Search Results

Search found 37966 results on 1519 pages for 'string compare'.

Page 1017/1519 | < Previous Page | 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024  | Next Page >

  • Can this be improved? Scrubing of dangerous html tags.

    - by chobo2
    I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • Is there value in unit testing auto implemented properties

    - by ahsteele
    It seems exceptionally heavy handed but going by the rule anything publicly available should be tested should auto-implemented properties be tested? Customer Class public class Customer { public string EmailAddr { get; set; } } Tested by [TestClass] public class CustomerTests : TestClassBase { [TestMethod] public void CanSetCustomerEmailAddress() { //Arrange Customer customer = new Customer(); //Act customer.EmailAddr = "[email protected]"; //Assert Assert.AreEqual("[email protected]", customer.EmailAddr); } }

    Read the article

  • Read from a file into an array and stop if a ":" is found in ruby

    - by Minky
    Hi! How can I in Ruby read a string from a file into an array and only read and save in the array until I get a certain marker such as ":" and stop reading? Any help would be much appreciated =) For example: 10.199.198.10:111 test/testing/testing (EST-08532522) 10.199.198.12:111 test/testing/testing (EST-08532522) 10.199.198.13:111 test/testing/testing (EST-08532522) Should only read the following and be contained in the array: 10.199.198.10 10.199.198.12 10.199.198.13

    Read the article

  • how to change color of text following function in javascript

    - by OVERTONE
    Ok before i make spaghetti of this code i thought id ask around here. ive made a quiz for an online site. The answers are stored in an array, and ive a function that checks the answers array to what youve clicked. then it counts them and gives you your score. but i want to change the clor of the right answer wen the user clicks the score button. so the correct answers are highlighted. something like this https://www.shutterpoint.com/Home-Quiz.cfm (just hit submit at the bottom, no need to do the quiz). the little answer icon at the side looks flashy but id rather just have the text change color. heres how my questions are formatted <p>Depth of field is controlled by :?</p> <p id = "question2"><input type="radio" name="question2" id="Answer1" value = "a" onClick ="recordAnswer(2,this.value)"/> The focal length of the lens. <br/> <input type="radio" name="question2" id="Answer2" value = "b" onClick = "recordAnswer(2,this.value)"/> The size of the aperture opening. <br/> <input type="radio" name="question2" id="Answer3" value = "c" onClick = "recordAnswer(2,this.value)"/> The distance between the camera and lens. <br/> <input type="radio" name="question2" id="Answer4" value = "d" onClick = "recordAnswer(2,this.value)"/> All of these. <br/></p> and these are the two functions that are called throughout. record answer is called every time the user clicks a button function recordAnswer(question,answer) { answers[question-1] = answer; } this is the final button which calculates the score function scoreQuiz() { var totalCorrect = 0; for(var count = 0; count<correctAnswers.length;count++) { if(answers[count]== correctAnswers[count]) totalCorrect++; } <!-- alert("You scored " + totalCorrect + " out of 12 correct!"); --> } another function is best i think. ive already made attemots at it and know i have to set the color using document.getElementById('question2').style.color = '#0000ff'; question2 being the p id i think if i take in the value part of (input type....) ill be able to compare it to the answers array. but im not quite sure how to do this. any helpers? maybe something like this document.getElementById("Answer1").style.color = '#0000ff'; using the id part of the (input type line) i think i got it actually. ill post my answer in a sec

    Read the article

  • Exporting classes containing std:: objects (vector, map, etc) from a dll

    - by RnR
    I'm trying to export classes from a DLL that contain objects such as std::vectors and std::stings - the whole class is declared as dll export through: class DLL_EXPORT FontManager { The problem is that for members of the complex types I get this warning: warning C4251: 'FontManager::m__fonts' : class 'std::map<_Kty,_Ty' needs to have dll-interface to be used by clients of class 'FontManager' with [ _Kty=std::string, _Ty=tFontInfoRef ] I'm able to remove some of the warnings by putting the following forward class declaration before them even though I'm not changing the type of the member variables themselves: template class DLL_EXPORT std::allocator<tCharGlyphProviderRef>; template class DLL_EXPORT std::vector<tCharGlyphProviderRef,std::allocator<tCharGlyphProviderRef> >; std::vector<tCharGlyphProviderRef> m_glyphProviders; Looks like the forward declaration "injects" the DLL_EXPORT for when the member is compiled but is it safe? Does it realy change anything when the client compiles this header and uses the std container on his side? Will it make all future uses of such a container DLL_EXPORT (and possibly not inline?)? And does it really solve the problem that the warning tries to warn about? Is this warning anything I should be worried about or would it be best to disable it in the scope of these constructs? The clients and the dll will always be built using the same set of libraries and compilers and those are header only classes... I'm using Visual Studio 2003 with the standard STD library. ---- Update ---- I'd like to target you more though as I see the answers are general and here we're talking about std containers and types (such as std::string) - maybe the question really is: Can we disable the warning for standard containers and types available to both the client and the dll through the same library headers and treat them just as we'd treat an int or any other built-in type? (It does seem to work correctly on my side.) If so would should be the conditions under which we can do this? Or should maybe using such containers be prohibited or at least ultra care taken to make sure no assignment operators, copy constructors etc will get inlined into the dll client? In general I'd like to know if you feel designing a dll interface having such objects (and for example using them to return stuff to the client as return value types) is a good idea or not and why - I'd like to have a "high level" interface to this functionality... maybe the best solution is what Neil Butterworth suggested - creating a static library?

    Read the article

  • TouchCode XML parsing error

    - by itsaboutcode
    Hi, I have a xml document which has only one element in the document, which is <error>error string<error> But when i try to parse it, it says this document has no element at all. In other words when i try to access the rootElement it says "null" CXMLDocument *rssParser = [[[CXMLDocument alloc] initWithContentsOfURL:url options:0 error:nil] autorelease]; NSLog(@"Root: %@",[[rssParser rootElement] name]); Please tell me what is wroing with this. Thanks

    Read the article

  • Placeholder for UITextView

    - by Gill Bates
    Anyone ever implements something in UITextView that stopping it from receiving future inputs when the text length is smaller than certain threshold? I plan to implement a textview like we have in the mail composer interface. We have a placeholder "Subject" there, and the cursor starts after. Placeholder in UITextView Inspired from this question, I wonder if there are some methods which could be used to stop changing the text in the UITextView once the cursor is moving back to the placeholder string. Any ideas?

    Read the article

  • Java - Make an object collection friendly

    - by DutrowLLC
    If an object holds a unique primary key, what interfaces does it need to implement in order to be collection friendly especially in terms of being efficiently sortable, hashable, etc...? If the primary key is a string, how are these interfaces best implemented? Thanks!

    Read the article

  • Requested Service not found

    - by mathirengasamy
    I have an windows service application with which works on remoting.That is used to display the ballontip. sometime it displays this error... Exception :Requested Service not foundInner Exception : Stack Trace : Server stack trace: at System.Runtime.Remoting.Channels.BinaryServerFormatterSink.ProcessMessage(IServerChannelSinkStack sinkStack, IMessage requestMsg, ITransportHeaders requestHeaders, Stream requestStream, IMessage& responseMsg, ITransportHeaders& responseHeaders, Stream& responseStream) Exception rethrown at [0]: at System.Runtime.Remoting.Proxies.RealProxy.HandleReturnMessage(IMessage reqMsg, IMessage retMsg) at System.Runtime.Remoting.Proxies.RealProxy.PrivateInvoke(MessageData& msgData, Int32 type) at Baloontip.clsBaloonTool.Messagebox(String Message) anybody help me..thanks in advance

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • How to configure SVN access list for directory/repository ?

    - by abatishchev
    I have next SVN repositories structure running Apache 2.2 under Windows Server 2008: http://example.com/svn/ is targeted to e:\svn (root) http://example.com/svn/dir/ is targeted to e:\svn\dir (some directory with a number of repositories) http://example.com/svn/dir/repo/ is targeted to e:\svn\dir\repo (a repository itself) How to access list so group @foo had rw access to repo? I have next access list: [groups] @foo = user1, user2 [/] * = r [dir/repo:/] @foo = rw The last string doesn't work in any combination I tried

    Read the article

  • Where to put the application ID in YQL

    - by earlyriser
    I'm trying to read an xml response from YQL: $url = 'http://query.yahooapis.com/v1/public/yql?q=select%20*%20from%20geo.places%20where%20woeid%3D%22'.$woeid.'%22'; if (!$xml=simplexml_load_file($url) ) { //DO STUFF } This code works. Now i'm trying to put my application ID in the url string but I don't know how it should be done. Thanks.

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

  • Releasing the keyboard stops shake events. Why?

    - by Moshe
    1) How do I make a UITextField resign the keyboard and hide it? The keyboard is in a dynamically created subview whose superview looks for shake events. Resigning first responder seems to break the shake event handler. 2) how do you make the view holding the keyboard transparent, like see through glass? I have seen this done before. This part has been taken care of thanks guys. As always, code samples are appreciated. I've added my own to help explain the problem. EDIT: Basically, - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event; gets called in my main view controller to handle shaking. When a user taps on the "edit" icon (a pen, in the bottom of the screen - not the traditional UINavigationBar edit button), the main view adds a subview to itself and animates it on to the screen using a custom animation. This subview contains a UINavigationController which holds a UITableView. The UITableView, when a cell is tapped on, loads a subview into itself. This second subview is the culprit. For some reason, a UITextField in this second subview is causing problems. When a user taps on the view, the main view will not respond to shakes unless the UITextField is active (in editing mode?). Additional info: My Motion Event Handler: - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event { NSLog(@"%@", [event description]); SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"shake" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); [self genRandom:TRUE]; } The genRandom: Method: /* Generate random label and apply it */ -(void)genRandom:(BOOL)deviceWasShaken{ if(deviceWasShaken == TRUE){ decisionText.text = [NSString stringWithFormat: (@"%@", [shakeReplies objectAtIndex:(arc4random() % [shakeReplies count])])]; }else{ SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"string" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); decisionText.text = [NSString stringWithFormat: (@"%@", [pokeReplies objectAtIndex:(arc4random() % [pokeReplies count])])]; } } shakeReplies and pokeReplies are both NSArrays of strings. One is used for when a certain part of the screen is poked and one is for when the device is shaken. The app will randomly choose a string from the NSArray and display onscreen. For those of you who work graphically, here is a diagram of the view hierarchy: Root View -> UINavigationController -> UITableView -> Edit View -> Problem UITextfield

    Read the article

  • Multiple REPLACE function in Oracle

    - by Adnan
    I am using the REPLACE function in oracle to replace values in my string like; SELECT REPLACE('THE NEW VALUE IS #VAL1#','#VAL1#','55') from dual So this is OK to replace one value, but what about 20+, should I use 20+ REPLACE function or is there a more practical solution. All ideas are welcome.

    Read the article

  • What's the difference between these two calls to a function taking a collection of structural types?

    - by James Moore
    Why does the call to fn(Iterator("foo") compile, but the call to fn(fooIterator) fail with an error "type mismatch; found : Iterator[java.lang.String] required: scala.Iterator[com.banshee.Qx.HasLength]" object Qx { type HasLength = {def length: Int} def fn(xs: Iterator[HasLength]) = 3 var tn = fn(Iterator("foo")) var fooIterator = Iterator("foo") var tnFails = fn(fooIterator) //doesn't compile } Aren't they the same thing?

    Read the article

  • Asp.Net(C#) inline coding problem

    - by oraclee
    Hi all; <% int i = Eval("NAME").ToString().IndexOf("."); string str = Eval("NAME").ToString().Substring(i + 1); %> <img src="../images/img_<%= str %>.gif" alt="" /> EVAL("test.txt") I need "txt" how to make ? Please Help Thank you

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Lisp's "some" in Python?

    - by Mark Probst
    I have a list of strings and a list of filters (which are also strings, to be interpreted as regular expressions). I want a list of all the elements in my string list that are accepted by at least one of the filters. Ideally, I'd write [s for s in strings if some (lambda f: re.match (f, s), filters)] where some is defined as def some (pred, list): for x in list: res = pred (x) if res: return res return False Is something like that already available in Python, or is there a more idiomatic way to do this?

    Read the article

  • passing nsdata in stringwithformat

    - by milanjansari
    hello, How to pass nsdata in below of the string NSData *myData = [NSData dataWithContentsOfFile:pathDoc]; pathDoc = [NSString stringWithFormat:@"<size>%d</size><type>%d</type><cdate>%@</cdate><file>%c</file><fname>File</fname>",fileSizeVal,filetype,creationDate,file]; Any idea about this? Thanks you, Milan

    Read the article

  • parse part of the text from regex pattern

    - by dalco
    I have a string: [\n['-','some text what\rcontains\nnewlines'],\n\n trying to parse: Regex.Split(@"[\n['-','some text what contains newlines'],\n\n", @"\[\n\['(.*)','(.*)'],.*"); but the split return array seems to be null i need to get part of text: "some text what contains newlines"

    Read the article

< Previous Page | 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024  | Next Page >