Search Results

Search found 18379 results on 736 pages for 'output buffering'.

Page 10/736 | < Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >

  • ubuntu input/output error

    - by rplevy
    I'm having a problem with Ubuntu that I'm finding hard to troubleshoot for reasons that will become clear: reboot -bash: /sbin/reboot: Input/output error dmesg -bash: /bin/dmesg: Input/output error ps -e ps: error while loading shared libraries: /lib/libproc-3.2.8.so: cannot read file data: Input/output error lsof -bash: /usr/bin/lsof: Input/output error fsck -bash: /sbin/fsck: Input/output error badblocks -bash: /sbin/badblocks: Input/output error So I can't see what is going on, and I can't remotely reboot. What can I do to get to the bottom of this? Interestingly: init 0 Segmentation fault I can cat /var/syslog but not /var/log/messages or several other important files. less and more don't work, neither do tail or head, etc.

    Read the article

  • how to get access to environment variables from output file

    - by getjoefree
    I want to get variables from a output file specific location,and input file format as below: log1.txt format: [v] Output Data <Value>DIMM_A,4096,1600,Hynix,HMT351S6CFR8C-PB,0942E041,1206,01,Hynix,,</Value> or log2.txt format: [v] Output Data <Value>DIMM_B,4096,1600,Hynix,HMT351S6CFR8C-PB,017E90AE,1205,01,Hynix,,</Value> <Value>DIMM_A,4096,1600,Hynix,HMT351S6CFR8C-PB,012E908D,1205,01,Hynix,,</Value> and we want to get output OUT.TXT file format as below: if log1.txt format and then output file format: SET DIMM1=DIMM_A,4096,1600,Hynix,HMT351S6CFR8C-PB,0942E041,1206,01,Hynix,, if log2.txt format and then output file format: SET DIMM2=DIMM_B,4096,1600,Hynix,HMT351S6CFR8C-PB,017E90AE,1205,01,Hynix,, SET DIMM1=DIMM_A,4096,1600,Hynix,HMT351S6CFR8C-PB,012E908D,1205,01,Hynix,, who could you help to me? thanks!

    Read the article

  • Adding VFACE semantic causes overlapping output semantics error

    - by user1423893
    My pixel shader input is a follows struct VertexShaderOut { float4 Position : POSITION0; float2 TextureCoordinates : TEXCOORD0; float4 PositionClone : TEXCOORD1; // Final position values must be cloned to be used in PS calculations float3 Normal : TEXCOORD2; //float3x3 TBN : TEXCOORD3; float CullFace : VFACE; // A negative value faces backwards (-1), while a positive value (+1) faces the camera (requires ps_3_0) }; I'm using ps_3_0 and I wish to utilise the VFACE semantic for correct lighting of normals depending on the cull mode. If I add the VFACE semantic then I get the following errors: error X5639: dcl usage+index: position,0 has already been specified for an output register error X4504: overlapping output semantics Why would this occur? I can't see why there would be too much data.

    Read the article

  • What is the difference between Output Text and Output Text (Active)?

    - by [email protected]
    When building an ADF Faces application in JDeveloper, you might have noticed that in the Component Palette there is an option for both "Output Text" as well as "Output Text (Active)".   Why do we have both of these options?Under the covers, there are actually two tags, af:outputText and af:activeOutputText.  Similarly, there is an active version of af:image, namely af:activeImage, and an active version of af:commandToolbarButton, af:activeCommandToolbarButton.In the vast majority of cases, developers should use the non-active version of the components.   The active version of the components are there to support specific usecases around Server Side Push using the Active Data Service feature.  Most of our customers don't use Server Side Push, and hence do not need the active version of the components.  You can learn more about Server Side Push with ADF Active Data Service in this blog.By using the active version of af:outputText, af:image or af:commandToolbarButton when you don't need to, you are taking a performance hit that is unnecessary.

    Read the article

  • OmniGraffle for iPad Now Supports VGA Output

    - by pat.shepherd
    I have (surprisingly) gotten a lot of comments over the last post about using OmniGraffle as an interactive EA tool.  The news flash/update is that it now supports VGA output.  I had sent a note to the developers and they responded that this was a highly sought after feature…well, they delivered. I have tried it informally and it works, thought there is a little lag between the drawing on the screen and the output, but it is not terrible. So buy yourself a VGA adapter and start trying it out in JAD (Joint Architecture Design) sessions. Here is a link to a couple little OG tutorials: "What's OmniGraffle for iPad", you say? Let us show you! Use the link below to see watch a guided tour of the powerful diagraming tool for the iPad. Videos - OmniGraffle for iPad - Products - The Omni Group

    Read the article

  • Analog and digital audio output at the same time

    - by wim
    My speakers use a digital input, but my headphones use an analog input. I have them both plugged in, and when I want to use the headphones I just turn off the speakers and switch on the headphones. I know that simultaneous output on digital and analog is supported by the hardware, because it worked fine in Windows XP. But on Ubuntu, I seem to only get one at a time, depending on which setting is selected in the combo box located at System -> Preferences -> Sound -> Hardware. How can I get simultaneous analog and digital output without having to switch the profile every time? I'm on Ubuntu 11.04 and it's an HDA Intel chip.

    Read the article

  • Stream sound card output to icecast2 via darkice

    - by Alberto Burgos
    I want to stream to icecast server via darkice, the default .cfg comes with /dev/dsp, witch is OSS, but there is no /dev/dsp in Ubuntu 12.10, so I tried hw:0,0, but it's just the microphone, and I would like to stream all of the sound-card output. Any ideas? cat /proc/asound/cards 0 [SB ]: HDA-Intel - HDA ATI SB HDA ATI SB at 0xf8700000 irq 16 cat /proc/asound/devices 1: : sequencer 2: [ 0- 0]: digital audio playback 3: [ 0- 0]: digital audio capture 4: [ 0- 0]: hardware dependent 5: [ 0] : control 33: : timer I tried following this post: How can I stream my soundcard output?

    Read the article

  • No HDMI output on 12.10, Intel HD graphics (Ironlake)

    - by Veazer
    I am unable to get any output to my external monitor on 12.10. The monitor is recognized and shows the native res (1920x1080, correct) but enabling has no effect. Graphics chipset is Intel Ironlake (Arrandale). I have tried: Full system update after installing Oibaf PPA updated drivers (https://launchpad.net/~oibaf/+archive/graphics-drivers) Enabling SNA Kubuntu 12.10 (in addition to Ubuntu 12.10) Both were fresh installs. Nothing works, any troubleshooting ideas? Everything is fine on 11.10. UPDATE 1: Also tried using Intel drivers from Xorg-Edgers PPA (https://launchpad.net/~xorg-edgers/+archive/ppa) Still no output on HDMI.

    Read the article

  • "find" command and piping its output through another program

    - by Charbel
    this is not an Ubuntu specific quesion, it applies to all unix/linux. how can I run a command like this: find . -maxdepth 1 -type d -print -exec svn info "{}" | grep URL \; the command above doesn't do what I want, I can't seem to pipe the output of the svn info to grep. This works, but the output contains much more than I need: find . -maxdepth 1 -type d -print -exec svn info "{}" \; Any ideas?

    Read the article

  • Audio output and input stopped working after the last update

    - by renatov
    I'm using Ubuntu 14.04 and everything was perfect until todays's update. Now my audio output (speakers) and input (microphone) stopped working. I guess it's a driver issue, but I need help to debug this problem and to solve it. I have a Dell Inspiron 5421 notebook with an Intel audio integrated sound card: $ lspci | grep Audio 00:1b.0 Audio device: Intel Corporation 7 Series/C210 Series Chipset Family High Definition Audio Controller (rev 04) If I go to Ubuntu Settings Sound Output, it doesn't show my Intel card there anymore: The same for the Input tab, it doesn's show my Intel card there anymore: Could you please help me?

    Read the article

  • Kernel Error during upgrade or update commands

    - by Ashesh
    I am getting these errors during sudo apt-get update and upgrade... I tried all possible options no success. I recently upgraded to 13.04 and had problems with Broadcom WiFi. Fixed tat issues using the clean script... but looks like it did not install the Kernel properly.. Here is the o/p of the few scripts I ran: ashesh@ashesh-HPdv4:~$ sudo dpkg -r bcmwl-kernel-source (Reading database ... 175338 files and directories currently installed.) Removing bcmwl-kernel-source ... Removing all DKMS Modules Done. update-initramfs: deferring update (trigger activated) Processing triggers for initramfs-tools ... update-initramfs: Generating /boot/initrd.img-3.8.0-25-generic cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/mtd/mtd.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/mtd/mtd.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/sfc/sfc.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/sfc/sfc.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/mellanox/mlx4/mlx4_core.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/mellanox/mlx4/mlx4_core.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/broadcom/bnx2x/bnx2x.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/broadcom/bnx2x/bnx2x.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/broadcom/cnic.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/broadcom/cnic.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/qlogic/netxen/netxen_nic.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/qlogic/netxen/netxen_nic.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/brocade/bna/bna.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/net/ethernet/brocade/bna/bna.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/scsi/libfc/libfc.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/scsi/libfc/libfc.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/scsi/advansys.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/scsi/advansys.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/scsi/be2iscsi/be2iscsi.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/scsi/be2iscsi/be2iscsi.ko’: Input/output error cp: reading ‘/lib/modules/3.8.0-25-generic/kernel/drivers/scsi/bnx2i/bnx2i.ko’: Input/output error cp: failed to extend ‘/tmp/mkinitramfs_8gjKwQ//lib/modules/3.8.0-25-generic/kernel/drivers/scsi/bnx2i/bnx2i.ko’: Input/output error Bus error (core dumped) depmod: ../libkmod/libkmod-elf.c:207: elf_get_mem: Assertion `offset < elf->size' failed. Aborted (core dumped) I am not a techie but I need your support to resolve this without re-installation from scratch....

    Read the article

  • function using cl-who:with-html-output ignoring parameter

    - by shanked
    I'm not sure whether this is an issue with my use of cl-who (specifically with-html-output-to-string and with-html-output) or an issue with my understanding of Common Lisp (as this is my first project using Lisp). I created a function to create form fields: (defun form-field (type name label) (cl-who:with-html-output (*standard-output* nil) (:div :class "field" (:label :for name label) (:input :type type :name name)))) When using this function, ie: (form-field "text" "username" "Username") the parameter label seems to be ignored... the HTML output is: <div class="field"><label for="username"></label> <input type="text" name="username"/></div> instead of the expected output: <div class="field"><label for="username">Username</label> <input type="text" name="username"/></div> If I modify the function and add a print statement: (defun form-field (type name label) (cl-who:with-html-output (*standard-output* nil) (print label) (:div :class "field" (:label :for name label) (:input :type type :name name)))) The "Username" string is successfully output (but still ignored in the HTML)... any ideas what might cause this? Keep in mind, I'm calling this function within a cl-who:with-html-output-to-string for use with hunchentoot.

    Read the article

  • Actionscript: NetStream stutters after buffering.

    - by meandmycode
    Using NetStream to stream content from http, I've noticed that esp with certain exported h264's, if the player encounters an empty buffer, it will stop and buffer to the requested length (as expected). However once the buffer is full, the playback doesn't resume, but instead jumps ahead, as such- instantly playing the buffered duration in a brief moment, and thusly triggering an empty buffer again.. this will then continue over and over. Presumably when the netstream pauses to buffer, the playhead position continues, and the player is attempting to snap to that position on resume- however given it could take 5 seconds to build a 2 second buffer- it ends up with a useless buffer again.. (this is an assumption) I've attempted to work around this by listening for an empty buffer netstatus event, pausing the stream, and at the same time setting up a loop to check the current buffer length vs the requested buffer length.. and resuming once the buffer length is greater than or equal to the requested buffer.. however this causes problems when there isn't enough of the video remaining.. for example, a 10 second buffer with only 5 seconds remaining, the loop just sits there waiting for a buffer length of 10 seconds when theres only 5 left... You would think that you could simply check which was smaller, the time left or the requested buffer length.. however the times flash gives are not accurate.. If you add the net streams current time index, plus the buffered time, the total is not the entire duration of the movie (when at the end).. it is close but not the same. This brings me back to the original problem, and if there is another way to fix this, clearly flash knows when the buffer is ready, so how can i get flash pause when it buffers, and resume once the buffer is ready? currently it doesn't.. it pauses and then once the buffer is full- it plays the entire buffered content in about .1 of a second. Thanks in advance, Stephen.

    Read the article

  • GDI+ double buffering in C++

    - by David Titarenco
    I haven't written anything with GDI for a while now (and never with GDI+), and I'm just working on a fun project, but for the life of me, I can't figure out how to double buffer GDI+ void DrawStuff(HWND hWnd) { HDC hdc; HDC hdcBuffer; PAINTSTRUCT ps; hdc = BeginPaint(hWnd, &ps); hdcBuffer = CreateCompatibleDC(hdc); Graphics graphics(hdc); graphics.Clear(Color::Black); // drawing stuff, i.e. bunnies: Image bunny(L"bunny.gif"); graphics.DrawImage(&bunny, 0, 0, bunny.GetWidth(), bunny.GetHeight()); BitBlt(hdc, 0,0, WIDTH , HEIGHT, hdcBuffer, 0,0, SRCCOPY); EndPaint(hWnd, &ps); } The above works (everything renders perfectly), but it flickers. If I change Graphics graphics(hdc); to Graphics graphics(hdcBuffer);, I see nothing (although I should be bitblt'ing the buffer-hWnd hdc at the bottom). My message pipeline is set up properly (WM_PAINT calls DrawStuff), and I'm forcing a WM_PAINT message every program loop by calling RedrawWindow(window, NULL, NULL, RDW_ERASE | RDW_INVALIDATE | RDW_UPDATENOW); I'm probably going about the wrong way to do this, any ideas? The MSDN documentation is cryptic at best.

    Read the article

  • how to get doctype tag with url using xsl:output

    - by keshav.veerapaneni
    Hi, i have added the below xsl:output tag in xslt <xsl:output method="html" indent="yes" encoding="utf-8" doctype-public="-//W3C//DTD HTML 4.0 Transitional//EN" </xsl:output as a result i get the below doctype tag in the html output- <!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN" how can i mention the url in the doctype tag using xsl:output which would output a doctype tag that looks like below <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "_http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd" Best Regards, Keshav

    Read the article

  • EAGLView orientation changes and strange buffering

    - by Drew
    I'm writing an app that offloads some heavy drawing into an EAGLView, and it does some lightweight stuff in UIKit on top. It seems that the GL render during an orientation change is cached somewhere, and I can't figure out how to get access to it. Specifically: After an orientation change, calling glClear(GL_COLOR_BUFFER_BIT) isn't enough to clear the GL display (drawing is cached somewhere?) How can I clear this cache? After an orientation change, glReadPixel() can no longer access pixels drawn before the orientation change. How can I get access to where this is stored?

    Read the article

  • Double buffering C#

    - by LmSNe
    Hey, I'm trying to implement the following method: void Ball::DrawOn(Graphics g); The method should draw all previous locations(stored in a queue) of the ball and finally the current location. I don't know if that matters, but I print the previous locations using g.DrawEllipse(...) and the current location using g.FillEllipse(...). The question is, that as you could imagine there is a lot of drawing to be done and thus the display starts to flicker much. I had searched for a way to double buffer, but all I could find is these 2 ways: 1) System.Windows.Forms.Control.DoubleBuffered = true; 2) SetStyle(ControlStyles.DoubleBuffer | ControlStyles.UserPaint | ControlStyles.AllPaintingInWmPaint, true); while trying to use the first, I get the an error explaining that from in this method the Property DoubleBuffered is inaccessible due to its protection level. While I can't figure how to use the SetStyle method. Is it possible at all to double buffer while all the access I have is to the Graphics Object I get as input in the method? Thanks in Advance,

    Read the article

  • How to implement buffering with timeout in RX

    - by Gaspar Nagy
    I need to implement an event processing, that is done delayed when there are no new events arriving for a certain period. (I have to queue up a parsing task when the text buffer changed, but I don't want to start the parsing when the user is still typing.) I'm new in RX, but as far as I see, I would need a combination of BufferWithTime and the Timeout methods. I imagine this to be working like this: it buffers the events until they are received regularly within a specified time period between the subsequent events. If there is a gap in the event flow (longer than the timespan) it should return propagate the events buffered so far. Having a look at how Buffer and Timeout is implemented, I could probably implement my BufferWithTimeout method (if everyone have one, please share with me), but I wonder if this can be achieved just by combining the existing methods. Any ideas?

    Read the article

  • Compare output of program to correct program using bash script, without using text files

    - by Doug
    I've been trying to compare the output of a program to known correct output by using a bash script without piping the output of the program to a file and then using diff on the output file and a correct output file. I've tried setting the variables to the output and correct output and I believe it's been successful but I can't get the string comparison to work correctly. I may be wrong about the variable setting so it could be that. What I've been writing: TEST=`./convert testdata.txt < somesampledata.txt` CORRECT="some correct output" if [ "$TEST"!="$CORRECT" ]; then echo "failed" fi

    Read the article

  • SocketAsyncEventArgs and buffering while messages are in parts

    - by Rob
    C# socket server, which has roughly 200 - 500 active connections, each one constantly sending messages to our server. About 70% of the time the messages are handled fine (in the correct order etc), however in the other 30% of cases we have jumbled up messages and things get screwed up. We should note that some clients send data in unicode and others in ASCII, so that's handled as well. Messages sent to the server are a variable length string which end in a char3, it's the char3 that we break on, other than that we keep receiving data. Could anyone shed any light on our ProcessReceive code and see what could possibly be causing us issues and how we can solve this small issue (here's hoping it's a small issue!) Code below:

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Why isn't my log4net appender buffering?

    - by Eric
    I've created a custom log4net appender. It descends from log4net.Appender.SmtpAppender which descends from log4net.Appender.BufferingAppenderSkeleton. I programatically setup the following parameters in its constructor: this.Lossy = false; //don't drop any messages this.BufferSize = 3; //buffer up to 3 messages this.Threshold = log4net.Core.Level.Error; //append messages of Error or higher this.Evaluator = new log4net.Core.LevelEvaluator(Level.Off); //don't flush the buffer for any message, regardless of level I expect this would buffer 3 events of level Error or higher and deliver those events when the buffer is filled. However, I'm finding that the events are not buffered at all; instead, SendBuffer() is called immediately every time an error is logged. Is there a mistake in my configuration? Thanks

    Read the article

< Previous Page | 6 7 8 9 10 11 12 13 14 15 16 17  | Next Page >