Search Results

Search found 27312 results on 1093 pages for 'javascript execution'.

Page 1008/1093 | < Previous Page | 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015  | Next Page >

  • Having trouble wrapping functions in the linux kernel

    - by Corey Henderson
    I've written a LKM that implements Trusted Path Execution (TPE) into your kernel: https://github.com/cormander/tpe-lkm I run into an occasional kernel OOPS (describe at the end of this question) when I define WRAP_SYSCALLS to 1, and am at my wit's end trying to track it down. A little background: Since the LSM framework doesn't export its symbols, I had to get creative with how I insert the TPE checking into the running kernel. I wrote a find_symbol_address() function that gives me the address of any function I need, and it works very well. I can call functions like this: int (*my_printk)(const char *fmt, ...); my_printk = find_symbol_address("printk"); (*my_printk)("Hello, world!\n"); And it works fine. I use this method to locate the security_file_mmap, security_file_mprotect, and security_bprm_check functions. I then overwrite those functions with an asm jump to my function to do the TPE check. The problem is, the currently loaded LSM will no longer execute the code for it's hook to that function, because it's been totally hijacked. Here is an example of what I do: int tpe_security_bprm_check(struct linux_binprm *bprm) { int ret = 0; if (bprm->file) { ret = tpe_allow_file(bprm->file); if (IS_ERR(ret)) goto out; } #if WRAP_SYSCALLS stop_my_code(&cs_security_bprm_check); ret = cs_security_bprm_check.ptr(bprm); start_my_code(&cs_security_bprm_check); #endif out: return ret; } Notice the section between the #if WRAP_SYSCALLS section (it's defined as 0 by default). If set to 1, the LSM's hook is called because I write the original code back over the asm jump and call that function, but I run into an occasional kernel OOPS with an "invalid opcode": invalid opcode: 0000 [#1] SMP RIP: 0010:[<ffffffff8117b006>] [<ffffffff8117b006>] security_bprm_check+0x6/0x310 I don't know what the issue is. I've tried several different types of locking methods (see the inside of start/stop_my_code for details) to no avail. To trigger the kernel OOPS, write a simple bash while loop that endlessly starts a backgrounded "ls" command. After a minute or so, it'll happen. I'm testing this on a RHEL6 kernel, also works on Ubuntu 10.04 LTS (2.6.32 x86_64). While this method has been the most successful so far, I have tried another method of simply copying the kernel function to a pointer I created with kmalloc but when I try to execute it, I get: kernel tried to execute NX-protected page - exploit attempt? (uid: 0). If anyone can tell me how to kmalloc space and have it marked as executable, that would also help me solve the above problem. Any help is appreciated!

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • Poor performance / speed of regex with lookahead

    - by Hugo Zaragoza
    I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • How can a C/C++ program put itself into background?

    - by Larry Gritz
    What's the best way for a running C or C++ program that's been launched from the command line to put itself into the background, equivalent to if the user had launched from the unix shell with '&' at the end of the command? (But the user didn't.) It's a GUI app and doesn't need any shell I/O, so there's no reason to tie up the shell after launch. But I want a shell command launch to be auto-backgrounded without the '&' (or on Windows). Ideally, I want a solution that would work on any of Linux, OS X, and Windows. (Or separate solutions that I can select with #ifdef.) It's ok to assume that this should be done right at the beginning of execution, as opposed to somewhere in the middle. One solution is to have the main program be a script that launches the real binary, carefully putting it into the background. But it seems unsatisfying to need these coupled shell/binary pairs. Another solution is to immediately launch another executed version (with 'system' or CreateProcess), with the same command line arguments, but putting the child in the background and then having the parent exit. But this seems clunky compared to the process putting itself into background. Edited after a few answers: Yes, a fork() (or system(), or CreateProcess on Windows) is one way to sort of do this, that I hinted at in my original question. But all of these solutions make a SECOND process that is backgrounded, and then terminate the original process. I was wondering if there was a way to put the EXISTING process into the background. One difference is that if the app was launched from a script that recorded its process id (perhaps for later killing or other purpose), the newly forked or created process will have a different id and so will not be controllable by any launching script, if you see what I'm getting at. Edit #2: fork() isn't a good solution for OS X, where the man page for 'fork' says that it's unsafe if certain frameworks or libraries are being used. I tried it, and my app complains loudly at runtime: "The process has forked and you cannot use this CoreFoundation functionality safely. You MUST exec()." I was intrigued by daemon(), but when I tried it on OS X, it gave the same error message, so I assume that it's just a fancy wrapper for fork() and has the same restrictions. Excuse the OS X centrism, it just happens to be the system in front of me at the moment. But I am indeed looking for a solution to all three platforms.

    Read the article

  • php connecting to mysql server(localhost) very slow

    - by Ahmad
    actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

    Read the article

  • Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

    - by chernevik
    I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

    Read the article

  • How can I improve the recursion capabilities of my ECMAScript implementation?

    - by ChaosPandion
    After some resent tests I have found my implementation cannot handle very much recursion. Although after I ran a few tests in Firefox I found that this may be more common than I originally thought. I believe the basic problem is that my implementation requires 3 calls to make a function call. The first call is made to a method named Call that makes sure the call is being made to a callable object and gets the value of any arguments that are references. The second call is made to a method named Call which is defined in the ICallable interface. This method creates the new execution context and builds the lambda expression if it has not been created. The final call is made to the lambda that the function object encapsulates. Clearly making a function call is quite heavy but I am sure that with a little bit of tweaking I can make recursion a viable tool when using this implementation. public static object Call(ExecutionContext context, object value, object[] args) { var func = Reference.GetValue(value) as ICallable; if (func == null) { throw new TypeException(); } if (args != null && args.Length > 0) { for (int i = 0; i < args.Length; i++) { args[i] = Reference.GetValue(args[i]); } } var reference = value as Reference; if (reference != null) { if (reference.IsProperty) { return func.Call(reference.Value, args); } else { return func.Call(((EnviromentRecord)reference.Value).ImplicitThisValue(), args); } } return func.Call(Undefined.Value, args); } public object Call(object thisObject, object[] arguments) { var lexicalEnviroment = Scope.NewDeclarativeEnviroment(); var variableEnviroment = Scope.NewDeclarativeEnviroment(); var thisBinding = thisObject ?? Engine.GlobalEnviroment.GlobalObject; var newContext = new ExecutionContext(Engine, lexicalEnviroment, variableEnviroment, thisBinding); Engine.EnterContext(newContext); var result = Function.Value(newContext, arguments); Engine.LeaveContext(); return result; }

    Read the article

  • How would you implement this "WorkerChain" functionality in .NET?

    - by Dan Tao
    Sorry for the vague question title -- not sure how to encapsulate what I'm asking below succinctly. (If someone with editing privileges can think of a more descriptive title, feel free to change it.) The behavior I need is this. I am envisioning a worker class that accepts a single delegate task in its constructor (for simplicity, I would make it immutable -- no more tasks can be added after instantiation). I'll call this task T. The class should have a simple method, something like GetToWork, that will exhibit this behavior: If the worker is not currently running T, then it will start doing so right now. If the worker is currently running T, then once it is finished, it will start T again immediately. GetToWork can be called any number of times while the worker is running T; the simple rule is that, during any execution of T, if GetToWork was called at least once, T will run again upon completion (and then if GetToWork is called while T is running that time, it will repeat itself again, etc.). Now, this is pretty straightforward with a boolean switch. But this class needs to be thread-safe, by which I mean, steps 1 and 2 above need to comprise atomic operations (at least I think they do). There is an added layer of complexity. I have need of a "worker chain" class that will consist of many of these workers linked together. As soon as the first worker completes, it essentially calls GetToWork on the worker after it; meanwhile, if its own GetToWork has been called, it restarts itself as well. Logically calling GetToWork on the chain is essentially the same as calling GetToWork on the first worker in the chain (I would fully intend that the chain's workers not be publicly accessible). One way to imagine how this hypothetical "worker chain" would behave is by comparing it to a team in a relay race. Suppose there are four runners, W1 through W4, and let the chain be called C. If I call C.StartWork(), what should happen is this: If W1 is at his starting point (i.e., doing nothing), he will start running towards W2. If W1 is already running towards W2 (i.e., executing his task), then once he reaches W2, he will signal to W2 to get started, immediately return to his starting point and, since StartWork has been called, start running towards W2 again. When W1 reaches W2's starting point, he'll immediately return to his own starting point. If W2 is just sitting around, he'll start running immediately towards W3. If W2 is already off running towards W3, then W2 will simply go again once he's reached W3 and returned to his starting point. The above is probably a little convoluted and written out poorly. But hopefully you get the basic idea. Obviously, these workers will be running on their own threads. Also, I guess it's possible this functionality already exists somewhere? If that's the case, definitely let me know!

    Read the article

  • StaX: Content not allowed in prolog

    - by RalfB
    I have the following (test) XML file below and Java code that uses StaX. I want to apply this code to a file that is about 30 GB large but with fairly small elements, so I thought StaX is a good choice. I am getting the following error: Exception in thread "main" javax.xml.stream.XMLStreamException: ParseError at [row,col]:[1,1] Message: Content is not allowed in prolog at com.sun.org.apache.xerces.internal.impl.XMLStreamReaderImpl.next(XMLStreamReaderImpl.java:598) at at.tuwien.mucke.util.xml.staxtest.StaXTest.main(StaXTest.java:18) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at java.lang.reflect.Method.invoke(Method.java:601) at com.intellij.rt.execution.application.AppMain.main(AppMain.java:120) <?xml version='1.0' encoding='utf-8'?> <catalog> <book id="bk101"> <author>Gambardella, Matthew</author> <title>XML Developer's Guide</title> <price>44.95</price> <description>An in-depth look at creating applications with XML.</description> </book> <book id="bk102"> <author>Ralls, Kim</author> <title>Midnight Rain</title> <price>5.95</price> <description>A former architect battles corporate zombies, an evil sorceress, and her own childhood to become queen of the world.</description> </book> </catalog> Here the code: package xml.staxtest; import java.io.*; import javax.xml.stream.*; public class StaXTest { public static void main(String[] args) throws Exception { XMLInputFactory xif = XMLInputFactory.newInstance(); XMLStreamReader streamReader = xif.createXMLStreamReader(new FileReader("D:/Data/testFile.xml")); while(streamReader.hasNext()){ int eventType = streamReader.next(); if(eventType == XMLStreamReader.START_ELEMENT){ System.out.println(streamReader.getLocalName()); } //... more to come here later ... } } }

    Read the article

  • run shell command from java

    - by Aykut
    Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

    Read the article

  • Why does the Ternary\Conditional operator seem significantly faster

    - by Jodrell
    Following on from this question, which I have partially answered. I compile this console app in x64 Release Mode, with optimizations on, and run it from the command line without a debugger attached. using System; using System.Diagnostics; class Program { static void Main() { var stopwatch = new Stopwatch(); var ternary = Looper(10, Ternary); var normal = Looper(10, Normal); if (ternary != normal) { throw new Exception(); } stopwatch.Start(); ternary = Looper(10000000, Ternary); stopWatch.Stop(); Console.WriteLine( "Ternary took {0}ms", stopwatch.ElapsedMilliseconds); stopwatch.Start(); normal = Looper(10000000, Normal); stopWatch.Stop(); Console.WriteLine( "Normal took {0}ms", stopwatch.ElapsedMilliseconds); if (ternary != normal) { throw new Exception(); } Console.ReadKey(); } static int Looper(int iterations, Func<bool, int, int> operation) { var result = 0; for (int i = 0; i < iterations; i++) { var condition = result % 11 == 4; var value = ((i * 11) / 3) % 5; result = operation(condition, value); } return result; } static int Ternary(bool condition, in value) { return value + (condition ? 2 : 1); } static int Normal(int iterations) { if (condition) { return = 2 + value; } return = 1 + value; } } I don't get any exceptions and the output to the console is somthing close to, Ternary took 107ms Normal took 230ms When I break down the CIL for the two logical functions I get this, ... Ternary ... { : ldarg.1 // push second arg : ldarg.0 // push first arg : brtrue.s T // if first arg is true jump to T : ldc.i4.1 // push int32(1) : br.s F // jump to F T: ldc.i4.2 // push int32(2) F: add // add either 1 or 2 to second arg : ret // return result } ... Normal ... { : ldarg.0 // push first arg : brfalse.s F // if first arg is false jump to F : ldc.i4.2 // push int32(2) : ldarg.1 // push second arg : add // add second arg to 2 : ret // return result F: ldc.i4.1 // push int32(1) : ldarg.1 // push second arg : add // add second arg to 1 : ret // return result } Whilst the Ternary CIL is a little shorter, it seems to me that the execution path through the CIL for either function takes 3 loads and 1 or 2 jumps and a return. Why does the Ternary function appear to be twice as fast. I underdtand that, in practice, they are both very quick and indeed, quich enough but, I would like to understand the discrepancy.

    Read the article

  • What common routines do you put in your Program.cs for C#

    - by Rick
    I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

    Read the article

  • When transactionManager is not named "transactionManager" ...

    - by smallufo
    I am trying Spring 3(.0.2.RELEASE) and JPA2 and Hibernate 3.5.1-Final... One thing upsets me is that spring seems only accept a transaction Manager named "transactionManager" If I don't name it "transactionManager" , Spring will throws NoSuchBeanDefinitionException: No bean named 'transactionManager' is defined. Here is my config : <context:component-scan base-package="destiny.data.mining"/> <context:annotation-config/> <bean id="miningEntityManagerFactory" class="org.springframework.orm.jpa.LocalContainerEntityManagerFactoryBean"> <property name="persistenceUnitName" value="mining"/> </bean> <bean id="miningTransactionManager" class="org.springframework.orm.jpa.JpaTransactionManager" > <property name="entityManagerFactory" ref="miningEntityManagerFactory"/> </bean> <tx:advice id="txAdviceMining" transaction-manager="miningTransactionManager"> <tx:attributes> <tx:method name="get*" read-only="true"/> <tx:method name="save*" propagation="REQUIRED"/> <tx:method name="update*" propagation="REQUIRED"/> <tx:method name="delete*" propagation="REQUIRED"/> <tx:method name="*" propagation="SUPPORTS" read-only="true"/> </tx:attributes> </tx:advice> <aop:config> <aop:pointcut id="methods" expression="execution(* destiny.utils.AbstractDao+.*(..))"/> <aop:advisor advice-ref="txAdviceMining" pointcut-ref="methods"/> </aop:config> <tx:annotation-driven transaction-manager="miningTransactionManager"/> In this config , an Entity Manager Factory is not necessarily named "entityManagerFactory" , and "txAdvice" is not necessarily named "txAdvice" , either. But I don't know why on earth Spring requires a transaction manager named "transactionManager" ? Is there any way not to name a transaction manager "transactionManager" ? (I'm running multiple spring config files , so I try my best to avoid name-conflicting) test code : @RunWith(SpringJUnit4ClassRunner.class) @ContextConfiguration(locations={"classpath:mining.xml"}) public class MiningPersonDaoTest { @Inject private EntityManagerFactory miningEntityManagerFactory; @Inject private MiningPersonDao miningPersonDao; @Transactional @Test public void testUpdate() { MiningPerson p = miningPersonDao.get(42L); p.setLocationName("OOXX"); miningPersonDao.update(p); System.out.println(p); } } ii

    Read the article

  • Jumping into argv?

    - by jth
    Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

    Read the article

  • Vertical Seek not progress value not showing on MainActivity textView

    - by Raju Gujarati
    I am try to display the progress value of the seekBar but when it comes to the execution, there is no update on the value being display on the TextView. I wonder what alternatives than putting two classes onto one big class in order to archive this aim ? The below is my code VerticalSeekBar.java package com.example.imagerotation; import android.content.Context; import android.graphics.Canvas; import android.util.AttributeSet; import android.view.MotionEvent; import android.widget.SeekBar; import android.widget.Toast; public class VerticalSeekBar extends SeekBar { public VerticalSeekBar(Context context) { super(context); } public VerticalSeekBar(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); } public VerticalSeekBar(Context context, AttributeSet attrs) { super(context, attrs); } protected void onSizeChanged(int w, int h, int oldw, int oldh) { super.onSizeChanged(h, w, oldh, oldw); } @Override protected synchronized void onMeasure(int widthMeasureSpec, int heightMeasureSpec) { super.onMeasure(heightMeasureSpec, widthMeasureSpec); setMeasuredDimension(getMeasuredHeight(), getMeasuredWidth()); } protected void onDraw(Canvas c) { c.rotate(-90); c.translate(-getHeight(), 0); super.onDraw(c); } @Override public boolean onTouchEvent(MotionEvent event) { if (!isEnabled()) { return false; } switch (event.getAction()) { case MotionEvent.ACTION_DOWN: case MotionEvent.ACTION_MOVE: case MotionEvent.ACTION_UP: int progress = getMax() - (int) (getMax() * event.getY() / getHeight()); setProgress(progress); onSizeChanged(getWidth(), getHeight(), 0, 0); //Toast.makeText(getContext(), String.valueOf(progress), Toast.LENGTH_SHORT).show(); break; case MotionEvent.ACTION_CANCEL: break; } return true; } } MainActvity.java package com.example.imagerotation; import android.app.Activity; import android.os.Bundle; import android.view.Menu; import android.view.MenuItem; import android.widget.TextView; public class MainActivity extends Activity { private VerticalSeekBar seek; private TextView by; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main); seek = (VerticalSeekBar)findViewById(R.id.seekBar1); by = (TextView)findViewById(R.id.textView1); by.setText(String.valueOf(seek.getProgress())); } }

    Read the article

  • SwingWorker exceptions lost even when using wrapper classes

    - by Ti Strga
    I've been struggling with the usability problem of SwingWorker eating any exceptions thrown in the background task, for example, described on this SO thread. That thread gives a nice description of the problem, but doesn't discuss recovering the original exception. The applet I've been handed needs to propagate the exception upwards. But I haven't been able to even catch it. I'm using the SimpleSwingWorker wrapper class from this blog entry specifically to try and address this issue. It's a fairly small class but I'll repost it at the end here just for reference. The calling code looks broadly like try { // lots of code here to prepare data, finishing with SpecialDataHelper helper = new SpecialDataHelper(...stuff...); helper.execute(); } catch (Throwable e) { // used "Throwable" here in desperation to try and get // anything at all to match, including unchecked exceptions // // no luck, this code is never ever used :-( } The wrappers: class SpecialDataHelper extends SimpleSwingWorker { public SpecialDataHelper (SpecialData sd) { this.stuff = etc etc etc; } public Void doInBackground() throws Exception { OurCodeThatThrowsACheckedException(this.stuff); return null; } protected void done() { // called only when successful // never reached if there's an error } } The feature of SimpleSwingWorker is that the actual SwingWorker's done()/get() methods are automatically called. This, in theory, rethrows any exceptions that happened in the background. In practice, nothing is ever caught, and I don't even know why. The SimpleSwingWorker class, for reference, and with nothing elided for brevity: import java.util.concurrent.ExecutionException; import javax.swing.SwingWorker; /** * A drop-in replacement for SwingWorker<Void,Void> but will not silently * swallow exceptions during background execution. * * Taken from http://jonathangiles.net/blog/?p=341 with thanks. */ public abstract class SimpleSwingWorker { private final SwingWorker<Void,Void> worker = new SwingWorker<Void,Void>() { @Override protected Void doInBackground() throws Exception { SimpleSwingWorker.this.doInBackground(); return null; } @Override protected void done() { // Exceptions are lost unless get() is called on the // originating thread. We do so here. try { get(); } catch (final InterruptedException ex) { throw new RuntimeException(ex); } catch (final ExecutionException ex) { throw new RuntimeException(ex.getCause()); } SimpleSwingWorker.this.done(); } }; public SimpleSwingWorker() {} protected abstract Void doInBackground() throws Exception; protected abstract void done(); public void execute() { worker.execute(); } }

    Read the article

  • How do I use JDK 7 on Mac OSX?

    - by Yko
    OK. This is a newbie question but I can't figure it out... I would like to use the WatchService API as mentioned in this link: http://download.oracle.com/javase/tutorial/essential/io/notification.html After reading around, I found out that WatchService is part of the NIO class which is scheduled for JDK 7. So, it is in beta form. It's fine. http://jdk7.java.net/download.html has the JDK which I downloaded and extracted. I got a bunch of folders. I don't know what to do with them. Then, I read around some more and found that some nice group of people created JDK 7 as a binary so someone like me can install it easily. It is called Open JDK: http://code.google.com/p/openjdk-osx-build/ So, I downloaded the .dmg file and instal it. Then I open "Java Preference" and see that OpenJDK7 is available. So, now I feel that I can start trying out WatchService API. From the tutorial in the first link, the author gave a .java file to test it out first and make sure that it is running. Here is the link to the file: http://download.oracle.com/javase/tutorial/essential/io/examples/WatchDir.java So, I boot up Eclipse (actually I use STS) and create a new Java project and choose JaveSE-1.7 in the "use an execution environment JRE:". Under the src folder, I copy pasted the WatchDir.java file. And I still see tons of squiggly red lines. All the "import.java.nio.*" are all red and I cannot run it as a Java app. If you read this far, thanks a lot. So, now... What do I need to do? Thanks. EDIT: I actually did not pursue using Java 7 but there are a lot of interest in it and it seems like people keep answering this question. What should I do to make it more relevant to people who search for it? Let me know by PMing me. Thanks.

    Read the article

  • How to fix this Speech Recognition wicked bug?

    - by aF
    I have this code in my C# project: public void startRecognition(string pName) { presentationName = pName; if (WaveNative.waveInGetNumDevs() > 0) { string grammar = System.Environment.GetEnvironmentVariable("PUBLIC") + "\\SoundLog\\Presentations\\" + presentationName + "\\SpeechRecognition\\soundlog.cfg"; if (File.Exists(grammar)) { File.Delete(grammar); } executeCommand(); /// Create an instance of SpSharedRecoContextClass which will be used /// to interface with the incoming audio stream recContext = new SpSharedRecoContextClass(); // Create the grammar object recContext.CreateGrammar(1, out recGrammar); //recContext.CreateGrammar(2, out recGrammar2); // Set up dictation mode //recGrammar2.SetDictationState(SpeechLib.SPRULESTATE.SPRS_ACTIVE); //recGrammar2.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); // Set appropriate grammar mode if (File.Exists(grammar)) { recGrammar.LoadCmdFromFile(grammar, SPLOADOPTIONS.SPLO_STATIC); //recGrammar.SetDictationState(SpeechLib.SPRULESTATE.SPRS_INACTIVE); recGrammar.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); recGrammar.SetRuleIdState(0, SPRULESTATE.SPRS_ACTIVE); } /// Bind a callback to the recognition event which will be invoked /// When a dictated phrase has been recognised. recContext.Recognition += new _ISpeechRecoContextEvents_RecognitionEventHandler(handleRecognition); // System.Windows.Forms.MessageBox.Show(recContext.ToString()); // gramática compilada } } private static void handleRecognition(int StreamNumber, object StreamPosition, SpeechLib.SpeechRecognitionType RecognitionType, SpeechLib.ISpeechRecoResult Result) { string temp = Result.PhraseInfo.GetText(0, -1, true); _recognizedText = ""; // System.Windows.Forms.MessageBox.Show(temp); // System.Windows.Forms.MessageBox.Show(recognizedWords.Count.ToString()); foreach (string word in recognizedWords) { if (temp.Contains(word)) { // System.Windows.Forms.MessageBox.Show("yes"); _recognizedText = word; } } } This codes generates a dll that I use in another application. Now, the wicked bug: - when I run the startRecognition method in the beginning of the execution of the other application, this codes works very well. But when I run it some time after the beginning, this codes works but the handleRecognition method is never called. I see that the words are recognized because they appear on the Microsoft Speech Recognition app, but the handler method is never called. Do you know what's the problem with this code? NOTE: this project has some code that is allways being executed. Might that be the problem? Because the other code is running it doesn't allow it to this to run?

    Read the article

  • How to fix this Speech Recognition on C# wicked bug?

    - by aF
    Hello, I have this code in my C# project: public void startRecognition(string pName) { presentationName = pName; if (WaveNative.waveInGetNumDevs() > 0) { string grammar = System.Environment.GetEnvironmentVariable("PUBLIC") + "\\SoundLog\\Presentations\\" + presentationName + "\\SpeechRecognition\\soundlog.cfg"; if (File.Exists(grammar)) { File.Delete(grammar); } executeCommand(); /// Create an instance of SpSharedRecoContextClass which will be used /// to interface with the incoming audio stream recContext = new SpSharedRecoContextClass(); // Create the grammar object recContext.CreateGrammar(1, out recGrammar); //recContext.CreateGrammar(2, out recGrammar2); // Set up dictation mode //recGrammar2.SetDictationState(SpeechLib.SPRULESTATE.SPRS_ACTIVE); //recGrammar2.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); // Set appropriate grammar mode if (File.Exists(grammar)) { recGrammar.LoadCmdFromFile(grammar, SPLOADOPTIONS.SPLO_STATIC); //recGrammar.SetDictationState(SpeechLib.SPRULESTATE.SPRS_INACTIVE); recGrammar.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); recGrammar.SetRuleIdState(0, SPRULESTATE.SPRS_ACTIVE); } /// Bind a callback to the recognition event which will be invoked /// When a dictated phrase has been recognised. recContext.Recognition += new _ISpeechRecoContextEvents_RecognitionEventHandler(handleRecognition); // System.Windows.Forms.MessageBox.Show(recContext.ToString()); // gramática compilada } } private static void handleRecognition(int StreamNumber, object StreamPosition, SpeechLib.SpeechRecognitionType RecognitionType, SpeechLib.ISpeechRecoResult Result) { string temp = Result.PhraseInfo.GetText(0, -1, true); _recognizedText = ""; // System.Windows.Forms.MessageBox.Show(temp); // System.Windows.Forms.MessageBox.Show(recognizedWords.Count.ToString()); foreach (string word in recognizedWords) { if (temp.Contains(word)) { // System.Windows.Forms.MessageBox.Show("yes"); _recognizedText = word; } } } This codes generates a dll that I use in another application. Now, the wicked bug: - when I run the startRecognition method in the beginning of the execution of the other application, this codes works very well. But when I run it some time after the beginning, this codes works but the handleRecognition method is never called. I see that the words are recognized because they appear on the Microsoft Speech Recognition app, but the handler method is never called. Do you know what's the problem with this code? Thanks in advance :D

    Read the article

  • How to get all captures of subgroup matches with preg_match_all()?

    - by hakre
    Update/Note: I think what I'm probably looking for is to get the captures of a group in PHP. Referenced: PCRE regular expressions using named pattern subroutines. (Read carefully:) I have a string that contains a variable number of segments (simplified): $subject = 'AA BB DD '; // could be 'AA BB DD CC EE ' as well I would like now to match the segments and return them via the matches array: $pattern = '/^(([a-z]+) )+$/i'; $result = preg_match_all($pattern, $subject, $matches); This will only return the last match for the capture group 2: DD. Is there a way that I can retrieve all subpattern captures (AA, BB, DD) with one regex execution? Isn't preg_match_all suitable for this? This question is a generalization. Both the $subject and $pattern are simplified. Naturally with such the general list of AA, BB, .. is much more easy to extract with other functions (e.g. explode) or with a variation of the $pattern. But I'm specifically asking how to return all of the subgroup matches with the preg_...-family of functions. For a real life case imagine you have multiple (nested) level of a variant amount of subpattern matches. Example This is an example in pseudo code to describe a bit of the background. Imagine the following: Regular definitions of tokens: CHARS := [a-z]+ PUNCT := [.,!?] WS := [ ] $subject get's tokenized based on these. The tokenization is stored inside an array of tokens (type, offset, ...). That array is then transformed into a string, containing one character per token: CHARS -> "c" PUNCT -> "p" WS -> "s" So that it's now possible to run regular expressions based on tokens (and not character classes etc.) on the token stream string index. E.g. regex: (cs)?cp to express one or more group of chars followed by a punctuation. As I now can express self-defined tokens as regex, the next step was to build the grammar. This is only an example, this is sort of ABNF style: words = word | (word space)+ word word = CHARS+ space = WS punctuation = PUNCT If I now compile the grammar for words into a (token) regex I would like to have naturally all subgroup matches of each word. words = (CHARS+) | ( (CHARS+) WS )+ (CHARS+) # words resolved to tokens words = (c+)|((c+)s)+c+ # words resolved to regex I could code until this point. Then I ran into the problem that the sub-group matches did only contain their last match. So I have the option to either create an automata for the grammar on my own (which I would like to prevent to keep the grammar expressions generic) or to somewhat make preg_match working for me somehow so I can spare that. That's basically all. Probably now it's understandable why I simplified the question. Related: pcrepattern man page Get repeated matches with preg_match_all()

    Read the article

  • -[NSConcreteMutableData release]: message sent to deallocated instance

    - by kamibutt
    Dear members, I am facing a problem of -[NSConcreteMutableData release]: message sent to deallocated instance, i have attached my sample code as well. - (IBAction)uploadImage { NSString *urlString = @"http://192.168.1.108/iphoneimages/uploadfile.php?userid=1&charid=23&msgid=3"; //if(FALSE) for (int i=0; i<[imgArray count]; i++) { // setting up the request object now NSMutableURLRequest *request = [[NSMutableURLRequest alloc] init]; [request setURL:[NSURL URLWithString:urlString]]; [request setHTTPMethod:@"POST"]; /* add some header info now we always need a boundary when we post a file also we need to set the content type You might want to generate a random boundary.. this is just the same as my output from wireshark on a valid html post */ NSString *boundary = [NSString stringWithString:@"---------------------------14737809831466499882746641449"]; NSString *contentType = [NSString stringWithFormat:@"multipart/form-data; boundary=%@",boundary]; [request addValue:contentType forHTTPHeaderField: @"Content-Type"]; /* now lets create the body of the post */ NSMutableData *body = [[NSMutableData data] autorelease]; NSString *str = [NSString stringWithFormat:@"Content-Disposition: form-data; name=\"userfile\"; filename=\"ipodfile%d.jpg\"\r\n",i]; [body appendData:[[NSString stringWithFormat:@"\r\n--%@\r\n",boundary] dataUsingEncoding:NSUTF8StringEncoding]]; [body appendData:[[NSString stringWithString:str] dataUsingEncoding:NSUTF8StringEncoding]]; [body appendData:[[NSString stringWithString:@"Content-Type: application/octet-stream\r\n\r\n"] dataUsingEncoding:NSUTF8StringEncoding]]; NSData *imageData = UIImageJPEGRepresentation([imgArray objectAtIndex:i], 90); [body appendData:[NSData dataWithData:imageData]]; [body appendData:[[NSString stringWithFormat:@"\r\n--%@--\r\n",boundary] dataUsingEncoding:NSUTF8StringEncoding]]; // setting the body of the post to the reqeust [request setHTTPBody:body]; // now lets make the connection to the web [NSURLConnection sendSynchronousRequest:request returningResponse:nil error:nil]; //NSString *returnString = [[NSString alloc] initWithData:returnData encoding:NSUTF8StringEncoding]; //NSLog(@"%@",returnString); [imageData release]; [request release]; //[body release]; } } It successfully upload the images to the folder and there is no any error in the execution but when it complete it process and try to go back it give error -[NSConcreteMutableData release]: message sent to deallocated instance Please help me out. Thanks

    Read the article

  • Fail to save a managed object to core-data after its properties were updated.

    - by Tzur Gazit
    I have to trouble to create the object, but updating it fails. Here is the creation code: // Save data from pList to core data fro the first time - (void) saveToCoreData:(NSDictionary *)plistDictionary { // Create system parameter entity SystemParameters *systemParametersEntity = (SystemParameters *)[NSEntityDescription insertNewObjectForEntityForName:@"SystemParameters" inManagedObjectContext:mManagedObjectContext]; //// // GPS SIMULATOR //// NSDictionary *GpsSimulator = [plistDictionary valueForKey:@"GpsSimulator"]; [systemParametersEntity setMGpsSimulatorEnabled:[[GpsSimulator objectForKey:@"Enabled"] boolValue]]; [systemParametersEntity setMGpsSimulatorFileName:[GpsSimulator valueForKey:@"FileName"]]; [systemParametersEntity setMGpsSimulatorPlaybackSpeed:[[GpsSimulator objectForKey:@"PlaybackSpeed"] intValue]]; [self saveAction]; } During execution the cached copy is changed and then it is saved (or trying) to the database. Here is the code to save the changed copy: // Save data from pList to core data fro the first time - (void) saveSystemParametersToCoreData:(SystemParameters *)theSystemParameters { // Step 1: Select Data NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"SystemParameters" inManagedObjectContext:mManagedObjectContext]; [fetchRequest setEntity:entity]; NSError *error = nil; NSArray *items = [self.managedObjectContext executeFetchRequest:fetchRequest error:&error]; [fetchRequest release]; if (error) { NSLog(@"CoreData: saveSystemParametersToCoreData: Unresolved error %@, %@", error, [error userInfo]); abort(); } // Step 2: Update Object SystemParameters *systemParameters = [items objectAtIndex:0]; //// // GPS SIMULATOR //// [systemParameters setMGpsSimulatorEnabled:[theSystemParameters mGpsSimulatorEnabled]]; [systemParameters setMGpsSimulatorFileName:[theSystemParameters mGpsSimulatorFileName]]; [systemParameters setMGpsSimulatorPlaybackSpeed:[theSystemParameters mGpsSimulatorPlaybackSpeed]]; // Step 3: Save Updates [self saveAction]; } As to can see, I fetch the object that I want to update, change its values and save. Here is the saving code: - (void)saveAction { NSError *error; if (![[self mManagedObjectContext] save:&error]) { NSLog(@"ERROR:saveAction. Unresolved Core Data Save error %@, %@", error, [error userInfo]); exit(-1); } } The Persistent store method: - (NSPersistentStoreCoordinator *)persistentStoreCoordinator { if (mPersistentStoreCoordinator != nil) { return mPersistentStoreCoordinator; } NSString *path = [self databasePath]; NSURL *storeUrl = [NSURL fileURLWithPath:path]; NSError *error = nil; mPersistentStoreCoordinator = [[NSPersistentStoreCoordinator alloc] initWithManagedObjectModel:[self managedObjectModel]]; if (![mPersistentStoreCoordinator addPersistentStoreWithType:NSSQLiteStoreType configuration:nil URL:storeUrl options:nil error:&error]) { NSLog(@"Unresolved error %@, %@", error, [error userInfo]); abort(); } return mPersistentStoreCoordinator; } There is no error but the sqLite file is not updated, hence the data is not persistent. Thanks in advance.

    Read the article

  • form inside tabview doesn't work

    - by user3536737
    i am working with jsf and primefaces , and here is what 've tried well i want to creat a tabview that get data from an arraylist in my bean i get for exemple 4 tabs , and inside each one i've created a hidden panel where i have a form with 2 input text to update informations , do i display the panel when i click on the second button Update , after that my panel is not hidden anymore , and i set the new values and click on the second button to update the informations , the problem is that the updating and the execution is working only for the first tab , it means when i try to update the new informations it works for the first one and for the other tabs it doesn't here is the code <p:tab title="#{rr.nom_ressource}"> <h:panelGrid> <h:graphicImage value="Ressources/images/emp.jpg" style="vertical-align:middle" /> <span style="font-size:15px; width:170px; display:inline-block;"> Nom : #{rr.nom_ressource} Type: #{rr.type_ressource} Specification: #{rr.experience} </span> <h:commandButton image="Ressources/images/delete.jpg" actionListener="#{SelectBean.act}" update=":form" style="vertical-align:middle" > Update </h:commandButton> <h:commandButton update=":outPanel" actionListener="#{SelectBean.mod1()}" image="Ressources/images/update.png" style="vertical-align:middle" > Modifier </h:commandButton> <h:form id="form111"> <p:growl id="growl" showDetail="true" sticky="true" /> <p:panel rendered ="#{SelectBean.bol}" closable="true" toggleable="true" id="outPanel" styleClass="outPanel" widgetVar="outpanel"> <h:outputLabel value="Nom " /> <h:inputText value="#{SelectBean.nom}" /> <br/> <h:outputLabel value="Experience " /> <h:inputText value="#{SelectBean.exp}" /> <br/> <h:commandButton value="Update" action="#{SelectBean.done}"/> </p:panel> </h:form> </h:panelGrid> </p:tab> for my managedbean the code is correct i think the problem is here

    Read the article

< Previous Page | 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015  | Next Page >