Search Results

Search found 5968 results on 239 pages for 'generator expression'.

Page 102/239 | < Previous Page | 98 99 100 101 102 103 104 105 106 107 108 109  | Next Page >

  • How to replace all the blanks within square brackets with an underscore using sed?

    - by Ringerrr
    I figured out that in order to turn [some name] into [some_name] I need to use the following expression: s/\(\[[^ ]*\) /\1_/ i.e. create a backreference capture for anything that starts with a literal '[' that contains any number of non space characters, followed by a space, to be replaced with the non space characters followed by an underscore. What I don't know yet though is how to alter this expression so it works for ALL underscores within the braces e.g. [a few words] into [a_few_words]. I sense that I'm close, but am just missing a chunk of knowledge that will unlock the key to making this thing work an infinite number of times within the constraints of the first set of []s contained in a line (of SQL Server DDL in this case). Any suggestions gratefully received....

    Read the article

  • Access is refusing to run an query with linked table?

    - by Mahmoud
    Hey all i have 3 tables each as follow cash_credit Bank_Name-------in_date-------Com_Id---Amount America Bank 15/05/2010 1 200 HSBC 17/05/2010 3 500 Cheque_credit Bank_Name-----Cheque_Number-----in_date-------Com_Id---Amount America Bank 74835435-5435 15/05/2010 2 600 HSBC 41415454-2851 17/05/2010 5 100 Companies com_id----Com_Name 1 Ebay 2 Google 3 Facebook 4 Amazon Companies table is a linked table when i tried to create an query as follow SELECT cash_credit.Amount, Companies.Com_Name, cheque_credit.Amount FROM cheque_credit INNER JOIN (cash_credit INNER JOIN Companies ON cash_credit.com_id = Companies.com_id) ON cheque_credit.com_id = Companies.com_id; I get an error saying that my inner Join is incorrectly, this query was created using Access 2007 query design the error is Type mismatch in expression then i thought it might be the inner join so i tried Left Join and i get an error that this method is not used JOIN expression is not supported I am confused on where is the problem that is causing all this

    Read the article

  • Problem using Conditional Operation with Nullable Int

    - by Rajarshi
    A small problem. Any idea guys why this does not work? int? nullableIntVal = (this.Policy == null) ? null : 1; I am trying to return 'null' if the left hand expression is True, else 1. Seems simple but gives compilation error - Type of conditional expression cannot be determined because there is no implicit conversion between 'null' and 'int' If I replace the " ? null : 1 " with any valid int, then there is no problem.

    Read the article

  • Haskell: Why is it saying my function type is off?

    - by linkmaster03
    I wrote a little Haskell program to find the area of a triangle, primarily to practice custom types, but it keeps throwing the following error on compile: areafinder.hs:7:4: Couldn't match expected type 'Triangle' against inferred type 'm b' In a stmt of a 'do' expression: putStr "Base: " In the expression: do { putStr "Base: "; baseStr I'm not sure where 'm b' comes from, so I'm at a loss here. Why is it throwing this error, and what can I do to fix it? Here is my code: module Main where data Triangle = Triangle Double Double -- base, height getTriangle :: Triangle getTriangle = do putStr "Base: " baseStr Double calcTriangle (Triangle base height) = base * height main = putStrLn ("Area = " ++ show (calcTriangle getTriangle)) Thanks. :)

    Read the article

  • How to generate random strings that match a given regexp?

    - by Pies
    Duplicate: Random string that matches a regexp No, it isn't. I'm looking for an easy and universal method, one that I could actually implement. That's far more difficult than randomly generating passwords. I want to create an application that takes a regular expression, and shows 10 randomly generated strings that match that expression. It's supposed to help people better understand their regexps, and to decide i.e. if they're secure enough for validation purposes. Does anyone know of an easy way to do that? One obvious solution would be to write (or steal) a regexp parser, but that seems really over my head. I repeat, I'm looking for an easy and universal way to do that. Edit: Brute force approach is out of the question. Assuming the random strings would just be [a-z0-9]{10} and 1 million iterations per second, it would take 65 years to iterate trough the space of all 10-char strings.

    Read the article

  • How do you add < or > to a summary tag in Visual studio?

    - by Tony
    How do you add < (less than) or (greater than) to a summary comment in visual studio? I am in Visual Studio 2008. I have a generic method: public bool IsMemberProtected<T>(Expression<Func<T, object>> expression) Would love to have a summary tag of something like this /// <summary> /// Determines whether a member is protected. /// /// Usage: IsMemberProtected<ExampleType>(x => x.Member) /// </summary> But when I do that, the tooltip for the property no longer works when a developer hovers over the method in code to view the summary tag. Thoughts?

    Read the article

  • RegularExpressionValidator always fails, but ValidationExpression works in testing

    - by Jerph
    I found the answer to this, but it's a bit of a gotcha so I wanted to share it here. I have a regular expression that validates passwords. They should be 7 to 60 characters with at least one numeric and one alpha character. Pretty standard. I used positive lookaheads (the (?= operator) to implement it: (?=^.{7,60}$)(?=.*[0-9].*)(?=.*[a-zA-Z].*) I checked this expression in my unit tests using Regex.IsMatch(), and it worked fine. However, when I use it in a RegularExpressionValidator, it always fails. Why?

    Read the article

  • negative look ahead to exclude html tags

    - by Remoh
    I'm trying to come up with a validation expression to prevent users from entering html or javascript tags into a comment box on a web page. The following works fine for a single line of text: ^(?!.(<|)).$ ..but it won't allow any newline characters because of the dot(.). If I go with something like this: ^(?!.(<|))(.|\s)$ it will allow multiple lines but the expression only matches '<' and '' on the first line. I need it to match any line. This works fine: ^[-_\s\d\w"'.,:;#/&\$\%\?!@+*\()]{0,4000}$ but it's ugly and I'm concerned that it's going to break for some users because it's a multi-lingual application. Any ideas? Thanks!

    Read the article

  • How to choose programaticaly the column to be querried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to querry the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); the myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq querries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to querry. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • preg_replace or regex string translation

    - by ccolon
    I found some partial help but cannot seem to fully accomplish what I need. I need to be able to do the following: I need an regular expression to replace any 1 to 3 character words between two words that are longer than 3 characters with a match any expression: For example: walk to the beach == walk(.*)beach If the 1 to 3 character word is not preceded by a word that's longer than 3 characters then I want to translate that 1 to 3 letter word to ' ?' For example: on the beach == on ?the ?beach The simpler the rule the better (of course, if there's an alternative more complicated version that's more performant then I'll take that as well as I eventually anticipate heavy usage eventually). This will be used in a PHP context most likely with preg_replace. Thus, if you can put it in that context then even better!

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • antlr: How to rewrite only specific

    - by user1293945
    I am sure antlr can solve my problem, but can't figure out how to implement it, even high level. I rapidly got caught into syntax problems of antlr itself. My grammar is quite simple and made of following tokens and rules. Don't really need to go in their details here. The evaluator resolves to expressions, which finally resolve to IDENT: evaluator : expression EOF! ; ... ... term : PARTICIPANT_TYPE(IDENT | '('! expression ')'! | max | min | if_ | NUMBER)+ ; Now, I would like to analyse and rewrite the 'term', so that IDENT tokens (and them only) get re-written with the PARTICIPANT_TYPE. All the others should simply remain the same.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • How to create a NSPredicate to find entries with leading numerical value?

    - by Toastor
    Hello, I'm using NSPredicates to fetch entities based on a name attribute. Creating a predicate for names beginning with letters was easy (@"name BEGINSWITH %@", searchLetter), however now I'd like to fetch all entities with a name that begins with a numerical value, or rather a non-alphabetical number. What would be the appropriate predicate expression here? Right now I don't want to get too deep into predicate programming, as this is all I need right now and time flies. So, please, don't point me to the Predicate Programming Guide, I just need that expression.. :) Thanks alot guys!

    Read the article

< Previous Page | 98 99 100 101 102 103 104 105 106 107 108 109  | Next Page >