Search Results

Search found 5991 results on 240 pages for 'iwork numbers'.

Page 10/240 | < Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >

  • Find numbers that equals a sum in an array

    - by valli-R
    I want to find the first set of integers in an array X that the sum equals a given number N. For example: X = {5, 13, 24, 9, 3, 3} N = 28 Solution = {13, 9, 3, 3} Here what I have so far : WARNING, I know it uses global and it is bad,that's not the point of the question. <?php function s($index = 0, $total = 0, $solution = '') { global $numbers; global $sum; echo $index; if($total == 28) { echo '<br/>'.$solution.' = '.$sum.'<br/>'; } elseif($index < count($numbers) && $total != 28) { s($index + 1, $total, $solution); s($index + 1, $total + $numbers[$index], $solution.' '.$numbers[$index]); } } $numbers = array(5, 13, 24, 9, 3, 3); $sum = 28; s(); ?> I don't get how I can stop the process when it finds the solution.. I know I am not far from good solution.. Thanks in advance

    Read the article

  • Haskell. Numbers in binary numbers. words

    - by Katja
    Hi! I need to code words into binary numbers. IN: "BCD..." OUT:1011... I have written already funktion for coding characters into siple numbers IN: 'C' OUT: 3 IN: 'c' OUT: 3 lett2num :: Char -> Int lett2num x | (ord 'A' <= ord x) && (ord x <= ord 'Z') = (ord x - ord 'A') + 1 | (ord 'a' <= ord x) && (ord x <= ord 'z') = (ord x - ord 'a') +1 num2lett :: Int -> Char num2lett n | (n <= ord 'A') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) | (n <= ord 'a') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) I wrote as well function for codind simple numbers into binary. num2bin :: Int->[Int] num2bin 0 = [] num2bin n | n>=0 = n `mod` 2 : (num2bin( n `div` 2)) | otherwise = error but I donw want those binary numbers to be in a list how can I get rid of the lists? Thanks

    Read the article

  • Extract string that is delimited with constant and ends with two numbers (numbers have to be included)

    - by Edmon
    I have a text that contains string of a following structure: text I do not care about, persons name followed by two IDs. I know that: a person's name is always preceded by XYZ code and that is always followed by two, space separated numbers. Name is not always just a last name and first name. It can be multiple last or first names (think Latin american names). So, I am looking to extract string that follows the constant XYZ code and that is always terminated by two separate numbers. You can say that my delimiter is XYZ and two numbers, but numbers need to be part of the extracted value as well. From blah, blah XYZ names, names 122322 344322 blah blah I want to extract: names, names 122322 344322 Would someone please advise on the regular expression for this that would work with Python's re package.

    Read the article

  • Best way to associate phone numbers with names

    - by Horace Loeb
    My application stores lots of its users friends' phone numbers. I'd like to allow users to associate names with these phone numbers, but I don't want to make users manually type in names (obviously). I'm curious what the best overall approach is here, as well as the best way to implement it Overall approach-wise, I imagine using Gmail / Yahoo / Windows Live contacts is best (the Facebook API doesn't let you access phone numbers), though the gems I've found for interacting with these contacts APIs (this and this) only give you access to the names and email addresses of each contact.

    Read the article

  • Unable to Export contents of Data table (with French formatted Numbers ) to XML

    - by Ananth
    I have a data Table with numbers formatted according to the current regional settings. ie ( in French decimal separators are ',' instead of '.' in English). I need to export it to XML. Numbers in XML needs to be formatted according to the current regional settings.But now numbers in XML are formatted in English.Is there any way to make the number formatting in XML according to current regional settings ( or based on the locale of the Data Table) during the exporting process ?

    Read the article

  • Convert String containing several numbers into integers

    - by GobiasKoffi
    I realize that this question may have been asked several times in the past, but I am going to continue regardless. I have a program that is going to get a string of numbers from keyboard input. The numbers will always be in the form "66 33 9" Essentially, every number is separated with a space, and the user input will always contain a different amount of numbers. I'm aware that using 'sscanf' would work if the amount of numbers in every user-entered string was constant, but this is not the case for me. Also, because I'm new to C++, I'd prefer dealing with 'string' variables rather than arrays of chars.

    Read the article

  • How computer multiplies 2 numbers?

    - by ckv
    How does a computer perform a multiplication on 2 numbers say 100 * 55. My guess was that the computer did repeated addition to achieve multiplication. Of course this could be the case for integer numbers. However for floating point numbers there must be some other logic. Note: This was asked in an interview.

    Read the article

  • Scaling range of values with negative numbers

    - by Pradeep Kumar
    How can I scale a set of values to fit a new range if they include negative numbers? For example, I have a set of numbers (-10, -9, 1, 4, 10) which have to scaled to a range [0 1], such that -10 maps to 0, and 10 maps to 1. The regular method for an arbitrary number 'x' would be: (x - from_min) * (to_max - to_min) / (from_max - from_min) + to_min but this does not work for negative numbers. Any help is appreciated. Thanks!!

    Read the article

  • Sorting a list of numbers with modified cost

    - by David
    First, this was one of the four problems we had to solve in a project last year and I couldn’t find a suitable algorithm so we handle in a brute force solution. Problem: The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. We need to design an algorithm that given a list of numbers, determine the optimal (in terms of cost) sequence of moves to rearrange the sequence. Attempts: Part of our investigation was around NP-Completeness, we make it a decision problem and try to find a suitable transformation to any of the problems listed in Garey and Johnson’s book: Computers and Intractability with no results. There is also no direct reference (from our point of view) to this kind of variation in Donald E. Knuth’s book: The art of Computer Programing Vol. 3 Sorting and Searching. We also analyzed algorithms to sort linked lists but none of them gives a good idea to find de optimal sequence of movements. Note that the idea is not to find an algorithm that orders the sequence, but one to tell me the optimal sequence of movements in terms of cost that organizes the sequence, you can make a copy and sort it to analyze the final position of the elements if you want, in fact we may assume that the list contains the numbers from 1 to n, so we know where we want to put each number, we are just concerned with minimizing the total cost of the steps. We tested several greedy approaches but all of them failed, divide and conquer sorting algorithms can’t be used because they swap with no cost portions of the list and our dynamic programing approaches had to consider many cases. The brute force recursive algorithm takes all the possible combinations of movements from i to j and then again all the possible moments of the rest of the element’s, at the end it returns the sequence with less total cost that sorted the list, as you can imagine the cost of this algorithm is brutal and makes it impracticable for more than 8 elements. Our observations: n movements is not necessarily cheaper than n+1 movements (unlike swaps in arrays that are O(1)). There are basically two ways of moving one element from position i to j: one is to move it directly and the other is to move other elements around i in a way that it reaches the position j. At most you make n-1 movements (the untouched element reaches its position alone). If it is the optimal sequence of movements then you didn’t move the same element twice.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Create numbers within an array that add up to a set amount

    - by RussellDias
    I'm fairly new to PHP - programming in general. So basically what I need to accomplish is, create an array of x amount of numbers (created randomly) who's value add up to n: Lets say, I have to create 4 numbers that add up to 30. I just need the first random dataset. The 4 and 30 here are variables which will be set by the user. Essentially something like x = amount of numbers; n = sum of all x's combined; create x random numbers which all add up to n; $row = array(5, 7, 10, 8) // these add up to 30 Also, no duplicates are allowed. I need the values with an array. I have been messing around with it sometime, however, my knowledge is fairly limited. Any help will be greatly appreciated. Cheers

    Read the article

  • Help constructing query - Compare columns and replace numbers

    - by Tommy
    I have a feeling that this query is pretty easy to construct, I just can't figure it out. I want to replace all numbers in table X column C, with numbers in table Z column A, where numbers from table X column C matches numbers in table Z column B. I hope that makes sense. Perhaps a little background information will make it clearer. I've converted from one CMS to another, and the module I used to convert mapped the ids to the new database. Table X column A is the new id's. Table X column B is the old id's. Table Z is the table for an image gallery that I migrated, and column C contains the id's of the images owners. Can anyone crack this nut?

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • Asterisk - Trying to use call files to create a conference call between two dynamic numbers

    - by Hank
    I'm trying to setup an Asterisk system that will allow me to create a conference call between two dynamic numbers. It seems I can use 'call files' to make Asterisk initiate the call without needing an incoming call - http://www.voip-info.org/tiki-index.php?page=Asterisk+auto-dial+out This example seems to be what I'd need: Channel: SIP/mytrunk/12345678 MaxRetries: 2 RetryTime: 60 WaitTime: 30 Context: callme Extension: 800 Priority: 2 I can generate this file with some scripting language and then place it into the Asterisk Call File folder. The problem I'm having is: How do I call out to two numbers and join them in a conference call? The MeetMe plugin/extension seems to be what I need in terms of conference calling, I'm just unsure as to how I'd use the two together and join them. Also, is it possible to have multiple 2-person conference calls at the same time? Is setting this up as simple as setting aside X amount of 'channels' in the meetme.conf?

    Read the article

  • Asterisk - Trying to use call files to create a conference call between two dynamic numbers

    - by Hank
    I'm trying to setup an Asterisk system that will allow me to create a conference call between two dynamic numbers. It seems I can use 'call files' to make Asterisk initiate the call without needing an incoming call - http://www.voip-info.org/tiki-index.php?page=Asterisk+auto-dial+out This example seems to be what I'd need: Channel: SIP/mytrunk/12345678 MaxRetries: 2 RetryTime: 60 WaitTime: 30 Context: callme Extension: 800 Priority: 2 I can generate this file with some scripting language and then place it into the Asterisk Call File folder. The problem I'm having is: How do I call out to two numbers and join them in a conference call? The MeetMe plugin/extension seems to be what I need in terms of conference calling, I'm just unsure as to how I'd use the two together and join them. Also, is it possible to have multiple 2-person conference calls at the same time? Is setting this up as simple as setting aside X amount of 'channels' in the meetme.conf?

    Read the article

  • Numbering equations based on chapter numbers in MS-Word

    - by Isaac
    I am seeking for a way to number each equation based on the chapter numbers. The number should be placed at the right side of the equation and the equation should be center-aligned. Something like this: (The bounding box around 2.3 is not necessary). I found this article that do this in a tricky way. Sadly it has some problems when I use multilevel numbering for Headings. To conclude, I am looking for a way to numbers equations that: The numbering is formatted as N-M that N is chapter number and M is equation number. equation is placed in center-aligned number is placed in the right side of equation There should be a way to cross-reference each numbered equation. Thanks!

    Read the article

  • Context is Hindi when printing line numbers in Word 2007

    - by Lessan Vaezi
    I'm trying to print a Word 2007 document with Line Numbering turned on, and in Word the document looks fine but when I print the document, the line numbers appear in Hindi script. See screenshots here: http://www.lessanvaezi.com/context-is-hindi-when-printing-line-numbers-in-word-2007/ I tried deleting my Normal template and allowing Word to create a new one, and testing using that, with no change. I also tried using different printers. The problem goes away if I choose Arabic instead of Context under Word Options - Advanced - Show Document Content / Numeral. However, I would like to keep this setting as Context. The question is, why is the default context of my document Hindi script? Is there a way to change this context?

    Read the article

  • Using international phone numbers on iPhone [closed]

    - by Cawas
    Spin off question Is it possible to hack a SIM card to add a javacard application on it (to properly format international numbers)? If yes, how? Original Question In my previous phone carrier I could just dial +55 11 99883655 and it would just work. Now I moved to a new carrier and it doesn't work anymore! When I dial the same international number it keeps saying the number isn't formated correctly. How can I get my iPhone to understand international numbering back again? I've got over 100 contacts with numbers stored in this format already, and I want to keep them that way. edit: I originally asked this question here, moved it to apple stackexchange and now I'm bringing a new one (hopefuly).

    Read the article

  • Automation for filling in sets of numbers in each row

    - by Brad
    I need to populate the same number 10 times in a row, then the next number up on the next row. starting at 0, ending at 1000 for example: 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 .... 1000 1000 1000 1000 1000 and to 1000 I need to print out these numbers to cut up and put each row of numbers in each envelope to be sold for a Chinese auction at a benefit. How do I do this dynamically without entering in all of the rows by hand?

    Read the article

  • Prevent breaking of specified part of paragraph

    - by AntonAL
    For example, we have a paragraph: Quick brown fox jumps over the lazy dog How can i prevent breaking the part "the lazy" ? I means, that this string will be incorrect in my formatting: Quick brown fox jumps over the lazy dog But this one is correct: Quick brown fox jumps over the lazy dog My text is large and hitting "Shift+Enter" at some placed is ugly, because everything will crash, when text size will be changed ... Selecting the part "the lazy", right-click - "Prevent breaking" does not works Help!

    Read the article

  • How can I recover a .pages document with only an iPad?

    - by waiwai933
    I had this problem a few hours ago, and was really frustrated by it, so I'd thought I'd share: Scenario: My computer with Pages has died I have a Pages file on a flash drive that I need now I don't want to reformat the document from a plain text version I have an iPad with Pages I can't email my file to my iPad because Pages files are really folders How can I recover my file?

    Read the article

  • Reusing slot numbers in Linux software RAID arrays

    - by thkala
    When a hard disk drive in one of my Linux machines failed, I took the opportunity to migrate from RAID5 to a 6-disk software RAID6 array. At the time of the migration I did not have all 6 drives - more specifically the fourth and fifth (slots 3 and 4) drives were already in use in the originating array, so I created the RAID6 array with a couple of missing devices. I now need to add those drives in those empty slots. Using mdadm --add does result in a proper RAID6 configuration, with one glitch - the new drives are placed in new slots, which results in this /proc/mdstat snippet: ... md0 : active raid6 sde1[7] sdd1[6] sda1[0] sdf1[5] sdc1[2] sdb1[1] 25185536 blocks super 1.0 level 6, 64k chunk, algorithm 2 [6/6] [UUUUUU] ... mdadm -E verifies that the actual slot numbers in the device superblocks are correct, yet the numbers shown in /proc/mdstat are still weird. I would like to fix this glitch, both to satisfy my inner perfectionist and to avoid any potential sources of future confusion in a crisis. Is there a way to specify which slot a new device should occupy in a RAID array? UPDATE: I have verified that the slot number persists in the component device superblock. For the version 1.0 superblocks that I am using that would be the dev_number field as defined in include/linux/raid/md_p.h of the Linux kernel source. I am now considering direct modification of said field to change the slot number - I don't suppose there is some standard way to manipulate the RAID superblock?

    Read the article

< Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >