Search Results

Search found 40165 results on 1607 pages for 'function pointers'.

Page 1010/1607 | < Previous Page | 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017  | Next Page >

  • jQuery update Google Map

    - by Beardy
    I am trying to update a google map v3 with jQuery and at the moment it loads the map but when .preview is clicked the map scaled to the width and height and then goes grey. $('.preview').click(function(){ var width = $('#width').val(); var height = $('#height').val(); $('#map').css({ 'width':width, 'height':height }); var mapElement = document.getElementById('map'); var updateOptions = { zoom: 6 } var map = new google.maps.Map(mapElement, updateOptions); });

    Read the article

  • jQuery getting just added by ajax element

    - by Qiao
    $.post('includes/script.php', $(this).serialize(), function(data) { $('body').append(data); }); alert ($('#new').length) php script is <php echo "<div id="new">text</div>" ?> it alerts 0, so it can't see new div. How can you make it see new div?

    Read the article

  • GridView in ASP.NET 2.0

    - by Subho
    How can I populate an editable Grid with data from different tables from MSSQL Server'05 writing a code behind function??? I have used: Dim conn As New SqlConnection(conn_web) Dim objCmd As New SqlDataAdapter(sql, conn) Dim oDS As New DataSet objCmd.Fill(oDS, "TAB") Dim dt As DataTable = oDS.Tables(0) Dim rowCount As Integer = dt.Rows.Count Dim dr As DataRow = dt.NewRow() If rowCount = 0 Then e.DataSource = Nothing e.DataBind() e.Focus() Else e.DataSource = dt e.DataBind() End If

    Read the article

  • How can I extract parts of this filename in Perl?

    - by devtech
    In my Excel sheet with column Changeset I am getting the changeset like: C:\ccviews\hgdasdff-9302\dfcsz\ahgrt\kjhssl\ASGHLS@@\main\ajsdkljlat\hahdasdhfk\1\test.txt\sub\hsdaklfl\3 I need to use split function in a Perl script so that there will be two ouput (input as the above string) the part before @@ (e.g-here C:\ccviews\hgdasdff-9302\dfcsz\ahgrt\kjhssl\ASGHLS) the last character of the string (e.g-here 3)

    Read the article

  • javascript problem

    - by Gourav
    I have created a dynamic table whose rows gets appended by click of the "Add" button, i want the user not to be able to submit the page if no value is entered in all the rows of the table. how do i achieve this The code is <html> <head> <script type="text/javascript"> function addRowToTable() { var tbl = document.getElementById('tblSample'); var lastRow = tbl.rows.length; var iteration = lastRow+1; var row = tbl.insertRow(lastRow); var cellLeft = row.insertCell(0); var textNode = document.createTextNode(iteration); cellLeft.appendChild(textNode); var cellRight = row.insertCell(1); var el = document.createElement('input'); el.type = 'text'; el.name = 'txtRow' + iteration; el.id = 'txtRow' + iteration; el.size = 40; cellRight.appendChild(el); } function validation() { var a=document.getElementById('tblSample').rows.length; for(i=0;i<a;i++) { alert(document.getElementById('tblSample').txtRow[i].value);//this doesnt work } return true; } </script> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"> <title>Insert title here</title> </head> <body> <form name ='qqq' action="sample.html"> <p> <input type="button" value="Add" onclick="addRowToTable();" /> <input type="button" value="Submit" onclick="return validation();" /> </p> <p> <table border="1" id="tblSample"> <tr> <td>1</td> <td>The 1st row</td> </tr> </table> </p> </form> </body> </html> Please suggest

    Read the article

  • how to code client-side call to webservice that calls automatically every few seconds

    - by Bob Jones
    I have a webservice that I want to call from the browser every few seconds to see if there are any notification messages in the database that should be displayed on the screen. We have the JSON code working to display the messages in a JavaScript function after an Async Postback, but this only executes after a page turn. I want it to execute every 10-15 seconds as well. A code sample would be very helpful.

    Read the article

  • C# multiple asynchronous HttpRequest with one callback

    - by aepheus
    I want to make 10 asynchronous http requests at once and only process the results when all have completed and in a single callback function. I also do not want to block any threads using WaitAll (it is my understanding that WaitAll blocks until all are complete). I think I want to make a custom IAsyncResult which will handle multiple calls. Am I on the right track? Are there any good resources or examples out there that describe handling this?

    Read the article

  • Error in computed Field of select Query

    - by Shehzad Bilal
    This Query is giving me an error of #1054 - Unknown column 'totalamount' in 'where clause' SELECT (amount1 + amount2) as totalamount FROM `Donation` WHERE totalamount > 1000 I know i can resolve this error by using group by clause and replace my where condition with having clause. But is there any other solution beside using having clause. If group by is the only solution then I want to know why I have to use group by clause even I havent use any aggregate function thanks.

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • What is the Action returned by the subscribe parameter of IObservable.Create actually for?

    - by James Hay
    The method definition of IObservable.Create is: public static IObservable<TSource> Create<TSource>( Func<IObserver<TSource>, Action> subscribe ) I get that the function is called once the observable is subscribed to, where by I can then call OnNext, OnError and OnComplete on the observer. But why do I need to return an Action from the subscibe parameter and when will it actually be called?

    Read the article

  • Having issues with JQuery progress bar

    - by Roland
    I'm busy creating a poll but am experiencing issues creating a progress bar for a poll using jquery, thus I have a couple of options and then when the page loads the div tags should increase in width, but it's not doing anything only if I have on option in the poll code <?php foreach($votes as $v): ?> <div><?php echo $v['name'].':'; ?></div> <div> <?php echo 'Votes: '.$v['num'].' | '.$v['percent'].'%'; ?> </div> <script type="text/javascript"> load(<?=$v['name']?>,<?=$v['percent']?>); </script> <div style="width:100%; height:10px; background-color:#effdff;"><div id="<?=$v['name']?>" style=" height:10px; background-color:#ff0000;"></div></div> <br /> <?php endforeach; ?> <?php if(!empty($loginMsg)): ?> <?php echo $loginMsg; ?><br /> <?php endif; ?> Votes: <?php echo $totalVotes+$totalComments; ?> | Comments: <?php echo $totalComments ?> <script type="text/javascript"> var interval=''; var progress = 0; function load(id,val){ alert(id); if (interval=="") { interval=window.setInterval("display('"+id+"','"+val+"')",200); } } function display(id,val) { progress += 1; if(progress == val){ window.clearInterval(interval) interval = ''; progress = 0; } $("#"+id).css("width",progress+'%'); } </script>

    Read the article

  • how to know when a work in a thread is complete?

    - by seinkraft
    I need to create multiple threads when a button is clicked and i've done that with this: Dim myThread As New Threading.Thread(AddressOf getFile) myThread.IsBackground = True myThread.Start() but i need to update a picture box with the downloaded file, buy if i set an event in the function getFile and raise it to notify that the files was downloaded and then update the picturebox.

    Read the article

  • jquery fade element does not show elements styled 'visibility: hidden'

    - by kalpaitch
    I have a bunch of thumbnails which I am loading with a style of visibility: hidden; so that they all maintain their correct layouts. Once the page is fully loaded I have a jquery function that fades them in. This worked when their style was set to display: none; but obviously the layout screwed up then. Any suggestions? Heres the fade line: $('.littleme').fadeIn('slow');

    Read the article

  • I want to set the AutoCompleteMode property in ApplyCellStyleToEditingControl subroutine

    - by Ranjan Gupta
    Hi, I am creating a DataGridView Column. and it is working well. now I want to customise this column with AutoCompleteMode, and AutoCompleteSource properties to show the customised data. I made the properties for this columns, and these are also working well. but these properties are not working in the "ApplyCellStyleToEditingControl" subroutine. Please help me to use these column properties in the "ApplyCellStyleToEditingControl" subroutine. Public Class DataGridViewDataValueColumn Inherits DataGridViewColumn Dim m_AutoCompleteMode As AutoCompleteMode, _ m_AutoCompleteSource As AutoCompleteSource, _ m_AutoCompleteStringCollection As AutoCompleteStringCollection Public Sub New() MyBase.New(New DataValueCell()) End Sub Public Overrides Property CellTemplate() As DataGridViewCell Get Return MyBase.CellTemplate End Get Set(ByVal value As DataGridViewCell) ' Ensure that the cell used for the template is a DataValueCell. If (value IsNot Nothing) AndAlso _ Not value.GetType().IsAssignableFrom(GetType(DataValueCell)) _ Then Throw New InvalidCastException("Must be a DataValueCell") End If MyBase.CellTemplate = value End Set End Property Region "User Defined Properties" '&*--------------------------------------*&' <Description("Indicates the text completion behaviour of the combo box."), DefaultValue(AutoCompleteMode.None)> _ Public Property AutoCompleteMode() As AutoCompleteMode Get Return m_AutoCompleteMode End Get Set(ByVal value As AutoCompleteMode) m_AutoCompleteMode = value End Set End Property <Description("The source of complete strings used to automatic completion."), DefaultValue(AutoCompleteSource.None)> _ Public Property AutoCompleteSource() As AutoCompleteSource Get Return m_AutoCompleteSource End Get Set(ByVal value As AutoCompleteSource) m_AutoCompleteSource = value End Set End Property <Description("The autocomplete custom source.")> _ Public Property AutoCompleteCustomSource() As AutoCompleteStringCollection Get Return m_AutoCompleteStringCollection End Get Set(ByVal value As AutoCompleteStringCollection) m_AutoCompleteStringCollection = value End Set End Property End Region End Class '&*--------------------------------------*&' Class DataValueCell Inherits DataGridViewTextBoxCell Public Sub New() ' End Sub Public Overrides ReadOnly Property EditType As Type Get Return GetType(PCLDataGridViewTextBoxEditingControl) End Get End Property End Class '&*--------------------------------------*&' '&* Edit DataGridView Columns *&' '&*--------------------------------------*&' Class PCLDataGridViewTextBoxEditingControl Inherits DataGridViewTextBoxEditingControl Public Overrides Function EditingControlWantsInputKey(ByVal keyData As Keys, ByVal dataGridViewWantsInputKey As Boolean) As Boolean Select Case ((keyData And Keys.KeyCode)) Case Keys.Prior, Keys.Next, Keys.End, Keys.Home, Keys.Left, Keys.Up, Keys.Right, Keys.Down, Keys.Delete Return True End Select Return MyBase.EditingControlWantsInputKey(keyData, dataGridViewWantsInputKey) End Function Public Overrides Sub ApplyCellStyleToEditingControl(ByVal dataGridViewCellStyle As DataGridViewCellStyle) With DirectCast(Me, TextBox) '.AutoCompleteMode = DataGridViewDataValueColumn.AutoCompleteMode_Value '.AutoCompleteSource = DataGridViewDataValueColumn.AutoCompleteSource_Value '.AutoCompleteCustomSource = MyBase.AutoCompleteCustomSource End With End Sub End Class

    Read the article

  • How can I cast authoritatively in asp classic?

    - by Tchalvak
    In asp classic, the cint() function or procedure or whatever it is won't allow me to cast arbitrary strings, like "bob" or "null" or anything like that. Is there anything that will allow me to simply cast integers, numeric strings, and arbitrary strings to actual integers, with some sane default like 0 for strings?

    Read the article

  • problem with Double and Rational Number

    - by altair211
    Hi, I am writing a function in which I need to read a string contains floating point number and turn it back to Rational. But When I do toRational (read input :: Double), it will not turn for eg: 0.9 into 9 % 10 as expected, but instead 81..... % 9007... Thx

    Read the article

  • Actionscript - Adding EventListener to multiple buttons on stage

    - by Chev
    I have a little problem with adding EventListener to multiple objects on stage. I have above 40 buttons on stage named "Button01","Button02" .. "Button40", and i'm looking for easiest way to add EventListener to all of them. Creating something like Button01.addEventListener(MouseEvent.CLICK, doSomething) Button02.addEventListener(MouseEvent.CLICK, doSomething) .. Button40.addEventListener(MouseEvent.Click, doSomething) (Notice the same function). isn't solution i'm looking for :(. Thanks in advice.

    Read the article

  • how to unpack the contents of a javascript file?

    - by altvali
    Hi all! You know how those packed js files look like, right? eval(function(p,a,c,k,e,d){ ... } ('obfuscated-string'.split('|'),0,{})) It just so happens to be that i have to tweak some large legacy code that looks like that and i want to find a way to turn this into a more readable version. If that's not possible, can i at least get rid of the eval?

    Read the article

  • PHP 5.3: Late static binding doesn't work for properties when defined in parent class while missing in child class

    - by DavidPesta
    Take a look at this example, and notice the outputs indicated. <?php class Mommy { protected static $_data = "Mommy Data"; public static function init( $data ) { static::$_data = $data; } public static function showData() { echo static::$_data . "<br>"; } } class Brother extends Mommy { } class Sister extends Mommy { } Brother::init( "Brother Data" ); Sister::init( "Sister Data" ); Brother::showData(); // Outputs: Sister Data Sister::showData(); // Outputs: Sister Data ?> My understanding was that using the static keyword would refer to the child class, but apparently it magically applies to the parent class whenever it is missing from the child class. (This is kind of a dangerous behavior for PHP, more on that explained below.) I have the following two things in mind for why I want to do this: I don't want the redundancy of defining all of the properties in all of the child classes. I want properties to be defined as defaults in the parent class and I want the child class definition to be able to override these properties wherever needed. The child class needs to exclude properties whenever the defaults are intended, which is why I don't define the properties in the child classes in the above example. However, if we are wanting to override a property at runtime (via the init method), it will override it for the parent class! From that point forward, child classes initialized earlier (as in the case of Brother) unexpectedly change on you. Apparently this is a result of child classes not having their own copy of the static property whenever it isn't explicitly defined inside of the child class--but instead of throwing an error it switches behavior of static to access the parent. Therefore, is there some way that the parent class could dynamically create a property that belongs to the child class without it appearing inside of the child class definition? That way the child class could have its own copy of the static property and the static keyword can refer to it properly, and it can be written to take into account parent property defaults. Or is there some other solution, good, bad, or ugly?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017  | Next Page >