Daily Archives

Articles indexed Friday June 18 2010

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 16/76 | < Previous Page | 12 13 14 15 16 17 18 19 20 21 22 23  | Next Page >

  • Preloading images from XML into Flash

    - by tykebikemike
    I know this has been asked to death, but I cant seem to find the answer i'm looking for... I've put together a simple Flash/XML image gallery and I would like to preload the images - Simple process. Get the XML data Preload the images When all images are preloaded, go to next frame Here is my code thus far: var myXML:XML = new XML(); myXML.ignoreWhite = true; myXML.load("xmltest.xml"); myXML.onLoad = function(success){ if(success){ var myImage = myXML.firstChild.childNodes; for (i=0; i<myImage.length; i++){ var imageNumber = i+1; var imageName = myImage[i].attributes.name; var imageURL = myImage[i].firstChild.nodeValue; trace('image #: ' + imageNumber); trace('image name: ' + imageName); trace('image url: ' + imageURL + '\n'); } } }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • What is JAF? What is its purpose?

    - by Manoj
    Hi All, I am unable to understand the purpose of JAF(java activation Framework). Please explain me in simple terms or else where can i find simple material to learn. In Java Mail API, they are using JAF. I read, it was like finding the supporting data types of an object. But i couldn't understand. Please teach me!!

    Read the article

  • iPhone storekit productIdentifier

    - by Garfield81
    I am trying to implement the StoreKit on iPhone 3.1.3 and keep getting the invalidProductIdentifier error. The question I have is the productKey used in following two methods the same? SKProductsRequest *request= [[SKProductsRequest alloc] initWithProductIdentifiers: [NSSet setWithObject: @"com.companyName.productName.upgrade"]]; SKPayment *payment = [SKPayment paymentWithProductIdentifier:@"com.companyName.productName.upgrade"]; The reason i as is because I have tried different productIdentifiers and SKProductsRequest always comes back with invalidProductIdentifier but SKPayment returns SKErrorUnknown for almost all the productIdentifier I tried but interestingly returns SKErrorPaymentInvalid for the @"com.companyName.productName.upgrade" (with the companyName and productName substituted). Any help would be appreciated.

    Read the article

  • How to build where clause in MS SQL??

    - by Kai
    I would like to build the where clase of sql statement dynamatically from hashtable in C#. The key of the hash_table will be the column's name to be inserted and the value of hash_table will be value. string sql_1="SELECT COL_1,COL_2 FROM MY_TABLE"; string sql_2="SELECT * FROM MY_TABLE WHERE COL_3='ABC'"; //note: some statment have where clause while some do NOT have. string sql= ToSql(sql_1,myHashTable); // the actual sql statment will be returned from ToSql //execute sql sql= ToSql(sql_2,myHashTable); // //execute sql My Question is, how can I create function ToSql() function in LINQ? NOTE: The data type of the value of hashtable will be taken into consideration. Thanks in advance.

    Read the article

  • Load binary file using fstream

    - by Kirill V. Lyadvinsky
    I'm trying to load binary file using fstream in the following way: #include <iostream #include <fstream #include <iterator #include <vector using namespace std; int main() { basic_fstream<uint32_t file( "somefile.dat", ios::in|ios::binary ); vector<uint32_t buffer; buffer.assign( istream_iterator<uint32_t, uint32_t( file ), istream_iterator<uint32_t, uint32_t() ); cout << buffer.size() << endl; return 0; } But it doesn't work. In Ubuntu it crashed with std::bad_cast exception. In MSVC++ 2008 it just prints 0. I know that I could use file.read to load file, but I want to use iterator and operator>> to load parts of the file. Is that possible? Why the code above doesn't work?

    Read the article

  • Trouble rendering a view inside a generic class

    - by Horace Loeb
    I'm trying to encapsulate the logic for generating my sitemap in a separate class so I can use Delayed::Job to generate it out of band: class ViewCacher include ActionController::UrlWriter def initialize @av = ActionView::Base.new(Rails::Configuration.new.view_path) @av.class_eval do include ApplicationHelper end end def cache_sitemap songs = Song.all sitemap = @av.render 'sitemap/sitemap', :songs => songs Rails.cache.write('sitemap', sitemap) end end But whenever I try ViewCacher.new.cache_sitemap I get this error: ActionView::TemplateError: ActionView::TemplateError (You have a nil object when you didn't expect it! The error occurred while evaluating nil.url_for) on line #5 of app/views/sitemap/_sitemap.builder: I assume this means that ActionController::UrlWriter is not included in the right place, but I really don't know

    Read the article

  • Unable to access published programs on TS web access - win server 2008 OS

    - by varun
    I am using the TS Web Access feature provided by windows server 2008 to publish programs so that they can be accessed over internet using RDC client. I am able to access the programs from the intranet domain . However, when i try from outside the college network, i am only able to see the published programs but not connect to them as i get an error saying "Remote computer cannot be connected. The certificate subject name and the gateway address requested do not match." . pls note that i have created a self -signed certificate and installed on server myself. Also, i am using the direct IPAddress of the server as the gateway address. Since i am able to access programs from with domain , i suspect it to be a simple setting with gateway or certificate. Please let me know if any further info is required on this..any help is appreciated..

    Read the article

  • DBA Command line options

    - by Anthony Shorten
    There are a number of database utilities supplied with the installation of the Oracle Utilities Application Framework based products. These are typically run in interactive mode where the utility prompts you for the values and then executes the required functionality. Did you know that the utilities also have command line options that allow you to run the utility in silent mode as well? You can assess the command line options by specifying the -h option on the command line. Here is an example of the oragensec command line options: oragensec -d <Owner,OwnerPswd,DbName> -u <Database Users> -r <ReadRole,UserRole> -l <logfile> -h where: -d <Owner,OwnerPswd,DbName> Database connect information for the target database. e.g. spladm,spladm,DB200ODB. -u <Database Users> A comma-separated list of database users where synonyms need to be created. e.g. spluser, splread -r <ReadRole,UserRole> Optional. Names of database roles with read and read-write privileges. Default roles are SPL_READ, SPL_USER. e.g. spl_read,spl_user -l <logfile> Optional. Name of the log file. -h Help The command line options allow the DBA to automate the exeucution either via a script or some utility can than execute utilities. This optin can apply to the majority of DBA utilities supplied with the product. Take a look at others.

    Read the article

  • Audio Framework in iPhone

    - by suse
    There are three major frameworks for iPhone audio : AVFoundation Framework CoreAudio Framework OpenAL Library And in turn CoreAudio Framework has AudioToolkit Framework and AudioUnit Framework Is this correct? Suppose I import AVFoundation Framework into my project and it in turn needs a feature which is provided by CoreAudio Framework.. Can it internally access the features of CoreAudio without importing CoreAudio framework into my project?

    Read the article

  • i tried to implement tde in sql2008...n got the error below.....plz help me to resolve...

    - by mahima
    while using USE mssqltips_tde; CREATE DATABASE ENCRYPTION KEY with ALGORITHM = AES_256 ENCRYPTION BY SERVER CERTIFICATE TDECert GO getting error Msg 156, Level 15, State 1, Line 2 Incorrect syntax near the keyword 'KEY'. Msg 319, Level 15, State 1, Line 3 Incorrect syntax near the keyword 'with'. If this statement is a common table expression or an xmlnamespaces clause, the previous statement must be terminated with a semicolon. please help in resolving the same as i need to implement Encryption on my DB

    Read the article

  • Flex 4 animation question

    - by Jerry
    Hello.. I am trying to do the move vertically animation on a button nested in the vertical layout. I am not sure if the Hgroup restricts the button moving vertically. Are there ways to go around it? Thanks for the helps. <s:states> <s:State name="default"/> <s:State name="addRecommend"/> <s:State name="seeOther"/> </s:states> AS: protected function add_clickHandler(event:MouseEvent):void { currentState="addRecommend"; addRecommendMove.play(); } <s:transitions> <s:Transition fromState="default" toState="addRecommend"> <s:Sequence id="addRecommendMove"> <s:Move yTo="50" target="{add}"/> // add button doesn't move at all </s:Sequence> </s:Transition> <s:Transition fromState="addRecommend" toState="seeOther"> <s:Sequence> <s:Move yBy="50" target="{seeOthers}"/> </s:Sequence> </s:Transition> </s:transitions> <s:layout> <s:VerticalLayout paddingTop="15" paddingRight="10" paddingLeft="7"/> </s:layout> <button id="add" click=add_clickHandler(event)/> <button id="seeOthers"/>

    Read the article

  • 2D platformer gravity physics with slow-motion

    - by DD
    Hi all, I fine tuned my 2d platformer physics and when I added slow-motion I realized that it is messed up. The problem I have is that for some reason the physics still depends on framerate. So when I scale down time elapsed, every force is scaled down as well. So the jump force is scaled down, meaning in slow-motion, character jumps vertically smaller height and gravity force is scaled down as well so the character goes further in the air without falling. I'm sending update function in hopes that someone can help me out here (I separated vertical (jump, gravity) and walking (arbitrary walking direction on a platform - platforms can be of any angle) vectors): characterUpdate:(float)dt { //Compute walking velocity walkingAcceleration = direction of platform * walking acceleration constant * dt; initialWalkingVelocity = walkingVelocity; if( isWalking ) { if( !isJumping ) walkingVelocity = walkingVelocity + walkingAcceleration; else walkingVelocity = walkingVelocity + Vector( walking acceleration constant * dt, 0 ); } // Compute jump/fall velocity if( !isOnPlatform ) { initialVerticalVelocity = verticalVelocity; verticalVelocity = verticalVelocity + verticalAcceleration * dt; } // Add walking velocity position = position + ( walkingVelocity + initialWalkingVelocity ) * 0.5 * dt; //Add jump/fall velocity if not on a platform if( !isOnPlatform ) position = position + ( verticalVelocity + initialVerticalVelocity ) * 0.5 * dt; verticalAcceleration.y = Gravity * dt; }

    Read the article

  • dismissing uiwebview

    - by chimgrrl
    Ok, I really spend 2 days on this and it has gotten me stumped. From my main UIViewController I called a WebViewController which is a UIViewController with a UIWebView inside: UOLCategoriesWebViewController *ucwvcontroller = [[UOLCategoriesWebViewController alloc] initWithNibName:@"UOLCategoriesWebViewController" bundle:nil]; [self presentModalViewController:ucwvcontroller animated:YES]; [ucwvcontroller release]; Inside the UOLCategoriesWebViewController I've call the delegate method shouldStartLoadWithRequest where when the user clicks on a particular type of link it parses out the params and return back to the main UIViewController (or at least that's what I want it to do): - (BOOL)webView:(UIWebView*)webView shouldStartLoadWithRequest:(NSURLRequest*)request navigationType:(UIWebViewNavigationType)navigationType { BOOL continueOrExit = YES; NSURL *url = request.URL; NSString *urlString = [url relativeString]; NSString *urlParams = [url query]; NSArray *urlParamArr = [urlParams componentsSeparatedByString:@"&"]; NSLog(@"the url is: %@",urlString); //NSLog(@"the params are: %@,%@",[urlParamArr objectAtIndex:0],[urlParamArr objectAtIndex:1]); //BOOL endTrain1 = [[urlParamArr objectAtIndex:1] hasPrefix:@"subCatValue"]; //BOOL endTrain2 = ([urlParamArr objectAtIndex:1 //NSLog(@"Number of elements: %@",[urlParamArr count]); if (navigationType == UIWebViewNavigationTypeLinkClicked) { //NSLog(@"Enter into His glory"); if ([urlString hasSuffix:@"categories_list.php"]) { //NSLog(@"2nd Heaven"); continueOrExit = YES; }else if ([[urlParamArr objectAtIndex:1] hasPrefix:@"subCatValue"]) { continueOrExit = NO; NSLog(@"end of the train"); NSArray *firstParamStringArr = [[urlParamArr objectAtIndex:0] componentsSeparatedByString:@"="]; NSArray *secondParamStringArr = [[urlParamArr objectAtIndex:1] componentsSeparatedByString:@"="]; NSString *catSelected = [firstParamStringArr objectAtIndex:1]; NSString *subCatSelected = [secondParamStringArr objectAtIndex:1]; //go back to native app [self goBackToMain:catSelected andSubCat:subCatSelected]; } } return continueOrExit; } Actually in the above function where I am calling the goBackToMain method I want it to call the delegate method and return to the mainviewcontroller. Unfortunately after executing that goBackToMain method it goes back to this method and continue to return continueOrExit. Is there anyway to make it truly exit without returning anything? I've tried putting in multiple returns to no avail. Or can I in the html page pass some javascript to directly call this method so that I don't have to go through this delegate method? Thanks for the help in advance!

    Read the article

  • Disabling itemrenderer Hovered state

    - by duder
    My itemrenderer has 2 custom states, no hovered state, and no normal state <s:states> <s:State name="state1" /> <s:State name="state2" /> </s:states> When I initialize it, I force it to go to state2. The problem is that when it's hovered over, it relapses back to the first state state1. It's kind of weird since I don't really have a hovered state. Anyone knows how to prevent this from happening? maybe by somehow disabling the hover effect?

    Read the article

  • Show loading image when pdf rendering

    - by Pankaj
    I am displaying pdf on my page like this <object data="/Customer/GetPricedMaterialPDF?projID=<%= ViewData["ProjectID"]%>" type="application/pdf" width="960" height="900" style="margin-top: -33px;"> <p> It appears you don't have a PDF plugin for this browser. No biggie... you can <a href="/Customer/GetPricedMaterialPDF?projID=<%= ViewData["ProjectID"]%>">click here to download the PDF file. </a> </p> </object> and Controller function are public FileStreamResult GetPricedMaterialPDF(string projID) { System.IO.Stream fileStream = GeneratePDF(projID); HttpContext.Response.AddHeader("content-disposition", "attachment; filename=form.pdf"); return new FileStreamResult(fileStream, "application/pdf"); } private System.IO.Stream GeneratePDF(string projID) { //create your pdf and put it into the stream... pdf variable below //comes from a class I use to write content to PDF files System.IO.MemoryStream ms = new System.IO.MemoryStream(); Project proj = GetProject(projID); List<File> ff = proj.GetFiles(Project_Thin.Folders.IntegrationFiles, true); string fileName = string.Empty; if (ff != null && ff.Count > 0 && ff.Where(p => p.AccessToUserID == CurrentCustomer.CustomerID).Count() > 0) { ff = ff.Where(p => p.AccessToUserID == CurrentCustomer.CustomerID).ToList(); foreach (var item in ff) { fileName = item.FileName; } byte[] bArr = new byte[] { }; bArr = GetJDLFile(fileName); ms.Write(bArr, 0, bArr.Length); ms.Position = 0; } return ms; } Now my problem is function on controller taking 10 to 20 second to process pdf, data="/Customer/GetPricedMaterialPDF?projID=<%= ViewData["ProjectID"]%>" at that time my page shows blank, which i don't want. i want to show loading image at that time. How can i do this...

    Read the article

  • New Rules of Retail

    - by David Dorf
    I've been on vacation and preparing for Crosstalk, so its been a while since I've posted. I've seen the agenda, and I can assure you Crosstalk will be lots of fun. In addition to hearing from lots of retailers, we'll also be doing a little bowling and racing on the track. I'll be around for the sessions, the ORUG meetings, and our Customer Advisory Board so please be sure to say hello. I also just completed a white paper based on a previous blog posting which in turn was based on learnings from reading What Would Google Do? For each of Jarvis' ten rules, I discuss the concept in the context of retail and provide real-world examples. No mention of products or sales pitches at all. You can download the paper here. It will put you in the right frame of mind for hearing Jeff Jarvis speak at Crosstalk. For those that can't make it, I'll post some highlights afterwards.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 12 13 14 15 16 17 18 19 20 21 22 23  | Next Page >