Search Results

Search found 3677 results on 148 pages for 'cs 79'.

Page 103/148 | < Previous Page | 99 100 101 102 103 104 105 106 107 108 109 110  | Next Page >

  • AppDomain assemblies not being loaded correctly.

    - by SharePoint Newbie
    Hi, We are doing the following in the Application_Start (Global.ascx.cs) for a WCF Service hosted by IIS 7.0 (integrated pipeline). var mapperConfigurations = AppDomain.CurrentDomain.GetAssemblies() .SelectMany(a => a.GetExportedTypes().Where(t => typeof (IMapperConfiguration).IsAssignableFrom(t) && t.IsClass)) .ToList(); The web-service has 8-10 assemblies in its bin folder and each of them have multiple implementations of IMapperConfiguration. After an IIS Reset, no mapper configurations are found (found this using debug.write). However, this behaviour is inconsistent and at other times all implementations of IMapperConfiguration are found. When exactly does IIS load assemblies and what is wrong with this code? Thanks

    Read the article

  • CruiseControl.NET, Visual Studio & SubVersion

    - by Ian
    Hi All, I am setting up a Continuous Integration server. I have one issue that doesn't seem to be mentioned in the tutorials. I have a ASP.net Web Application that I need to compile and them publish. My Problem is that I seem to be able to compile the app but when I attempt to use a buildPublisher this copies every thing including .svn files & folders and ms CS files. I am using an MSBuild task to compile my source. I tried setting my MSBuild Output Directory to directory but this didn't seem to have any effect. What am I not understanding? Thanks

    Read the article

  • Is there any Application Server Frameworks for other languages/platforms than JavaEE and .NET?

    - by Jonas
    I'm a CS student and has rare experience from the enterprise software industry. When I'm reading about enterprise software platforms, I mostly read about these two: Java Enterprise Edition, JavaEE .NET and Windows Communication Foundation By "enterprise software platforms" I mean frameworks and application servers with support for the same characteristics as J2EE and WCF has: [JavaEE] provide functionality to deploy fault-tolerant, distributed, multi-tier Java software, based largely on modular components running on an application server. WCF is designed in accordance with service oriented architecture principles to support distributed computing where services are consumed by consumers. Clients can consume multiple services and services can be consumed by multiple clients. Services are loosely coupled to each other. Is there any alternatives to these two "enterprise software platforms"? Isn't any other programming languages used in a bigger rate for this problem area? I.e Why isn't there any popular application servers for C++/Qt?

    Read the article

  • Passing derived objects in a constructure

    - by Clarence Klopfstein
    This is a bit of a convoluted question, hopefully I can make it clear. I am finding that this may not be possible, but am trying to see if anybody has a solution. I have four classes, two are core classes and two are those core classes extended: extUser Extends coreUser extSecurity Extends coreSecurity In the constructor for coreUser you have this: public coreUser(string id, ref coreSecurity cs) When trying to extend coreUser you would have this: public extUser(string id ref extSecurity es) : base(id, ref es) This fails because es is of type, extSecurity and the base class expects a type of coreSecurity. I've not found anyway to cast this to allow for me to override this base class in C#. In VB it works just fine. Ideas?

    Read the article

  • C++ Vector of pointers

    - by xbonez
    For my latest CS homework, I am required to create a class called Movie which holds title, director, year, rating, actors etc. Then, I am required to read a file which contains a list of this info and store it in a vector of pointers to Movies. I am not sure what the last line means. Does it mean, I read the file, create multiple Movie objects. Then make a vector of pointers where each element (pointer) points to one of those Movie objects? Do I just make two vectors - one of pointers and one of Movies and make a one-to-one mapping of the two vectors?

    Read the article

  • issue with c# xml documentation

    - by galford13x
    I have the following comment. /// <summary> /// MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/> /// </summary> /// <returns>MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/></returns> but I'm not sure why I receive the following warning Warning 7 XML comment on 'MSLab.DateTime.SystemTimeProvider.GetTimeFormat()' has cref attribute 'DateTime.ParseExact(string, string, IFormatProvider)' that could not be resolved F:\My Documents\Visual Studio 2010\Projects\MSLab\trunk\MSLab\MSLab\DateTime\SystemTimeProvider.cs 110 57 MSLab

    Read the article

  • Paging with jQuery

    - by zurna
    I get data from another page using jQuery get method. But I have a small problem. Sometimes, data that I take from another page is too long so it's divided into pages. When the user clicks on 1, 2, 3, ... links he/she is redirected to the other page. However, I want data to be reloaded on the same page. Edit $('ul.thumbs li.pagination a').live('click', function() { var pageNumber = parseInt($(this).text().replace(/[^0-9]/g, '')); $.ajax({ type: "GET", url: "images.cs.asp?Process=ViewImages&PAGEID=<%=Request.QueryString("PAGEID")%>", success: function(data) { $("#ViewImages").html(data); }, error: function (XMLHttpRequest, textStatus, errorThrown) { $("#ViewImages").html('.'); } }); return false; });

    Read the article

  • How is the implicit segment register of a near pointer determined?

    - by Daniel Trebbien
    In section 4.3 of Intel 64® and IA-32 Architectures Software Developer's Manual. Volume 1: Basic Architecture, it says: A near pointer is a 32-bit offset ... within a segment. Near pointers are used for all memory references in a flat memory model or for references in a segmented model where the identity of the segment being accessed is implied. This leads me to wondering: how is the implied segment register determined? I know that (%eip) and displaced (%eip) (e.g. -4(%eip)) addresses use %cs by default, and that (%esp) and displaced (%esp) addresses use %ss, but what about (%eax), (%edx), (%edi), (%ebp) etc., and can the implicit segment register depend also on the instruction that the memory address operand appears in?

    Read the article

  • How does the dataset determine the return type of a scalar query?

    - by Tobias Funke
    I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

    Read the article

  • How to set ItemsSource?

    - by Mark
    This dialog makes no sense to me And I'm having trouble finding good tutorials on it. Most of the examples aren't detailed enough, or do stuff via code, but I'd like to take advantage of the IDE as much as possible. Whats the difference between ItemsSource and DataContext? I'd like to bind it to just a List for starters. I don't need SQL or databases or anything fancy. Where would I declare my list? In MainWindow.xaml.cs? How do I get it to appear in that dialog?

    Read the article

  • Programmatically Setting the Version of a Window's Service on the ProjectInstaller

    - by user302004
    I have a Windows Service created in Visual Studio 2005 in C#. I have a setup project and a ProjectInstaller class. I also have code to programmatically get the version from the AssemblyFileVersionAttribute. I need to figure out where I set the version that I've obtained (and where this code should go). I tried placing it in the InitializeComponent method on ProjectInstaller.Designer.cs and then appending the version to serviceInstaller1.DisplayName and serviceInstaller1.ServiceName. This didn't work and you're not supposed to modify the contents of this method. Any ideas?

    Read the article

  • Text property in a UserControl in C#

    - by yeyeyerman
    I have a control with a inner TextBox. I want to make a direct relationship between the Text property of the UserControl and the Text property of the TextBox. The first thing I realized is that Text was not being displayed in the Properties of the UserControl. Then I added the Browsable(true) attribute. [Browsable(true)] public override string Text { get { return m_textBox.Text; } set { m_textBox.Text = value; } } Now, the text will be shown for a while, but then is deleted. This is because the information is not written within the xxxx.Designer.cs. How can this behviour be changed?

    Read the article

  • Clear the form once form submitted

    - by zurna
    Once the form submitted, response from another page is printed to #GameStorySys. But values entered to the form still stays there. Is it possible for the form values to disappear (but the form should still stay) once the form submitted? $("[name='GameStoryForm']").click(function() { $.ajax({ type: "POST", data: $("#GameStoryForm").serialize(), url: "content/commentary/index.cs.asp?Process=EditLiveCommentaryStory&CommentaryID=<%=Request.QueryString("CommentaryID")%>", success: function(output) { $('#GameStorySys').html(output); }, error: function(output) { $('#GameStorySys').html(output); } }); });

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How does the dataset designer determine the return type of a scalar query?

    - by Tobias Funke
    I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

    Read the article

  • C++ Questions about vectors

    - by xbonez
    Hey guys, I have a CS exam tomorrow. Just want to get a few questions cleared up. Thanks a lot, and I really appreciate the help. Que 1. What are parallel vectors? Vectors of the same length that contain data that is meant to be processed together Vectors that are all of the same data type Vectors that are of the same length Any vector of data type parallel Que 2. Arrays are faster and more efficient than vectors. True False Que 3. Arrays can be a return type of a function call. True False Que 4. Vectors can be a return type of a function call. True False

    Read the article

  • How to Use a Windows App with Embeded files and folders to copy to a destination. In C#

    - by Mark Sweetman
    I am trying to write a small application, whose only purpose is to copy some folders and .cs source files into a user specified Directory, I can do it easy enough by simply having the application look for the files and folders in its own install directory then copy them to thier destination Directory, but I was wondering if its possible to Embed the Folders and Files into the Application, so that when you run the application it creates or copies the folders and files from the exe app directly to the install directory, rather than searching for them in the apps install directory then copying them over. Basically Im trying to only have a single exe file rather than having an exe file and a bunch of folders and files along side it. Is this possible to do with just a Windows Form App without using an actual Installer Class?

    Read the article

  • Example applications and benefits of using "C" , "C++" or "Java"

    - by Waltzy
    Ok, I'm revising for my upcoming year 2 exams on a CS course and its likely something like this will come up. my question is what is an ideal application that would especially benefit from the program features of each of the three languages? I have a vague idea but getting a second opinion could really help. JavaPortability, easy - good for GUIs. C++Fast but may requite significant changes in order to be moved from system to system, good for image processing. CI'm unsure here small embedded applications? Some clarification on this would be really appreciated, thanks again StackOverflow

    Read the article

  • Catching / Redirecting 404's (ASP.NET)

    - by maxp
    Ive noticed that when I request a page in ASP.NET (webforms) that does not exist, the 'StaticFile' handler deals with the error notification. Id like to be a bit more helpful in these situations. What is the correct way for me to intercept this 404, and as a result, run some code to redirect the user? Two ways Ive thought of doing which I currently don't really like are: 1 - Create a module that basically does a if (!file.exists($url){redirect to $correctedurl}) 2 - Modify the error.aspx.cs(or the default error page) to do something similar (yuck!)

    Read the article

  • Changing careers to Software Engineering.... Wise?

    - by Phil
    Hello everyone, I notice this site has a wealth of software professionals and I am investigating a career change to Software Engineering: *Particularly, I would like to know how likely one would be able to work from home or another country over the internet. Is this something that can be done and what does it usually entail? (time?,experience?, specific companies?, etc) *Currently, I am a teacher but always had a passion for tech. I am interested in a MS - Software Engineering program designed for individuals based from another field. Is this a wise degree to obtain? Would I be just wasting my time and money obtaining this degree? (I'm suspicious about this program and the feasibility of obtaining employment without a healthy CS background) Thanks for any assistance you can provide!

    Read the article

  • Should I use C(99) booleans ? ( also c++ booleans in c++ ?)

    - by Roman A. Taycher
    I haven't done much c programming but when I do when I need a false I put 0 when I want true I put 1, (ex. while(1)), in other cases I use things like "while(ptr)" or "if(x)". Should I try using C99 booleans, should I recommend them to others if I'm helping people new to programming learn c basics(thinking of cs 1?? students)? I'm pretty sure the Visual Studio compiler supports c99 bools, but do a lot of projects (open source and c apps in industry) compile for c89? If I don't use C bools should I at least do something like #define TRUE 1 #define FALSE 0? Also what about c++ Booleans (for c++)?

    Read the article

  • Did anybody use the constream (constrea.h) lib?

    - by user337938
    Two years ago, I used the conio.h (actually conio2.h for Dev-C++) to create a console form interface. Now I want to make the same thing, but C++ std lib does not provide the needed functions and I don't want to use the old C conio lib. I found some websites which highlights the constream lib, but I have no idea to use it on VS! I tried just copying the header file into my project, but VS show several erros. I believe I am doing something wrong. ps: i got this file: ftp://ftp.cs.technion.ac.il/pub/misc/baram/TC31/INCLUDE/CONSTREA.H

    Read the article

  • Error message regarding IEnumerable.GetEnumerator().

    - by Bon_chan
    I get this error message and I can't figure out why! Error 1 'Exo5Chap12.ShortCollection<T>' does not implement interface member 'System.Collections.IEnumerable.GetEnumerator()'. 'Exo5Chap12.ShortCollection<T>.GetEnumerator()' cannot implement 'System.Collections.IEnumerable.GetEnumerator()' because it does not have the matching return type of 'System.Collections.IEnumerator'. E:\MyFolders\Dev\c#\Chapter12\Exo5Chap12\Exo5Chap12\exo5.cs 9 18 Exo5Chap12 Here is the code with an implementation of GetEnumerator(). What is wrong? public class ShortCollection<T> : IList<T> { protected Collection<T> innerCollection; protected int maxSize = 10; public IEnumerator<T> GetEnumerator() { return (innerCollection as IEnumerator<T>).GetEnumerator(); } }

    Read the article

  • IEnumerable<SelectListItem> error question

    - by user281180
    I have the following code, but i`m having error of Error 6 foreach statement cannot operate on variables of type 'int' because 'int' does not contain a public definition for 'GetEnumerator' C:\Dev\DEV\Code\MvcUI\Models\MappingModel.cs 100 13 MvcUI How can I solve this? Note: string [] projectID; Class Employee { int id {get; set;} string Name {get;set;} } public IEnumerable<SelectListItem> GetStudents() { List<SelectListItem> result = new List<SelectListItem>(); foreach (var id in Convert.ToInt32(projectID)) { foreach( Employee emp in Project.Load(id)) result.Add(new SelectListItem { Selected = false, Text = emp.ID.ToString(), Value = emp.Name }); return result.AsEnumerable(); } }

    Read the article

  • Hilighting div tag in Masterpage on redirection to content page

    - by user1713632
    I have a link in Master page within a div tag. I want to highlight the div when I am clicking the link, in order to redirect to some content page. I have written the following code: <li> <div id="div_test" runat="server"> <asp:LinkButton ID="lnk_test_menu" Font-Underline="false" ForeColor="Black" runat="server" Text="Test Link" CausesValidation="false" onclick="lnk_test_menu_Click1" > </asp:LinkButton></div> </li> Code in the cs page: protected void lnk_test_menu_Click1(object sender, EventArgs e) { div_test.Attributes.Add("class", "testSelected"); Response.Redirect(Test.aspx"); } The div in the master page is not being selected on redirection. Could anybody help me on this?

    Read the article

< Previous Page | 99 100 101 102 103 104 105 106 107 108 109 110  | Next Page >