Monthly Archives

Articles indexed in February 2011

Page 273/314 | < Previous Page | 269 270 271 272 273 274 275 276 277 278 279 280  | Next Page >

• Decorator Pattern on List<T> for DataGridView

  - by elector

  Hi all, I would like to apply a Decorator on List class and be able to bind it to the WinForms DataGirdView. I would like to know what members of List i need to implement for this new class to be able to bind it to DataGrid. Some of the methods from List I would hide with my decorated class methods and others I would just call _decoratedList.Method(). Is this an option for implementing Decorator on List type? Decorator: public class MyCustomList : List<MyObject> { List<MyObject> _decoratedList; . . . }

  Read the article

• Having difficulty in mapreduce to understand

  - by mahesh

  Hi all, I have seen the below link which is of getting started mapreduce with python http://code.google.com/p/appengine-mapreduce/wiki/GettingStartedInPython But still I am not able to understand how its working. I am executing below code but not able to understand what exactly is happening? mapreduce.yaml mapreduce: - name: Testmapper mapper: input_reader: mapreduce.input_readers.DatastoreInputReader handler: main.process params: - name: entity_kind default: main.userDetail mapreduce/main.py #some code class userDetail(db.Model): name = db.StringProperty() #some code def process(u): u.name="mahesh" yield op.db.Put(u) I am executing this and it gives me status = success in status page. But not able to understand what happend The main thing I want do with mapreduce is to search or count records from entity So anyone can please help me?? Thanks in advance

  Read the article

• What's best performance way to constantly change image on WP7?

  - by AlRodriguez

  I'm trying to make my own type of remote desktop for WP7. I have a WCF service that returns an image on what's on the target machine's screen. Here's the WCF Server Code: // Method to load desktop image Bitmap image = new Bitmap( ViewSize.Width, ViewSize.Height ); Graphics g = Graphics.FromImage( image ); g.CopyFromScreen( Position.X, Position.Y, 0, 0, ViewSize ); g.Dispose( ); return image; // Convert image to byte[] which is returned to client using ( MemoryStream ms = new MemoryStream( ) ) { Bitmap image = screenGrabber.LoadScreenImage( ); image.Save( ms, ImageFormat.Jpeg ); imageArray = ms.ToArray( ); } Here's the code for the WP7 client: MemoryStream stream = new MemoryStream( data ); BitmapImage image = new BitmapImage( ); image.SetSource( stream ); BackgroundImage.Source = image; The BackgroundImage variable is an Image control. I'm noticing this freeze on the emulator after a short while, and will eventually crash from an OutOfMemoryException. This is already pretty slow ( images show up a good half second later than what's on the screen ), and I'm wondering if there's a better/faster way of doing this? Any help would be great. Thanks in advance.

  Read the article

• Berkeley DB tuple with unknown datatype

  - by Ronnie

  I'm working with a Berkeley database (in Java). I need to read a tuple where the sequence is a string, either an int or long, then another string. How can I determine if the tuple holds an int or a long? Depending on what the tuple holds, I'll do one of the following: String s1 = input.readString(); int num1 = input.readInt(); String s2= input.readString(); or String s1 = input.readString(); long num1 = input.readLong(); String s2= input.readString(); The int is 4 bytes and the long is 8 bytes. If the tuple holds an int and I read it in as a long, I get an invalid value as it converts the 4 byte int + 4 bytes of the following string into a long.

  Read the article

• Parallelizing some LINQ to XML

  - by Lol coder

  How can I make this code run in parallel? List<Crop> crops = new List<Crop>(); //Get up to 10 pages of data. for (int i = 1; i < 10; i++) { //i is basically used for paging. XDocument document = XDocument.Load(string.Format(url, i)); crops.AddRange(from c in document.Descendants("CropType") select new Crop { //The data here. }); }

  Read the article

• Problem: scrolling a tableview and then select the searchbar (iphone)

  - by Samui

  Hello everyone, I've been stuck with this problem for hours and I can't see the light. Please give me a hand with this: I have a tableview and a searchbar. The searchbar is situated in the navigationbar. When I do a fast scroll of the tableview, if I select the searchbar while the tableview is still decelerating, a exception raises: Terminating app due to uncaught exception 'NSRangeException', reason: ' -[NSMutableArray objectAtIndex:]: index 31 beyond bounds for empty array' How can I stop programmatically the deceleration of the tableview? Thanks for your time!

  Read the article

• why the global variable value is not being set?

  - by masato-san

  I can't figure out why my global variable workRegionCode is not set properly. In function getWorkRegion(), after getting ajax callback, it attempt to set workRegionCode global variable. (inside of function setFirstIndexWorkRegionCode() ). The alert in setFirstIndexWorkRegionCode() outputs expected value like 401 or 123 etc. But then when getMachines() is called, the global variable workRegionCode is undefiend :( This js starts from window.onload() (please ignore those Japanese JSON key value and few Japanese variables. They are harmless) Code: var workRegionDropdown = document.getElementById("workRegionDropdown");; var machineDropdown = document.getElementById("machineDropdown"); //this is the global variable with problem..... var workRegionCode; //INIT window.onload = function() { getWorkRegions(); // alert("before: " + window.workRegionCode); getMachines(); // alert("after: " + window.workRegionCode); } function addWorkRegionToDropdown(jsonObject, dropdown) { for(var i=0, j=jsonObject.length; i<j; i++) { var option = document.createElement("option"); option.text = jsonObject[i].?????? + ":" + jsonObject[i].??????; option.value = jsonObject[i].??????; dropdown.options.add(option); } } function addMachineToDropdown(jsonObject, dropdown) { for(var i=0, j=jsonObject.length; i<j; i++) { var option = document.createElement("option"); option.text = jsonObject[i].???; option.value = jsonObject[i].???; dropdown.options.add(option); } } function getMachines() { //!!!!!!!!!!! workRegionCode is undefined.. why?!?!?! alert("inside of getMachines() ==> " + window.workRegionCode); var ajaxRequest = new XMLHttpRequest(); ajaxTimeout = setTimeout(function() {timeoutAjax(ajaxRequest, "showMessage")}, "5000"); ajaxRequest.onreadystatechange = function() { if(ajaxRequest.readyState == 4 ) { clearTimeout(ajaxTimeout); switch ( ajaxRequest.status ) { case 200: var jsonOut = JSON.parse(ajaxRequest.responseText); addMachineToDropdown(jsonOut.??, machineDropdown); break; default: document.getElementById("showMessage").innerHTML = ajaxRequest.responseText; } } } var aMonthAgo = new Date(); with(aMonthAgo) { setMonth(getMonth() - 1) } aMonthAgo = aMonthAgo.getYYYYMMDD(); var ??? = "29991231"; var url = "../resources/machine/list/" + window.workRegionCode + "/" + aMonthAgo + "/" + ???; ajaxRequest.open("GET", url, true); ajaxRequest.send(null) } function getWorkRegions() { var ajaxRequest = new XMLHttpRequest(); ajaxTimeout = setTimeout(function() {timeoutAjax(ajaxRequest, "showMessage")}, "5000"); ajaxRequest.onreadystatechange = function() { if(ajaxRequest.readyState == 4 ) { clearTimeout(ajaxTimeout); switch ( ajaxRequest.status ) { case 200: var jsonOut = JSON.parse(ajaxRequest.responseText); //set global variable workRegionCode setFirstIndexWorkRegionCode(jsonOut); addWorkRegionToDropdown(jsonOut.???, workRegionDropdown); default: document.getElementById("showMessage").innerHTML = ajaxRequest.responseText; } } } var url = "../resources/workshop/list"; ajaxRequest.open("GET", url, true); ajaxRequest.send(null) }//end getWorkRegions() function setFirstIndexWorkRegionCode(jsonString) { //here I set the value to work region code! window.workRegionCode = jsonString.???[0].??????; alert("??????: " + window.workRegionCode); }

  Read the article

• Need help choosing database server

  - by The Pretender

  Good day everyone. Recently I was given a task to develop an application to automate some aspects of stocks trading. While working on initial architecture, the database dilemma emerged. What I need is a fast database engine which can process huge amounts of data coming in very fast. I'm fairly experienced in general programming, but I never faced a task of developing a high-load database architecture. I developed a simple MSSQL database schema with several many-to-many relationships during one of my projects, but that's it. What I'm looking for is some advice on choosing the most suitable database engine and some pointers to various manuals or books which describe high-load database development. Specifics of the project are as follows: OS: Windows NT family (Server 2008 / 7) Primary platform: .NET with C# Database structure: one table to hold primary items and two or three tables with foreign keys to the first table to hold additional information. Database SELECT requirements: Need super-fast selection by foreign keys and by combination of foreign key and one of the columns (presumably DATETIME) Database INSERT requirements: The faster the better :) If there'll be significant performance gain, some parts can be written in C++ with managed interfaces to the rest of the system. So once again: given all that stuff I just typed, please give me some advice on what the best database for my project is. Links or references to some manuals and books on the subject are also greatly appreciated. EDIT: I'll need to insert 3-5 rows in 2 tables approximately once in 30-50 milliseconds and I'll need to do SELECT with 0-2 WHERE clauses queries with similar rate.

  Read the article

• I need help converting a C# string from one character encoding to another?

  - by Handleman

  According to Spolsky I can't call myself a developer, so there is a lot of shame behind this question... Scenario: From a C# application, I would like to take a string value from a SQL db and use it as the name of a directory. I have a secure (SSL) FTP server on which I want to set the current directory using the string value from the DB. Problem: Everything is working fine until I hit a string value with a "special" character - I seem unable to encode the directory name correctly to satisfy the FTP server. The code example below uses "special" character é as an example uses WinSCP as an external application for the ftps comms does not show all the code required to setup the Process "_winscp". sends commands to the WinSCP exe by writing to the process standardinput for simplicity, does not get the info from the DB, but instead simply declares a string (but I did do a .Equals to confirm that the value from the DB is the same as the declared string) makes three attempts to set the current directory on the FTP server using different string encodings - all of which fail makes an attempt to set the directory using a string that was created from a hand-crafted byte array - which works Process _winscp = new Process(); byte[] buffer; string nameFromString = "Sinéad O'Connor"; _winscp.StandardInput.WriteLine("cd \"" + nameFromString + "\""); buffer = Encoding.UTF8.GetBytes(nameFromString); _winscp.StandardInput.WriteLine("cd \"" + Encoding.UTF8.GetString(buffer) + "\""); buffer = Encoding.ASCII.GetBytes(nameFromString); _winscp.StandardInput.WriteLine("cd \"" + Encoding.ASCII.GetString(buffer) + "\""); byte[] nameFromBytes = new byte[] { 83, 105, 110, 130, 97, 100, 32, 79, 39, 67, 111, 110, 110, 111, 114 }; _winscp.StandardInput.WriteLine("cd \"" + Encoding.Default.GetString(nameFromBytes) + "\""); The UTF8 encoding changes é to 101 (decimal) but the FTP server doesn't like it. The ASCII encoding changes é to 63 (decimal) but the FTP server doesn't like it. When I represent é as value 130 (decimal) the FTP server is happy, except I can't find a method that will do this for me (I had to manually contruct the string from explicit bytes). Anyone know what I should do to my string to encode the é as 130 and make the FTP server happy and finally elevate me to level 1 developer by explaining the only single thing a developer should understand?

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• Jquery can't get form data in opera

  - by Rick de Graaf

  I can't understand why in Opera and IE the following code does not work... $("#form_" + $(this).attr('id')).serialize(); I checked it by only getting the attribute; worked I checked if I could get the form data without serialize; worked How should I code this? Tried a lot of combinations and stuff but nothing works.. why does this isn't working in opera? In chrome I have no problems... To answer some of the questions below I have multiple forms on my page, each with an unique id (from_1, form_5 etc.) I checked this and is correct. The form data needs to be fetched when a select changes, so data call is fired by an change event.

  Read the article

• My HTML5 web app crashes and I have no clue how to debug

  - by Shouvik

  Hi All, I have written a word game using HTML5 canvas tag and a little bit of audio. I developed the application on the chrome web browser on a linux system. Recently during the testing phase it was tried on safari 5.0.3 on Mac and the webpage froze. Not just the canvas element, but interactive element on the page froze. I have at some times experienced this problem on google chrome when I was developing but since the console did not throw any error before this happened, I did not give it much credence. Now as per requirements I am supposed to support both chrome and safari but this dismal performance on safari has left me shocked and I cannot see what error can be thrown which might lead to such a situation. Worse yet the CPU usage on using this application peaks to 70-80percent on my 2yr old macbook running ubuntu... I can only but pity the person who uses mac to operate this app, which undoubtedly is a heavier OS. Could someone help me out with a place I can start with to find out what exactly is causing this issue. I have run profiles on this webapp on google chromes console and noticed that in the heap spanshot value increases steadily with the playing of the game, specifically (root) value which jumps up by 900 counts. Any help would be very appreciated! Thanks EDIT: I don't know if this helps, but I have noticed that even on refreshing the page after the app becomes unresponsive the page reloads and I am still not able to interact with the page elements but the tab scroll bar continues to work and I can see my application window completely. So to summaries the tab stops accepting any sort of user interaction inside the page. Edit2: Nop. It doesn't work still... The app crashes on double click on the canvas element. The console is not throwing any errors either! =/ I have noticed this problem is isolated only to safari!

  Read the article

• Setting an ASIHTTPRequest post to a SimpleHTTPServer Python server?

  - by Rob

  I am working on a project (that i will not be releasing to the app store - just for fun) that will upload an image via an HTTP Post request from my iPhone to a server that I have running the Python script SimpleHTTPServer. I have successfully used the ASIHTTP APIs in the past for text strings, but can't for the life of me figure out how to upload an image. I have tried all of the following: NSString *path = [[NSBundle mainBundle] pathForResource:@"Image" ofType:@".png"]; [request setFile:@"Image.png" forKey:@"file"]; [request setFile:path forKey:@"file"]; [request setFile:path withFileName:@"Image.png" andContentType:@"image/jpeg" forKey:@"file"]; [request setData:[UIImage imageNamed:@"Image.png"] withFileName:@"Image.png" andContentType:@"Image" forKey:@"file"]; Any thoughts on where i could be going wrong?

  Read the article

• jQuery draggable removing without changing position of other elements

  - by Yurish

  Hi! I am building a page layout configuration system on jQuery. So everyone, who is using my website can make it personal by moving elements on webpage. But, I have a problem. Every element on my page is a draggable div with option to be removed from page if necessary. When user wants to remove an element, he clicks on inner div and the following function is called: <script language="javascript"> $(function() { $('.close').click(function(){ $(this).parent().hide(); }); }); </script> <div class="main"><div class="close"></div></div> When user wants to add an element on page, he clicks on link and followinf function is called: function addNewWidget(page_name, size){ var page = $('#'+page_name); var closeDiv = $(document.createElement("div")).attr("class", "close").html('X'); closeDiv.click(function(){ $(this).parent().hide(); }); var div = $(document.createElement("div")) div.attr("class", "drag"); div.appendTo(page); closeDiv.appendTo(div); div.draggable({ containment: "#page", scroll: false, grid: [200, 200] }); div.css("top:0; left:0"); div.addClass(size); div.addClass('widget'); } Everything works fine, but when element is removed, other elements, which were on page are moving up. It is because of element positioning in the code. These divs in the code are before div, which was removed, and their absolute top is changed by -heghtOfRemovedElement Is there any way to prevent other elements from moving up?

  Read the article

• HttpWebRequest and Ignoring SSL Certificate Errors

  - by Rick Strahl

  Man I can't believe this. I'm still mucking around with OFX servers and it drives me absolutely crazy how some these servers are just so unbelievably misconfigured. I've recently hit three different 3 major brokerages which fail HTTP validation with bad or corrupt certificates at least according to the .NET WebRequest class. What's somewhat odd here though is that WinInet seems to find no issue with these servers - it's only .NET's Http client that's ultra finicky. So the question then becomes how do you tell HttpWebRequest to ignore certificate errors? In WinInet there used to be a host of flags to do this, but it's not quite so easy with WebRequest. Basically you need to configure the CertificatePolicy on the ServicePointManager by creating a custom policy. Not exactly trivial. Here's the code to hook it up: public bool CreateWebRequestObject(string Url) {    try     {        this.WebRequest =  (HttpWebRequest) System.Net.WebRequest.Create(Url);         if (this.IgnoreCertificateErrors)            ServicePointManager.CertificatePolicy = delegate { return true; };}One thing to watch out for is that this an application global setting. There's one global ServicePointManager and once you set this value any subsequent requests will inherit this policy as well, which may or may not be what you want. So it's probably a good idea to set the policy when the app starts and leave it be - otherwise you may run into odd behavior in some situations especially in multi-thread situations.Another way to deal with this is in you application .config file. Normal 0 false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} <configuration>   <system.net>     <settings>       <servicePointManager           checkCertificateName="false"           checkCertificateRevocationList="false"                />     </settings>   </system.net> </configuration> This seems to work most of the time, although I've seen some situations where it doesn't, but where the code implementation works which is frustrating. The .config settings aren't as inclusive as the programmatic code that can ignore any and all cert errors - shrug. Anyway, the code approach got me past the stopper issue. It still amazes me that theses OFX servers even require this. After all this is financial data we're talking about here. The last thing I want to do is disable extra checks on the certificates. Well I guess I shouldn't be surprised - these are the same companies that apparently don't believe in XML enough to generate valid XML (or even valid SGML for that matter)...© Rick Strahl, West Wind Technologies, 2005-2011Posted in .NET  CSharp  HTTP  

  Read the article

• The Enterprise Architect (EA) diary - day 22 (from business processes to implemented applications)

  - by nattYGUR

  After spending time on keeping our repository up to date (add new ETRM application and related data flows as well as changing databases to DB clusters), collecting more data for the root cause analysis and spending time for writing proposal to creating new software infrastructure team ( that will help us to clean the table from a pile of problems that just keep on growing due to BAU control over IT dev team resources). I spend time to adapt our EA tool to support a diagram flow from high level business processes to implementation of new applications that will better support the business process. http://www.theeagroup.net/ea/Default.aspx?tabid=1&newsType=ArticleView&articleId=195

  Read the article

• Benefits of PerformancePoint Services Using SharePoint Server 2010

  - by Wayne

  What is PerformancePoint Services? Most of the time it happens that the metrics that make up your key performance indicators are not simple values from a data source. In SharePoint Server 2007 PerformancePoint Services, you could create two kinds of KPI metrics: Simple single value metrics from any supported data source or Complex multiple value metrics from a single Analysis Services data source using MDX. Now things are even easier with Performance Point Services in SharePoint 2010. Let us check what is it? PerformancePoint Services in SharePoint Server 2010 is a performance management service that you can use to monitor and analyze your business. By providing flexible, easy-to-use tools for building dashboards, scorecards, reports, and key performance indicators (KPIs), PerformancePoint Services can help everyone across an organization make informed business decisions that align with companywide objectives and strategy. Scorecards, dashboards, and KPIs help drive accountability. Integrated analytics help employees move quickly from monitoring information to analyzing it and, when appropriate, sharing it throughout the organization. Prior to the addition of PerformancePoint Services to SharePoint Server, Microsoft Office PerformancePoint Server 2007 functioned as a standalone server. Now PerformancePoint functionality is available as an integrated part of the SharePoint Server Enterprise license, as is the case with Excel Services in Microsoft SharePoint Server 2010. The popular features of earlier versions of PerformancePoint Services are preserved along with numerous enhancements and additional functionality. New PerformancePoint Services features PerformancePoint Services now can utilize SharePoint Server scalability, collaboration, backup and recovery, and disaster recovery capabilities. Dashboards and dashboard items are stored and secured within SharePoint lists and libraries, providing you with a single security and repository framework. New features and enhancements of SharePoint 2010 PerformancePoint Services • With PerformancePoint Services, functioning as a service in SharePoint Server, dashboards and dashboard items are stored and secured within SharePoint lists and libraries, providing you with a single security and repository framework. The new architecture also takes advantage of SharePoint Server scalability, collaboration, backup and recovery, and disaster recovery capabilities. You also can include and link PerformancePoint Services Web Parts with other SharePoint Server Web Parts on the same page. The new architecture also streamlines security models that simplify access to report data. • The Decomposition Tree is a new visualization report type available in PerformancePoint Services. You can use it to quickly and visually break down higher-level data values from a multi-dimensional data set to understand the driving forces behind those values. The Decomposition Tree is available in scorecards and analytic reports and ultimately in dashboards. • You can access more detailed business information with improved scorecards. Scorecards have been enhanced to make it easy for you to drill down and quickly access more detailed information. PerformancePoint scorecards also offer more flexible layout options, dynamic hierarchies, and calculated KPI features. Using this enhanced functionality, you can now create custom metrics that use multiple data sources. You can also sort, filter, and view variances between actual and target values to help you identify concerns or risks. • Better Time Intelligence filtering capabilities that you can use to create and use dynamic time filters that are always up to date. Other improved filters improve the ability for dashboard users to quickly focus in on information that is most relevant. • Ability to include and link PerformancePoint Services Web Parts together with other PerformancePoint Services Web parts on the same page. • Easier to author and publish dashboard items by using Dashboard Designer. • SQL Server Analysis Services 2008 support. • Increased support for accessibility compliance in individual reports and scorecards. • The KPI Details report is a new report type that displays contextually relevant information about KPIs, metrics, rows, columns, and cells within a scorecard. The KPI Details report works as a Web part that links to a scorecard or individual KPI to show relevant metadata to the end user in SharePoint Server. This Web part can be added to PerformancePoint dashboards or any SharePoint Server page. • Create analytics reports to better understand underlying business forces behind the results. Analytic reports have been enhanced to support value filtering, new chart types, and server-based conditional formatting. To conclude, PerformancePoint Services, by becoming tightly integrated with SharePoint Server 2010, takes advantage of many enterprise-level SharePoint Server 2010 features. Unfortunately, SharePoint Foundation 2010 doesn’t include this feature. There are still many choices in SharePoint family of products that include SharePoint Server 2010, SharePoint Foundation, SharePoint Server 2007 and associated free SharePoint web parts and templates.

  Read the article

• West Palm Beach .Net User Group with Chris Eargle - February 22nd, 2011

  - by Sam Abraham

  Chris Eargle, Telerik Evangelist, Microsoft MVP and INETA Speaker, was our guest speaker at the West Palm Beach .Net User Group February 2011 meeting.   Chris shared many advanced C#  tricks that he learned throughout his many years of programming in a talk earning raving reviews from all attendees.   At the end of our event, we had a free raffle of 2 Telerik Ultimate Collection licenses and various .Net Ninja shirts.   We would like to thank Chris for sharing with us and we look forward to having him again at our group at his earliest convenience.   Below are some pictures of the event:

  Read the article

• Quick Script for Adding Skype Groups

  - by Robert May

  So, I needed to add about 30 people to several different Skype groups today, and I didn’t want to repeat the /add [skypename] thing over and over and over.  Building the list was a pain . . . I couldn’t find a good way to extract all of the users in an existing group.  There’s probably an api or something, but I just did that part by hand. Adding them to the groups was pretty easy with Windows Scripting Host.  Basically, I just ran this: <package>    <job id="vbs">       <script language="VBScript">          set WshShell = WScript.CreateObject("WScript.Shell")          WshShell.AppActivate 4484          WScript.Sleep 100          WshShell.SendKeys "/add user1~"          WScript.Sleep 100 …          WshShell.SendKeys "/add usern~"          WScript.Sleep 100       </script>    </job> </package> Add as many users as you need by copying the sendkeys and sleep lines.  Then, save the script to a .wsf file.  The AppActivate line needs to be changed to have the process id of skype instead of the number there.  To get that, open up Task Manager, click on Processes, then find skype.exe and find it’s PID. Before you double click on the file in windows explorer, you’ll need to have created the groups in skype.  For each group, open the group, and click in the chat window of the group.  Then double click on the WSF file.  If you don’t click in the chat window, you will likely get the add user dialog box instead of just adding the users. Technorati Tags: Skype,Script

  Read the article

• Adobe Photoshop Vs Lightroom Vs Aperture

  - by Aditi

  Adobe Photoshop is the standard choice for photographers, graphic artists and Web designers. Adobe Photoshop Lightroom  & Apple’s Aperture are also in the same league but the usage is vastly different. Although Photoshop is most popular & widely used by photographers, but in many ways it’s less relevant to photographers than ever before. As Lightroom & Aperture is aimed squarely at photographers for photo-processing. With this write up we are going to help you choose what is right for you and why. Adobe Photoshop Adobe Photoshop is the most liked tool for the detailed photo editing & designing work. Photoshop provides great features for rollover and Image slicing. Adobe Photoshop includes comprehensive optimization features for producing the highest quality Web graphics with the smallest possible file sizes. You can also create startling animations with it. Designers & Editors know how important precise masking is, PhotoShop lets you do that with various detailing tools. Art history brush, contact sheets, and history palette are some of the smart features, which add to its viability. Download Whether you’re producing printed pages or moving images, you can work more efficiently and produce better results because of its smooth integration across other adobe applications. Buy supporting layer effects, it allows you to quickly add drop shadows, inner and outer glows, bevels, and embossing to layers. It also provides Seamless Web Graphics Workflow. Photoshop is hands-down the BEST for editing. Photoshop Cons: • Slower, less precise editing features in Bridge • Processing lots of images requires actions and can be slower than exporting images from Lightroom • Much slower with editing and processing a large number of images Aperture Apple Aperture is aimed at the professional photographer who shoots predominantly raw files. It helps them to manage their workflow and perform their initial Raw conversion in a better way. Aperture provides adjustment tools such as Histogram to modify color and white balance, but most of the editing of photos is left for Photoshop. It gives users the option of seeing their photographs laid out like slides or negatives on a light table. It boasts of – stars, color-coding and easy techniques for filtering and picking images. Aperture has moved forward few steps than Photoshop, but most of the editing work has been left for Photoshop as it features seamless Photoshop integration. Aperture Pros: Aperture is a step up from the iPhoto software that comes with every Mac, and fairly easy to learn. Adjustments are made in a logical order from top to bottom of the menu. You can store the images in a library or any folder you choose. Aperture also works really well with direct Canon files. It is just $79 if you buy it through Apple’s App Store Moving forward, it will run on the iPad, and possibly the iPhone – Adobe products like Lightroom and Photoshop may never offer these options It is much nicer and simpler user interface. Lightroom Lightroom does a smashing job of basic fixing and editing. It is more advanced tool for photographers. They can use it to have a startling photography effect. Light room has many advanced features, which makes it one of the best tools for photographers and far ahead of the other two. They are Nondestructive editing. Nothing is actually changed in an image until the photo is exported. Better controls over organizing your photos. Lightroom helps to gather a group of photos to use in a slideshow. Lightroom has larger Compare and Survey views of images. Quickly customizable interface. Simple keystrokes allow you to perform different All Lightroom controls are kept available in panels right next to the photos. Always-available History palette, it doesn’t go when you close lightroom. You gain more colors to work with compared to Photoshop and with more precise control. Local control, or adjusting small parts of a photo without affecting anything else, has long been an important part of photography. In Lightroom 2, you can darken, lighten, and affect color and change sharpness and other aspects of specific areas in the photo simply by brushing your cursor across the areas. Photoshop has far more power in its Cloning and Healing Brush tools than Lightroom, but Lightroom offers simple cloning and healing that’s nondestructive. Lightroom supports the RAW formats of more cameras than Aperture. Lightroom provides the option of storing images outside the application in the file system. It costs less than photoshop. Download Why PhotoShop is advanced than Lightroom? There are countless image processing plug-ins on the market for doing specialized processing in Photoshop. For example, if your image needs sophisticated noise reduction, you can use the Noiseware plug-in with Photoshop to do a much better job or noise removal than Lightroom can do. Lightroom’s advantages over Aperture 3 Will always have better integration with Photoshop. Lightroom is backed by bigger and more active user community (So abundant availability for tutorials, etc.) Better noise reduction tool. Especially for photographers the Lens-distortion correction tool  is perfect Lightroom Cons: • Have to Import images to work on them • Slows down with over 10,000 images in the catalog • For processing just one or two images this is a slower workflow Photoshop Pros: • ACR has the same RAW processing controls as Lightroom • ACR Histogram is specialized to the chosen color space (Lightroom is locked into ProPhoto RGB color space with an sRGB tone curve) • Don’t have to Import images to open in Bridge or ACR • Ability to customize processing of RAW images with Photoshop Actions Pricing and Availability Get LightRoomGet PhotoShop Latest version Of Photoshop can be purchased from Adobe store and Adobe authorized reseller and it costs US$999. Latest version of Aperture can be bought for US$199 from Apple Online store or Mac App Store. You can buy latest version of LightRoom from Adobe Store or Adobe Authorized reseller for US$299. Related posts:Adobe Photoshop CS5 vs Photoshop CS5 extended Web based Alternatives to Photoshop 10 Free Alternatives for Adobe Photoshop Software

  Read the article

• Other processes take over port 80 when restarting Apache - why, and how to solve?

  - by user72149

  I have a CentOS 5.5 server running Apache on port 80 as well as some other applications. All works fine until I for some reason need to restart the httpd process. Doing so returns: sudo /etc/init.d/httpd restart Stopping httpd: [ OK ] Starting httpd: (98)Address already in use: make_sock: could not bind to address [::]:80 (98)Address already in use: make_sock: could not bind to address 0.0.0.0:80 no listening sockets available, shutting down Unable to open logs First I thought perhaps httpd had frozen and was still running, but that was not the case. So I ran netstat to find out what was using port 80: sudo netstat -tlp Active Internet connections (only servers) Proto Recv-Q Send-Q Local Address Foreign Address State PID/Program name tcp 0 0 *:7203 *:* LISTEN 24012/java tcp 0 0 localhost.localdomain:smux *:* LISTEN 3547/snmpd tcp 0 0 *:mysql *:* LISTEN 21966/mysqld tcp 0 0 *:ssh *:* LISTEN 3562/sshd tcp 0 0 *:http *:* LISTEN 3780/python26 Turns out that my python process had taken over listening to http in the instant that httpd was restarting. So, I killed python and tried starting httpd again - but ran into the same error. Netstat again: sudo netstat -tlp Active Internet connections (only servers) Proto Recv-Q Send-Q Local Address Foreign Address State PID/Program name tcp 0 0 *:7203 *:* LISTEN 24012/java tcp 0 0 localhost.localdomain:smux *:* LISTEN 3547/snmpd tcp 0 0 *:mysql *:* LISTEN 21966/mysqld tcp 0 0 *:ssh *:* LISTEN 3562/sshd tcp 0 0 *:http *:* LISTEN 24012/java Now my java process had taken over listening to http. I killed that too and could then successfully restart httpd. But this is a terrible workaround. Why will these python and java processes start listening to port 80 as soon as httpd is restarted? How to solve? Two other comments. 1) Both java and python processes are started by apache from a php script. But when apache is restarted, they should not be affected. And 2) I have the same setup on two other machines running Ubuntu and there's no problem there. Any ideas? Edit: The Java process listens to port 7203 and the python process supposedly doesn't listen to any port. For some reason, they start listening to port 80 when apache is restarted. This hasn't happened before. On Ubuntu it runs fine. For some reason, on my current CentOS 5.5 machine, this problem arises.

  Read the article

• Encyrpting a Macbook with Truecrypt (Snow Leopard + Bootcamp)

  - by user69486

  I have a Macbook Pro with Snow Leopard and Windows 7 Pro (Bootcamp). I have encyrpted all the company computers with truecrypt and now its the Macbooks turn. Will Truecrypt only encrypt the Win 7 partition and will it disable Bootcamp, or would it install after Bootcamp, whereby after I select either the OS X or Windows partition under Bootcamp, the Truecrypt encryption for Win 7 would be activated? Thanks in advance. Byron

  Read the article

• Unable to connect to local SQL Express (2008)

  - by Will

  I'm trying to get an installation of SQL Express 2008 working, but no matter what I do I can't connect to it with management studio. I've enabled TCP/IP for the instance. I've tried connecting with machinename\instance, .\instance, (local), etc etc etc. Nothing works, and I always get the same message. If I browse for a server, the only server listed is the local integration services, which I can connect to just fine. The SQL server service is running (SQLEXPRESS), SQL Server Agent is not (and won't, can't enable it), and SQL Server Browser is. Anyone have any suggestions on where to go next? I've tried uninstalling EVERYTHING sql and reinstalling, no change.

  Read the article

• Daisy-chaining network switches with multiple cables

  - by user72153

  This might just be the dumbest question you'll ever read, but I digress. Say I have two 100Mbps Ethernet switches with 2 computers on each, connected together by a single cable. This way, the two PCs on each switch share the 100Mbps bandwidth with the others. If I added another cable between the 2 switches, would there be 200Mbps throughput available between the switches? Or am I completely off my rocker? Thanks for the help.

  Read the article

• Is it possible to disable ARP in Windows 7

  - by DriverGuy

  I have a unique requirement where I need to disable ARP on a Windows 7 box. In previous Windows versions you could modify the ArpRetryCount in the registry (and set it to 0), but this does not work in 7 (nor does it exist). Does anybody know how, or if this is possible? I've been asked to elaborate this more and I'm not quite sure how. I want to switch off ARP (including gratuitous arp) on Windows 7 for a project I'm working on. You can do this in Linux by simply adding '-arp' when you bring up an interface, but you cannot do this in Windows 7. You could in previous versions by modifying the registry, but this does not work any more. If the fine folk here aren't sure then I don't like my chances...

  Read the article

< Previous Page | 269 270 271 272 273 274 275 276 277 278 279 280  | Next Page >