at all. Now what is the problem here. Am I getting something completely wrong? I can't be that wrong since everything works just fine with Gimp... Thanks for any help in this. I am also open to other automated solutions which are easily done on a Linux system...

    Read the article

  • Open Office crashes, recovers, crashes again

    - by Daniel R Hicks
    After completely reinstalling my laptop due to apparent registry corruption, I've encountered a problem with Open Office: I open a simple Calc spreadsheet, it comes up normally, but then after anywhere from 5 seconds to several minutes (without even touching the Calc window) OO crashes, then comes up through recovery. If I let it "recover" it will do so and bring the spreadsheet up again, only to repeat the crash scenario again. If I kept clicking "OK" it would apparently do this all day. I reinstalled OO once and the problem went away for awhile, but it came back. I then attempted to "reset" my profile (ie, rename the OO user directory in App Data), but OO crashed during the first startup after that, then resumed the original behavior. If I open the same file using Excel it complains of errors in the file, and "recovers" them, but the "error report" it generates contains no details. If I save the "recovered" file then OO Calc will open it, but the problem returns after saving again. Any ideas? (The system is Vista SP2, running OO 3.4.1) How to reproduce: Start Open Office Calc. Save workspace as "CrashTest.ods" From Task Manager kill Open Office (soffice.exe/bin -- one of each) Double click on the saved "CrashTest.ods" in Explorer. OO puts up a message that recovery will occur -- allow it. When the Calc window comes up, don't touch it -- just wait about 10 seconds. Calc window closes and OO puts up a message that recovery will occur -- from now on the sequence will repeat. I suspect this behavior is limited to a few (recent) versions of OO, and very possibly only Calc. Reported as Open Office Bug 1211094. Sigh!! As much as it irritates me, I'm having to switch over to Excel for several things I used to do with Calc. Excel has a miserable UI, but at least it says up for longer than 10 seconds.

    Read the article

  • How do I get my Nvidia monitor position settings (in Linux) to persist after a restart?

    - by machineghost
    I have two monitors, and I run them both in Linux using the proprietary Nvidia drivers with "TwinView". I just installed Linux Mint 13, and since the install after every reboot my monitors come up in the wrong position (the computer thinks the left monitor is on the right). After boot-up I can run the Nvidia config and fix the monitors' position, and I can even save the configuration file successfully. But as soon as I restart again, the monitors re-appear switched. Does anyone have any idea what might be causing this (and more importantly, how I can solve it?)

    Read the article

  • Mac OS X behind OpenLDAP and Samba

    - by Sam Hammamy
    I have been battling for a week now to get my Mac (Mountain Lion) to authenticate on my home network's OpenLDAP and Samba. From several sources, like the Ubuntu community docs, and other blogs, and after a hell of a lot of trial and error and piecing things together, I have created a samba.ldif that will pass the smbldap-populate when combined with apple.ldif and I have a fully functional OpenLDAP server and a Samba PDC that uses LDAP to authenticate the OS X Machine. The problem is that when I login, the home directory is not created or pulled from the server. I get the following in system.log Sep 21 06:09:15 Sams-MacBook-Pro.local SecurityAgent[265]: User info context values set for sam Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Got user: sam Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Got ruser: (null) Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Got service: authorization Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in od_principal_for_user(): no authauth availale for user. Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in od_principal_for_user(): failed: 7 Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Failed to determine Kerberos principal name. Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Done cleanup3 Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): Kerberos 5 refuses you Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_authenticate(): pam_sm_authenticate: ntlm Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_acct_mgmt(): OpenDirectory - Membership cache TTL set to 1800. Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in od_record_check_pwpolicy(): retval: 0 Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_setcred(): Establishing credentials Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_setcred(): Got user: sam Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_setcred(): Context initialised Sep 21 06:09:15 Sams-MacBook-Pro.local authorizationhost[270]: in pam_sm_setcred(): pam_sm_setcred: ntlm user sam doesn't have auth authority All that's great and good and I authenticate. Then I get CFPreferences: user home directory for user kCFPreferencesCurrentUser at /Network/Servers/172.17.148.186/home/sam is unavailable. User domains will be volatile. Failed looking up user domain root; url='file://localhost/Network/Servers/172.17.148.186/home/sam/' path=/Network/Servers/172.17.148.186/home/sam/ err=-43 uid=9000 euid=9000 If you're wondering where /Network/Servers/IP/home/sam comes from, it's from a couple of blogs that said the OpenLDAP attribute apple-user-homeDirectory should have that value and the NFSHomeDirectory on the mac should point to apple-user-homeDirectory I also set the attr apple-user-homeurl to <home_dir><url>smb://172.17.148.186/sam/</url><path></path></home_dir> which I found on this forum. Any help is appreciated, because I'm banging my head against the wall at this point. By the way, I intend to create a blog on my vps just for this, and create an install script in python that people can download so no one has to go through what I've had to go through this week :) After some sleep I am going to try to login from a windows machine and report back here. Thanks Sam

    Read the article

  • Gmail and FB is not rendering properly in Firefox

    - by Andy
    I am unable read Gmail in my Firefox browser on my laptop. However, there are no problems when I try to access Gmail on my office desktop. In fact, Gmail renders fine on IE on both computers. Things I have tried: Uninstalling and reinstalling Firefox. Using Firefox 3.6.26 and Firefox 10; same problem. Clearing the cache. But all to no avail. For starters: My background image does not get loaded. It says "Oops. Your selected image failed to load". The buttons for the new look do not get rendered, but when I do a mouse-over I see text which helps me navigate. When I try to read a message, I see the subject line and I see the reply / forward box. The message body does not get rendered, it seems like a styling error. Check this screenshot where the icons in the GMail new look are not rendered properly Check this screenshot where even facebook is not getting rendered properly EDIT: 25th Feb 2012 GMAIL is getting rendered fine in the old look

    Read the article

1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >