Search Results

Search found 3646 results on 146 pages for 'escape sequence'.

Page 107/146 | < Previous Page | 103 104 105 106 107 108 109 110 111 112 113 114  | Next Page >

  • Codeignitor Global Array Declaration

    - by Ajith
    I have a sequence of number like follows 1 - 25, 2 - 60, 3 - 80, 4 - 100 and so on which means that if input is 1 output will be 25 and so on...I need to store it in global array.I would like to use it in multiple pages also.In codeigniter where i can declare a global array and store all these? I am trying like as follows in constants.php $CONFIDENCEVALUE = array(); $CONFIDENCEVALUE[] = array('1'=>25,'2'=>'60','3'=>80,'4'=>100); If it is correct how can access these array value in required pages.Help me please.I am not an expert with codeignitor.Thanks

    Read the article

  • Error occurs while using SPADE method in R

    - by Yuwon Lee
    I'm currently mining sequence patterns using SPADE algorithm in R. SPADE is included in "arulesSequence" package of R. I'm running R on my CentOS 6.3 64bit. For an exercise, I've tried an example presented in http://en.wikibooks.org/wiki/Data_Mining_Algorithms_In_R/Sequence_Mining/SPADE When I tried to do "cspade(x, parameter = list(support = 0.4), control = list(verbose = TRUE))" R says: parameter specification: support : 0.4 maxsize : 10 maxlen : 10 algorithmic control: bfstype : FALSE verbose : TRUE summary : FALSE preprocessing ... 1 partition(s), 0 MB [0.096s] mining transactions ... 0 MB [0.066s] reading sequences ...Error in asMethod(object) : 's' is not an integer vector When I try to run SPADE on my Window 7 32bit, it runs well without any error. Does anybody know why such errors occur?

    Read the article

  • How to transfer large file (File size > Heap Size) over the network?

    - by neo
    How to transfer large file (File size Heap/RAM Size) over the network ? Lets say I have file (size 10GB) I want to transfer it machine a (RAM 512mb) to machine b (RAM 512mb). Want achieve this using java code. First, is it possible ? Any recommendation on framework. If possible, can we speed this up using threading ? Important criteria: file's data sequence needs to be maintained during transfer. Any example will be great help.

    Read the article

  • sequencing function calls in javascript - are callbacks the only way?

    - by tim
    I read through various threads like this one for example. But it really escapes me how to accomplish the following: I have 4 functions, and want them happen one after another in sequence. Notice they are in incorrect order, to get my point across. I want the result that will output "1, 2, 3, 4' function firstFunction(){ // some very time consuming asynchronous code... console.log('1'); } function thirdFunction(){ // definitely dont wanna do this until secondFunction is finished console.log('3'); } function secondFunction(){ // waits for firstFunction to be completed console.log('2'); } function fourthFunction(){ // last function, not executed until the other 3 are done. console.log('4'); } I tried to figure out callbacks but am getting lost :( Isn't there some simple way to do this? Like looping through an array...

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to change the text int JLabel under the while or for loop?

    - by guilgamos
    I want to create a simple clock by using java. The code is very simply that i will give an example shown below for(int i=0;i<=60;i++) jLabel11.setText( Integer.toString(i) ); The problem is while I'm running my program the result didn't show the update in sequence. I mean it show only 60 digit immediately. It didn't show the change from 1 to 2 to 3 ... something like this. How can i fix this problem. Thank you in advance.

    Read the article

  • SQL Full Outer Join

    - by Torment March
    I have a table named 'Logs' with the following values : CheckDate CheckType CheckTime ------------------------------------------- 2011-11-25 IN 14:40:00 2011-11-25 OUT 14:45:00 2011-11-25 IN 14:50:00 2011-11-25 OUT 14:55:00 2011-11-25 IN 15:00:00 2011-11-25 OUT 15:05:00 2011-11-25 IN 15:15:00 2011-11-25 OUT 15:20:00 2011-11-25 IN 15:25:00 2011-11-25 OUT 15:30:00 2011-11-25 OUT 15:40:00 2011-11-25 IN 15:45:00 I want to use the previous table to produce a result of: CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 NULL 15:40:00 2011-11-25 15:45:00 NULL So far I have come up with this result set : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 15:45:00 NULL The problem is I cannot generate the log without CheckIns : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 NULL 15:40:00 The sequence of CheckIn - CheckOut pairing and order is in increasing time value.

    Read the article

  • Multiple Concurrent Changes Using SVN, GIT, and CVS

    - by KlaxSmashing
    At work, we are using SVN, CVS, and GIT because there any many projects that were started at various times. Anyway, a common sequence that occurs is as follows: Working on task A, making changes to project Has new task B, some bug or functionality needs to be done on project, independent of task A but may affect same set of files Check in task B Check in task A Unfortunately, what I do at this time is two maintain 2 working copies of each project. So I can always work on task B from a clean copy. As you can imagine, this is wasteful and also, does not scale well (task C, D, E, etc.) For each of these versioning systems, are there commands that can help me do the following: "Save" task A, reverting working copy to current repository Work on task B, check in changes "Restore" task A changes back to working copy

    Read the article

  • How to encode(represent) an ornament?

    - by Daniyar
    I would like to find a numeric representation of kazakh national ornaments for generating new ones. The ornaments essentially consist of combinations of relatively basic ornaments. Usually the ornaments are symmetrical. Here are few examples of basic elements: (The images are a bit distorted) And this is an example of a more complex ornament: How could I encode an ornament's representation in as few numbers as possible? So that I could write a program that would generate an ornament, given some sequence of numbers Any ideas are appreciated. As I write this, I have thought that generating images of snowlfakes may be somewhat relevant, although it's possibly just a fractal.

    Read the article

  • Faster way of initializing arrays in Delphi

    - by Max
    I'm trying to squeeze every bit of performance in my Delphi application and now I came to a procedure which works with dynamic arrays. The slowest line in it is SetLength(Result, Len); which is used to initialize the dynamic array. When I look at the code for the SetLength procedure I see that it is far from optimal. The call sequence is as follows: _DynArraySetLength - DynArraySetLength DynArraySetLength gets the array length (which is zero for initialization) and then uses ReallocMem which is also unnecessary for initilization. I was doing SetLength to initialize dynamic array all the time. Maybe I'm missing something? Is there a faster way to do this?

    Read the article

  • for (Object object : list) [java] construction

    - by EugeneP
    My question, is, whether the sequence of elements picked from a list will always be the same, is this construction behaviour is deterministic for java "List"s - descendants of java.util.List 2) question, if I use for(Object o: list) construction and inside the loop's body increment a variable, will it be the index of list's elements? So, how it goes through list's elements, from 0 to size()-1 or chaotically? List.get(i) will always return this element? 3) question ( I suppose for the 2-nd question the answer will be negative, so:) for (int i=0; i < list.size(); i++) { } is the best way if I need to save the index of an element and later get it back from a list by its id?

    Read the article

  • Clojure: find repetition

    - by demi
    Let we have a list of integers: 1, 2, 5, 13, 6, 5, 7 and I want to find the first number has a duplicate before it and return a vector of two indices, In my sample, it's 5 at [2, 5]. What I did so far is loop, but can I do it more elegant, short way? (defn get-cycle [xs] (loop [[x & xs_rest] xs, indices {}, i 0] (if (nil? x) [0 i] ; Sequence is over before we found a duplicate. (if-let [x_index (indices x)] [x_index i] (recur xs_rest (assoc indices x i) (inc i)))))) No need to return number itself, because I can get it by index and, second, it may be not always there.

    Read the article

  • dynamic memory allocation [closed]

    - by gcc
    i wanna write a program that creates (allocating memory) and manipulates (adding elements and increasing memory etc.) integer arrays dynamically according to given input sequences. input sequence which starts with the maximum number of arrays, includes integers to be put into arrays and some one letter characters which are commands to carry out some tasks (activating next array, deleting an array etc). also, i wanna create *c_arrays which is the address of the array whose elements are the actual capacities (How many integer slots are already allocated for an array?) of arrays how should i organize(set up) the algorithm?

    Read the article

  • How to apply Seq map function?

    - by netmatrix01
    Hello All, I been recently playing with F# . I was wondering instead of using a for loop to generate a sequence to element which are multiplied with every other element in the list how can I use a Seq map function or something similar to generate something like below. So for e.g. I have a list [1..10] I would like to apply a fun which generates a result something like [(1*1); (1*2);(1*3); (1*4); (1*5)......(2*1);(2*2);(2*3).....(3*1);(3*2)...] How can i achieve this ?. Many thanks for all you help.

    Read the article

  • A Taxonomy of Numerical Methods v1

    - by JoshReuben
    Numerical Analysis – When, What, (but not how) Once you understand the Math & know C++, Numerical Methods are basically blocks of iterative & conditional math code. I found the real trick was seeing the forest for the trees – knowing which method to use for which situation. Its pretty easy to get lost in the details – so I’ve tried to organize these methods in a way that I can quickly look this up. I’ve included links to detailed explanations and to C++ code examples. I’ve tried to classify Numerical methods in the following broad categories: Solving Systems of Linear Equations Solving Non-Linear Equations Iteratively Interpolation Curve Fitting Optimization Numerical Differentiation & Integration Solving ODEs Boundary Problems Solving EigenValue problems Enjoy – I did ! Solving Systems of Linear Equations Overview Solve sets of algebraic equations with x unknowns The set is commonly in matrix form Gauss-Jordan Elimination http://en.wikipedia.org/wiki/Gauss%E2%80%93Jordan_elimination C++: http://www.codekeep.net/snippets/623f1923-e03c-4636-8c92-c9dc7aa0d3c0.aspx Produces solution of the equations & the coefficient matrix Efficient, stable 2 steps: · Forward Elimination – matrix decomposition: reduce set to triangular form (0s below the diagonal) or row echelon form. If degenerate, then there is no solution · Backward Elimination –write the original matrix as the product of ints inverse matrix & its reduced row-echelon matrix à reduce set to row canonical form & use back-substitution to find the solution to the set Elementary ops for matrix decomposition: · Row multiplication · Row switching · Add multiples of rows to other rows Use pivoting to ensure rows are ordered for achieving triangular form LU Decomposition http://en.wikipedia.org/wiki/LU_decomposition C++: http://ganeshtiwaridotcomdotnp.blogspot.co.il/2009/12/c-c-code-lu-decomposition-for-solving.html Represent the matrix as a product of lower & upper triangular matrices A modified version of GJ Elimination Advantage – can easily apply forward & backward elimination to solve triangular matrices Techniques: · Doolittle Method – sets the L matrix diagonal to unity · Crout Method - sets the U matrix diagonal to unity Note: both the L & U matrices share the same unity diagonal & can be stored compactly in the same matrix Gauss-Seidel Iteration http://en.wikipedia.org/wiki/Gauss%E2%80%93Seidel_method C++: http://www.nr.com/forum/showthread.php?t=722 Transform the linear set of equations into a single equation & then use numerical integration (as integration formulas have Sums, it is implemented iteratively). an optimization of Gauss-Jacobi: 1.5 times faster, requires 0.25 iterations to achieve the same tolerance Solving Non-Linear Equations Iteratively find roots of polynomials – there may be 0, 1 or n solutions for an n order polynomial use iterative techniques Iterative methods · used when there are no known analytical techniques · Requires set functions to be continuous & differentiable · Requires an initial seed value – choice is critical to convergence à conduct multiple runs with different starting points & then select best result · Systematic - iterate until diminishing returns, tolerance or max iteration conditions are met · bracketing techniques will always yield convergent solutions, non-bracketing methods may fail to converge Incremental method if a nonlinear function has opposite signs at 2 ends of a small interval x1 & x2, then there is likely to be a solution in their interval – solutions are detected by evaluating a function over interval steps, for a change in sign, adjusting the step size dynamically. Limitations – can miss closely spaced solutions in large intervals, cannot detect degenerate (coinciding) solutions, limited to functions that cross the x-axis, gives false positives for singularities Fixed point method http://en.wikipedia.org/wiki/Fixed-point_iteration C++: http://books.google.co.il/books?id=weYj75E_t6MC&pg=PA79&lpg=PA79&dq=fixed+point+method++c%2B%2B&source=bl&ots=LQ-5P_taoC&sig=lENUUIYBK53tZtTwNfHLy5PEWDk&hl=en&sa=X&ei=wezDUPW1J5DptQaMsIHQCw&redir_esc=y#v=onepage&q=fixed%20point%20method%20%20c%2B%2B&f=false Algebraically rearrange a solution to isolate a variable then apply incremental method Bisection method http://en.wikipedia.org/wiki/Bisection_method C++: http://numericalcomputing.wordpress.com/category/algorithms/ Bracketed - Select an initial interval, keep bisecting it ad midpoint into sub-intervals and then apply incremental method on smaller & smaller intervals – zoom in Adv: unaffected by function gradient à reliable Disadv: slow convergence False Position Method http://en.wikipedia.org/wiki/False_position_method C++: http://www.dreamincode.net/forums/topic/126100-bisection-and-false-position-methods/ Bracketed - Select an initial interval , & use the relative value of function at interval end points to select next sub-intervals (estimate how far between the end points the solution might be & subdivide based on this) Newton-Raphson method http://en.wikipedia.org/wiki/Newton's_method C++: http://www-users.cselabs.umn.edu/classes/Summer-2012/csci1113/index.php?page=./newt3 Also known as Newton's method Convenient, efficient Not bracketed – only a single initial guess is required to start iteration – requires an analytical expression for the first derivative of the function as input. Evaluates the function & its derivative at each step. Can be extended to the Newton MutiRoot method for solving multiple roots Can be easily applied to an of n-coupled set of non-linear equations – conduct a Taylor Series expansion of a function, dropping terms of order n, rewrite as a Jacobian matrix of PDs & convert to simultaneous linear equations !!! Secant Method http://en.wikipedia.org/wiki/Secant_method C++: http://forum.vcoderz.com/showthread.php?p=205230 Unlike N-R, can estimate first derivative from an initial interval (does not require root to be bracketed) instead of inputting it Since derivative is approximated, may converge slower. Is fast in practice as it does not have to evaluate the derivative at each step. Similar implementation to False Positive method Birge-Vieta Method http://mat.iitm.ac.in/home/sryedida/public_html/caimna/transcendental/polynomial%20methods/bv%20method.html C++: http://books.google.co.il/books?id=cL1boM2uyQwC&pg=SA3-PA51&lpg=SA3-PA51&dq=Birge-Vieta+Method+c%2B%2B&source=bl&ots=QZmnDTK3rC&sig=BPNcHHbpR_DKVoZXrLi4nVXD-gg&hl=en&sa=X&ei=R-_DUK2iNIjzsgbE5ID4Dg&redir_esc=y#v=onepage&q=Birge-Vieta%20Method%20c%2B%2B&f=false combines Horner's method of polynomial evaluation (transforming into lesser degree polynomials that are more computationally efficient to process) with Newton-Raphson to provide a computational speed-up Interpolation Overview Construct new data points for as close as possible fit within range of a discrete set of known points (that were obtained via sampling, experimentation) Use Taylor Series Expansion of a function f(x) around a specific value for x Linear Interpolation http://en.wikipedia.org/wiki/Linear_interpolation C++: http://www.hamaluik.com/?p=289 Straight line between 2 points à concatenate interpolants between each pair of data points Bilinear Interpolation http://en.wikipedia.org/wiki/Bilinear_interpolation C++: http://supercomputingblog.com/graphics/coding-bilinear-interpolation/2/ Extension of the linear function for interpolating functions of 2 variables – perform linear interpolation first in 1 direction, then in another. Used in image processing – e.g. texture mapping filter. Uses 4 vertices to interpolate a value within a unit cell. Lagrange Interpolation http://en.wikipedia.org/wiki/Lagrange_polynomial C++: http://www.codecogs.com/code/maths/approximation/interpolation/lagrange.php For polynomials Requires recomputation for all terms for each distinct x value – can only be applied for small number of nodes Numerically unstable Barycentric Interpolation http://epubs.siam.org/doi/pdf/10.1137/S0036144502417715 C++: http://www.gamedev.net/topic/621445-barycentric-coordinates-c-code-check/ Rearrange the terms in the equation of the Legrange interpolation by defining weight functions that are independent of the interpolated value of x Newton Divided Difference Interpolation http://en.wikipedia.org/wiki/Newton_polynomial C++: http://jee-appy.blogspot.co.il/2011/12/newton-divided-difference-interpolation.html Hermite Divided Differences: Interpolation polynomial approximation for a given set of data points in the NR form - divided differences are used to approximately calculate the various differences. For a given set of 3 data points , fit a quadratic interpolant through the data Bracketed functions allow Newton divided differences to be calculated recursively Difference table Cubic Spline Interpolation http://en.wikipedia.org/wiki/Spline_interpolation C++: https://www.marcusbannerman.co.uk/index.php/home/latestarticles/42-articles/96-cubic-spline-class.html Spline is a piecewise polynomial Provides smoothness – for interpolations with significantly varying data Use weighted coefficients to bend the function to be smooth & its 1st & 2nd derivatives are continuous through the edge points in the interval Curve Fitting A generalization of interpolating whereby given data points may contain noise à the curve does not necessarily pass through all the points Least Squares Fit http://en.wikipedia.org/wiki/Least_squares C++: http://www.ccas.ru/mmes/educat/lab04k/02/least-squares.c Residual – difference between observed value & expected value Model function is often chosen as a linear combination of the specified functions Determines: A) The model instance in which the sum of squared residuals has the least value B) param values for which model best fits data Straight Line Fit Linear correlation between independent variable and dependent variable Linear Regression http://en.wikipedia.org/wiki/Linear_regression C++: http://www.oocities.org/david_swaim/cpp/linregc.htm Special case of statistically exact extrapolation Leverage least squares Given a basis function, the sum of the residuals is determined and the corresponding gradient equation is expressed as a set of normal linear equations in matrix form that can be solved (e.g. using LU Decomposition) Can be weighted - Drop the assumption that all errors have the same significance –-> confidence of accuracy is different for each data point. Fit the function closer to points with higher weights Polynomial Fit - use a polynomial basis function Moving Average http://en.wikipedia.org/wiki/Moving_average C++: http://www.codeproject.com/Articles/17860/A-Simple-Moving-Average-Algorithm Used for smoothing (cancel fluctuations to highlight longer-term trends & cycles), time series data analysis, signal processing filters Replace each data point with average of neighbors. Can be simple (SMA), weighted (WMA), exponential (EMA). Lags behind latest data points – extra weight can be given to more recent data points. Weights can decrease arithmetically or exponentially according to distance from point. Parameters: smoothing factor, period, weight basis Optimization Overview Given function with multiple variables, find Min (or max by minimizing –f(x)) Iterative approach Efficient, but not necessarily reliable Conditions: noisy data, constraints, non-linear models Detection via sign of first derivative - Derivative of saddle points will be 0 Local minima Bisection method Similar method for finding a root for a non-linear equation Start with an interval that contains a minimum Golden Search method http://en.wikipedia.org/wiki/Golden_section_search C++: http://www.codecogs.com/code/maths/optimization/golden.php Bisect intervals according to golden ratio 0.618.. Achieves reduction by evaluating a single function instead of 2 Newton-Raphson Method Brent method http://en.wikipedia.org/wiki/Brent's_method C++: http://people.sc.fsu.edu/~jburkardt/cpp_src/brent/brent.cpp Based on quadratic or parabolic interpolation – if the function is smooth & parabolic near to the minimum, then a parabola fitted through any 3 points should approximate the minima – fails when the 3 points are collinear , in which case the denominator is 0 Simplex Method http://en.wikipedia.org/wiki/Simplex_algorithm C++: http://www.codeguru.com/cpp/article.php/c17505/Simplex-Optimization-Algorithm-and-Implemetation-in-C-Programming.htm Find the global minima of any multi-variable function Direct search – no derivatives required At each step it maintains a non-degenerative simplex – a convex hull of n+1 vertices. Obtains the minimum for a function with n variables by evaluating the function at n-1 points, iteratively replacing the point of worst result with the point of best result, shrinking the multidimensional simplex around the best point. Point replacement involves expanding & contracting the simplex near the worst value point to determine a better replacement point Oscillation can be avoided by choosing the 2nd worst result Restart if it gets stuck Parameters: contraction & expansion factors Simulated Annealing http://en.wikipedia.org/wiki/Simulated_annealing C++: http://code.google.com/p/cppsimulatedannealing/ Analogy to heating & cooling metal to strengthen its structure Stochastic method – apply random permutation search for global minima - Avoid entrapment in local minima via hill climbing Heating schedule - Annealing schedule params: temperature, iterations at each temp, temperature delta Cooling schedule – can be linear, step-wise or exponential Differential Evolution http://en.wikipedia.org/wiki/Differential_evolution C++: http://www.amichel.com/de/doc/html/ More advanced stochastic methods analogous to biological processes: Genetic algorithms, evolution strategies Parallel direct search method against multiple discrete or continuous variables Initial population of variable vectors chosen randomly – if weighted difference vector of 2 vectors yields a lower objective function value then it replaces the comparison vector Many params: #parents, #variables, step size, crossover constant etc Convergence is slow – many more function evaluations than simulated annealing Numerical Differentiation Overview 2 approaches to finite difference methods: · A) approximate function via polynomial interpolation then differentiate · B) Taylor series approximation – additionally provides error estimate Finite Difference methods http://en.wikipedia.org/wiki/Finite_difference_method C++: http://www.wpi.edu/Pubs/ETD/Available/etd-051807-164436/unrestricted/EAMPADU.pdf Find differences between high order derivative values - Approximate differential equations by finite differences at evenly spaced data points Based on forward & backward Taylor series expansion of f(x) about x plus or minus multiples of delta h. Forward / backward difference - the sums of the series contains even derivatives and the difference of the series contains odd derivatives – coupled equations that can be solved. Provide an approximation of the derivative within a O(h^2) accuracy There is also central difference & extended central difference which has a O(h^4) accuracy Richardson Extrapolation http://en.wikipedia.org/wiki/Richardson_extrapolation C++: http://mathscoding.blogspot.co.il/2012/02/introduction-richardson-extrapolation.html A sequence acceleration method applied to finite differences Fast convergence, high accuracy O(h^4) Derivatives via Interpolation Cannot apply Finite Difference method to discrete data points at uneven intervals – so need to approximate the derivative of f(x) using the derivative of the interpolant via 3 point Lagrange Interpolation Note: the higher the order of the derivative, the lower the approximation precision Numerical Integration Estimate finite & infinite integrals of functions More accurate procedure than numerical differentiation Use when it is not possible to obtain an integral of a function analytically or when the function is not given, only the data points are Newton Cotes Methods http://en.wikipedia.org/wiki/Newton%E2%80%93Cotes_formulas C++: http://www.siafoo.net/snippet/324 For equally spaced data points Computationally easy – based on local interpolation of n rectangular strip areas that is piecewise fitted to a polynomial to get the sum total area Evaluate the integrand at n+1 evenly spaced points – approximate definite integral by Sum Weights are derived from Lagrange Basis polynomials Leverage Trapezoidal Rule for default 2nd formulas, Simpson 1/3 Rule for substituting 3 point formulas, Simpson 3/8 Rule for 4 point formulas. For 4 point formulas use Bodes Rule. Higher orders obtain more accurate results Trapezoidal Rule uses simple area, Simpsons Rule replaces the integrand f(x) with a quadratic polynomial p(x) that uses the same values as f(x) for its end points, but adds a midpoint Romberg Integration http://en.wikipedia.org/wiki/Romberg's_method C++: http://code.google.com/p/romberg-integration/downloads/detail?name=romberg.cpp&can=2&q= Combines trapezoidal rule with Richardson Extrapolation Evaluates the integrand at equally spaced points The integrand must have continuous derivatives Each R(n,m) extrapolation uses a higher order integrand polynomial replacement rule (zeroth starts with trapezoidal) à a lower triangular matrix set of equation coefficients where the bottom right term has the most accurate approximation. The process continues until the difference between 2 successive diagonal terms becomes sufficiently small. Gaussian Quadrature http://en.wikipedia.org/wiki/Gaussian_quadrature C++: http://www.alglib.net/integration/gaussianquadratures.php Data points are chosen to yield best possible accuracy – requires fewer evaluations Ability to handle singularities, functions that are difficult to evaluate The integrand can include a weighting function determined by a set of orthogonal polynomials. Points & weights are selected so that the integrand yields the exact integral if f(x) is a polynomial of degree <= 2n+1 Techniques (basically different weighting functions): · Gauss-Legendre Integration w(x)=1 · Gauss-Laguerre Integration w(x)=e^-x · Gauss-Hermite Integration w(x)=e^-x^2 · Gauss-Chebyshev Integration w(x)= 1 / Sqrt(1-x^2) Solving ODEs Use when high order differential equations cannot be solved analytically Evaluated under boundary conditions RK for systems – a high order differential equation can always be transformed into a coupled first order system of equations Euler method http://en.wikipedia.org/wiki/Euler_method C++: http://rosettacode.org/wiki/Euler_method First order Runge–Kutta method. Simple recursive method – given an initial value, calculate derivative deltas. Unstable & not very accurate (O(h) error) – not used in practice A first-order method - the local error (truncation error per step) is proportional to the square of the step size, and the global error (error at a given time) is proportional to the step size In evolving solution between data points xn & xn+1, only evaluates derivatives at beginning of interval xn à asymmetric at boundaries Higher order Runge Kutta http://en.wikipedia.org/wiki/Runge%E2%80%93Kutta_methods C++: http://www.dreamincode.net/code/snippet1441.htm 2nd & 4th order RK - Introduces parameterized midpoints for more symmetric solutions à accuracy at higher computational cost Adaptive RK – RK-Fehlberg – estimate the truncation at each integration step & automatically adjust the step size to keep error within prescribed limits. At each step 2 approximations are compared – if in disagreement to a specific accuracy, the step size is reduced Boundary Value Problems Where solution of differential equations are located at 2 different values of the independent variable x à more difficult, because cannot just start at point of initial value – there may not be enough starting conditions available at the end points to produce a unique solution An n-order equation will require n boundary conditions – need to determine the missing n-1 conditions which cause the given conditions at the other boundary to be satisfied Shooting Method http://en.wikipedia.org/wiki/Shooting_method C++: http://ganeshtiwaridotcomdotnp.blogspot.co.il/2009/12/c-c-code-shooting-method-for-solving.html Iteratively guess the missing values for one end & integrate, then inspect the discrepancy with the boundary values of the other end to adjust the estimate Given the starting boundary values u1 & u2 which contain the root u, solve u given the false position method (solving the differential equation as an initial value problem via 4th order RK), then use u to solve the differential equations. Finite Difference Method For linear & non-linear systems Higher order derivatives require more computational steps – some combinations for boundary conditions may not work though Improve the accuracy by increasing the number of mesh points Solving EigenValue Problems An eigenvalue can substitute a matrix when doing matrix multiplication à convert matrix multiplication into a polynomial EigenValue For a given set of equations in matrix form, determine what are the solution eigenvalue & eigenvectors Similar Matrices - have same eigenvalues. Use orthogonal similarity transforms to reduce a matrix to diagonal form from which eigenvalue(s) & eigenvectors can be computed iteratively Jacobi method http://en.wikipedia.org/wiki/Jacobi_method C++: http://people.sc.fsu.edu/~jburkardt/classes/acs2_2008/openmp/jacobi/jacobi.html Robust but Computationally intense – use for small matrices < 10x10 Power Iteration http://en.wikipedia.org/wiki/Power_iteration For any given real symmetric matrix, generate the largest single eigenvalue & its eigenvectors Simplest method – does not compute matrix decomposition à suitable for large, sparse matrices Inverse Iteration Variation of power iteration method – generates the smallest eigenvalue from the inverse matrix Rayleigh Method http://en.wikipedia.org/wiki/Rayleigh's_method_of_dimensional_analysis Variation of power iteration method Rayleigh Quotient Method Variation of inverse iteration method Matrix Tri-diagonalization Method Use householder algorithm to reduce an NxN symmetric matrix to a tridiagonal real symmetric matrix vua N-2 orthogonal transforms     Whats Next Outside of Numerical Methods there are lots of different types of algorithms that I’ve learned over the decades: Data Mining – (I covered this briefly in a previous post: http://geekswithblogs.net/JoshReuben/archive/2007/12/31/ssas-dm-algorithms.aspx ) Search & Sort Routing Problem Solving Logical Theorem Proving Planning Probabilistic Reasoning Machine Learning Solvers (eg MIP) Bioinformatics (Sequence Alignment, Protein Folding) Quant Finance (I read Wilmott’s books – interesting) Sooner or later, I’ll cover the above topics as well.

    Read the article

  • Why do apache2 upgrades remove and not re-install libapache2-mod-php5?

    - by nutznboltz
    We repeatedly see that when an apache2 update arrives and is installed it causes the libapache2-mod-php5 package to be removed and does not subsequently re-install it automatically. We must subsequently re-install the libapache2-mod-php5 manually in order to restore functionality to our web server. Please see the following github gist, it is a contiguous section of our server's dpkg.log showing the November 14, 2011 update to apache2: https://gist.github.com/1368361 it includes 2011-11-14 11:22:18 remove libapache2-mod-php5 5.3.2-1ubuntu4.10 5.3.2-1ubuntu4.10 Is this a known issue? Do other people see this too? I could not find any launchpad bug reports about it. Platform details: $ lsb_release -ds Ubuntu 10.04.3 LTS $ uname -srvm Linux 2.6.38-12-virtual #51~lucid1-Ubuntu SMP Thu Sep 29 20:27:50 UTC 2011 x86_64 $ dpkg -l | awk '/ii.*apache/ {print $2 " " $3 }' apache2 2.2.14-5ubuntu8.7 apache2-mpm-prefork 2.2.14-5ubuntu8.7 apache2-utils 2.2.14-5ubuntu8.7 apache2.2-bin 2.2.14-5ubuntu8.7 apache2.2-common 2.2.14-5ubuntu8.7 libapache2-mod-authnz-external 3.2.4-2+squeeze1build0.10.04.1 libapache2-mod-php5 5.3.2-1ubuntu4.10 Thanks At a high-level the update process looks like: package package_name do action :upgrade case node[:platform] when 'centos', 'redhat', 'scientific' options '--disableplugin=fastestmirror' when 'ubuntu' options '-o Dpkg::Options::="--force-confdef" -o Dpkg::Options::="--force-confold"' end end But at a lower level def install_package(name, version) run_command_with_systems_locale( :command = "apt-get -q -y#{expand_options(@new_resource.options)} install #{name}=#{version}", :environment = { "DEBIAN_FRONTEND" = "noninteractive" } ) end def upgrade_package(name, version) install_package(name, version) end So Chef is using "install" to do "update". This sort of moves the question around to "how does apt-get safe-upgrade" remember to re-install libapache-mod-php5? The exact sequence of packages that triggered this was: apache2 apache2-mpm-prefork apache2-mpm-worker apache2-utils apache2.2-bin apache2.2-common But the code is attempting to run checks to make sure the packages in that list are installed already before attempting to "upgrade" them. case node[:platform] when 'debian', 'centos', 'fedora', 'redhat', 'scientific', 'ubuntu' # first primitive way is to define the updates in the recipe # data bags will be used later %w/ apache2 apache2-mpm-prefork apache2-mpm-worker apache2-utils apache2.2-bin apache2.2-common /.each{ |package_name| Chef::Log.debug("is #{package_name} among local packages available for changes?") next unless node[:packages][:changes].keys.include?(package_name) Chef::Log.debug("is #{package_name} available for upgrade?") next unless node[:packages][:changes][package_name][:action] == 'upgrade' package package_name do action :upgrade case node[:platform] when 'centos', 'redhat', 'scientific' options '--disableplugin=fastestmirror' when 'ubuntu' options '-o Dpkg::Options::="--force-confdef" -o Dpkg::Options::="--force-confold"' end end tag('upgraded') } # after upgrading everything, run yum cache updater if tagged?('upgraded') # Remove old orphaned dependencies and kernel images and kernel headers etc. # Remove cached deb files. case node[:platform] when 'ubuntu' execute 'apt-get -y autoremove' execute 'apt-get clean' # Re-check what updates are available soon. when 'centos', 'fedora', 'redhat', 'scientific' node[:packages][:last_time_we_looked_at_yum] = 0 end untag('upgraded') end end But it's clear that it fails since the dpkg.log has 2011-11-14 11:22:25 install apache2-mpm-worker 2.2.14-5ubuntu8.7 on a system which does not currently have apache2-mpm-worker. I will have to discuss this with the author, thanks again.

    Read the article

  • How to use SharePoint modal dialog box to display Custom Page Part3

    - by ybbest
    In the second part of the series, I showed you how to display and close a custom page in a SharePoint modal dialog using JavaScript and display a message after the modal dialog is closed. In this post, I’d like to show you how to use SPLongOperation with the Modal dialog box. You can download the source code here. 1. Firstly, modify the element file as follow <Elements xmlns="http://schemas.microsoft.com/sharepoint/"> <CustomAction Id="ReportConcern" RegistrationType="ContentType" RegistrationId="0x010100866B1423D33DDA4CA1A4639B54DD4642" Location="EditControlBlock" Sequence="107" Title="Display Custom Page" Description="To Display Custom Page in a modal dialog box on this item"> <UrlAction Url="javascript: function emitStatus(messageToDisplay) { statusId = SP.UI.Status.addStatus(messageToDisplay.message + ' ' +messageToDisplay.location ); SP.UI.Status.setStatusPriColor(statusId, 'Green'); } function portalModalDialogClosedCallback(result, value) { if (value !== null) { emitStatus(value); } } var options = { url: '{SiteUrl}' + '/_layouts/YBBEST/TitleRename.aspx?List={ListId}&amp;ID={ItemId}', title: 'Rename title', allowMaximize: false, showClose: true, width: 500, height: 300, dialogReturnValueCallback: portalModalDialogClosedCallback }; SP.UI.ModalDialog.showModalDialog(options);" /> </CustomAction> </Elements> 2. In your code behind, you can implement a close dialog function as below. This will close your modal dialog box once the button is clicked and display a status bar. Note that you need to use window.frameElement.commonModalDialogClose instead of window.frameElement.commonModalDialogClose protected void SubmitClicked(object sender, EventArgs e) { //Process stuff string message = "You clicked the Submit button"; string newLocation="http://www.google.com"; string information = string.Format("{{'message':'{0}','location':'{1}' }}", message, newLocation); var longOperation = new SPLongOperation(Page); longOperation.LeadingHTML = "Processing the  application"; longOperation.TrailingHTML = "Please wait while the application is being processed."; longOperation.Begin(); Thread.Sleep(5*1000); var closeDialogScript = GetCloseDialogScriptForLongProcess(information); longOperation.EndScript(closeDialogScript); } protected static string GetCloseDialogScriptForLongProcess(string message) { var scriptBuilder = new StringBuilder(); scriptBuilder.Append("window.frameElement.commonModalDialogClose(1,").Append(message).Append(");"); return scriptBuilder.ToString(); }   References: How to: Display a Page as a Modal Dialog Box

    Read the article

  • HPC Server Dynamic Job Scheduling: when jobs spawn jobs

    - by JoshReuben
    HPC Job Types HPC has 3 types of jobs http://technet.microsoft.com/en-us/library/cc972750(v=ws.10).aspx · Task Flow – vanilla sequence · Parametric Sweep – concurrently run multiple instances of the same program, each with a different work unit input · MPI – message passing between master & slave tasks But when you try go outside the box – job tasks that spawn jobs, blocking the parent task – you run the risk of resource starvation, deadlocks, and recursive, non-converging or exponential blow-up. The solution to this is to write some performance monitoring and job scheduling code. You can do this in 2 ways: manually control scheduling - allocate/ de-allocate resources, change job priorities, pause & resume tasks , restrict long running tasks to specific compute clusters Semi-automatically - set threshold params for scheduling. How – Control Job Scheduling In order to manage the tasks and resources that are associated with a job, you will need to access the ISchedulerJob interface - http://msdn.microsoft.com/en-us/library/microsoft.hpc.scheduler.ischedulerjob_members(v=vs.85).aspx This really allows you to control how a job is run – you can access & tweak the following features: max / min resource values whether job resources can grow / shrink, and whether jobs can be pre-empted, whether the job is exclusive per node the creator process id & the job pool timestamp of job creation & completion job priority, hold time & run time limit Re-queue count Job progress Max/ min Number of cores, nodes, sockets, RAM Dynamic task list – can add / cancel jobs on the fly Job counters When – poll perf counters Tweaking the job scheduler should be done on the basis of resource utilization according to PerfMon counters – HPC exposes 2 Perf objects: Compute Clusters, Compute Nodes http://technet.microsoft.com/en-us/library/cc720058(v=ws.10).aspx You can monitor running jobs according to dynamic thresholds – use your own discretion: Percentage processor time Number of running jobs Number of running tasks Total number of processors Number of processors in use Number of processors idle Number of serial tasks Number of parallel tasks Design Your algorithms correctly Finally , don’t assume you have unlimited compute resources in your cluster – design your algorithms with the following factors in mind: · Branching factor - http://en.wikipedia.org/wiki/Branching_factor - dynamically optimize the number of children per node · cutoffs to prevent explosions - http://en.wikipedia.org/wiki/Limit_of_a_sequence - not all functions converge after n attempts. You also need a threshold of good enough, diminishing returns · heuristic shortcuts - http://en.wikipedia.org/wiki/Heuristic - sometimes an exhaustive search is impractical and short cuts are suitable · Pruning http://en.wikipedia.org/wiki/Pruning_(algorithm) – remove / de-prioritize unnecessary tree branches · avoid local minima / maxima - http://en.wikipedia.org/wiki/Local_minima - sometimes an algorithm cant converge because it gets stuck in a local saddle – try simulated annealing, hill climbing or genetic algorithms to get out of these ruts   watch out for rounding errors – http://en.wikipedia.org/wiki/Round-off_error - multiple iterations can in parallel can quickly amplify & blow up your algo ! Use an epsilon, avoid floating point errors,  truncations, approximations Happy Coding !

    Read the article

  • Modify Build Failure Work Item in TFS 2010 Build

    - by Jakob Ehn
    The default behaviour in TFS Team Build (all versions) is to create a bug work item when a build fails. This main benefit of this is that you get a work item for something that needs to be done, namely to fix the build!. When the developer responsible for the build failure has fixed the problem, he/she can associated that check-in with the work item that was created from the previous build failure. In TFS 2005/2008 you could modify the information in the created work item by changing some predefined properties in the TFSBuild.proj file:   <!-- WorkItemType The type of the work item created on a build failure. --> <WorkItemType>Bug</WorkItemType> <!-- WorkItemFieldValues Fields and values of the work item created on a build failure. Note: Use reference names for fields if you want the build to be resistant to field name changes. Reference names are language independent while friendly names are changed depending on the installed language. For example, "System.Reason" is the reference name for the "Reason" field. --> <WorkItemFieldValues>System.Reason=Build Failure;System.Description=Start the build using Team Build</WorkItemFieldValues> <!-- WorkItemTitle Title of the work item created on build failure. --> <WorkItemTitle>Build failure in build:</WorkItemTitle> <!-- DescriptionText History comment of the work item created on a build failure. --> <DescriptionText>This work item was created by Team Build on a build failure.</DescriptionText> <!-- BuildLogText Additional comment text for the work item created on a build failure. --> <BuildlogText>The build log file is at:</BuildlogText> <!-- ErrorWarningLogText Additional comment text for the work item created on a build failure. This text will only be added if there were errors or warnings. --> <ErrorWarningLogText>The errors/warnings log file is at:</ErrorWarningLogText>   In TFS 2010, with Windows Workflow, you change this by modifying the properties on the OpenWorkItem activity. The hardest part of this is to actually find where this activity is located in the build process workflow. If you open the build definition in XAML you can just search for OpenWorkItem. If you use the designer you need to click your way down to the Catch section of the Try to Compile the Project sequence: To change the default values of the created work item, select the Created Work Item activity and look at the Properties window: Note the CustomFields property which is a dictionary with key (work item field name) and value. If you add custom fields to your work item you can add a value for it here by adding a new entry in the dictionary.

    Read the article

  • Friday Fun: Factory Balls – Christmas Edition

    - by Asian Angel
    Your weekend is almost here, but until the work day is over we have another fun holiday game for you. This week your job is to correctly decorate/paint the ornaments that go on the Christmas tree. Simple you say? Maybe, but maybe not! Factory Balls – Christmas Edition The object of the game is to correctly decorate/paint each Christmas ornament exactly as shown in the “sample image” provided for each level. What starts off as simple will quickly have you working to figure out the correct combination or sequence to complete each ornament. Are you ready? The first level serves as a tutorial to help you become comfortable with how to decorate/paint the ornaments. To move an ornament to a paint bucket or cover part of it with one of the helper items simply drag the ornament towards that area. The ornament will automatically move back to its’ starting position when the action is complete. First, a nice coat of red paint followed by covering the middle area with a horizontal belt. Once the belt is on move the ornament to the bucket of yellow paint. Next, you will need to remove the belt, so move the ornament back to the belt’s original position. One ornament finished! As soon as you complete decorating/painting an ornament, you move on to the next level and will be shown the next “sample Image” in the upper right corner. Starting with a coat of orange paint sounds good… Pop the little serrated edge cap on top… Add some blue paint… Almost have it… Place the large serrated edge cap on top… Another dip in the orange paint… And the second ornament is finished. Level three looks a little bit tougher…just work out your pattern of helper items & colors and you will definitely get it! Have fun decorating/painting those ornaments! Note: Starting with level four you will need to start using a combination of two helper items combined at times to properly complete the ornaments. Play Factory Balls – Christmas Edition Latest Features How-To Geek ETC The Complete List of iPad Tips, Tricks, and Tutorials The 50 Best Registry Hacks that Make Windows Better The How-To Geek Holiday Gift Guide (Geeky Stuff We Like) LCD? LED? Plasma? The How-To Geek Guide to HDTV Technology The How-To Geek Guide to Learning Photoshop, Part 8: Filters Improve Digital Photography by Calibrating Your Monitor Exploring the Jungle Ruins Wallpaper Protect Your Privacy When Browsing with Chrome and Iron Browser Free Shipping Day is Friday, December 17, 2010 – National Free Shipping Day Find an Applicable Quote for Any Programming Situation Winter Theme for Windows 7 from Microsoft Score Free In-Flight Wi-Fi Courtesy of Google Chrome

    Read the article

  • Guidance and Pricing for MSDN 2010

    - by John Alexander
    Sorry for the rather lengthy post here. I get asked this all the time so I decided to post it…Visual Studio 2010 editions will be available on April 12, 2010. Product Features Professional with MSDN Essentials Professional with MSDN Premium with MSDN Ultimate with MSDN Test Professional with MSDN Debugging and Diagnostics IntelliTrace (Historical Debugger)         Static Code Analysis       Code Metrics       Profiling       Debugger   Testing Tools Unit Testing   Code Coverage       Test Impact Analysis       Coded UI Test       Web Performance Testing         Load Testing1         Microsoft Test Manager 2010       Test Case Management2       Manual Test Execution       Fast-Forward for Manual Testing       Lab Management Configuration3       Integrated Development Environment Multiple Monitor Support   Multi-Targeting   One Click Web Deployment   JavaScript and jQuery Support   Extensible WPF-Based Environment Database Development Database Deployment       Database Change Management2       Database Unit Testing       Database Test Data Generation       Data Access   Development Platform Support Windows Development   Web Development   Office and SharePoint Development   Cloud Development   Customizable Development Experience   Architecture and Modeling Architecture Explorer         UML® 2.0 Compliant Diagrams (Activity, Use Case, Sequence, Class, Component)         Layer Diagram and Dependency Validation         Read-only diagrams (UML, Layer, DGML Graphs)         Lab Management Virtual environment setup & tear down3       Provision environment from template3       Checkpoint environment3       Team Foundation Server Version Control2   Work Item Tracking2   Build Automation2   Team Portal2   Reporting & Business Intelligence2   Agile Planning Workbook2   Microsoft Visual Studio Team Explorer 2010   Test Case Management2       MSDN Subscription – Software and Services for Production Use Windows Azure Platform 20 hrs/mo † 50 hrs/mo † 100 hrs/mo † 250 hrs/mo † n/a Microsoft Visual Studio Team Foundation Server 2010   Microsoft Visual Studio Team Foundation Server 2010 CAL   1 1 1 1 Microsoft Expression Studio 3       Microsoft Office Professional Plus 2010, Project Professional 2010, Visio Premium 2010 (following Office 2010 launch)       MSDN Subscription – Software for Development and Testing 4 Windows 7, Windows Server 2008 R2 and SQL Server 2008 Toolkits, Software Development Kits, Driver Development Kits Previous versions of Windows (client and server operation systems)   Previous versions of Microsoft SQL Server   Microsoft Office       Microsoft Dynamics       All other Servers       Windows Embedded operating systems       Teamprise         MSDN Subscription – Other Benefits Technical support incidents 0 2 4 4 2 Priority support in MSDN Forums Microsoft e-learning collections (typically 10 courses or 20 hours) 0 1 2 2 1 MSDN Flash newsletter MSDN Online Concierge MSDN Magazine   System Requirements View View View View View Buy from (MSRP) $799 $1,199 $5,469 $11,899 $2,169 Renew from (MSRP) $549 (upgrade) $799 $2,299 $3,799 $899 † Availability varies by country and subscription level.  Details available on the MSDN site 1. May require one or more Microsoft Visual Studio Load Test Virtual User Pack 2010 2. Requires Team Foundation Server and a Team Foundation Server CAL 3. Requires Microsoft Visual Studio Lab Management 2010 4. Per-user license allows unlimited installations and use for designing, developing, testing, and demonstrating applications. UML is a registered trademark of Object Management Group, Inc. Windows is either a registered trademark or trademark of Microsoft Corporation in the United States and/or other countries.

    Read the article

  • Gparted Partition Mount Points Alternate Between 2 Physical Disk Drives

    - by California Ken
    I'm running Ubuntu Server 14.04 on a system with 2 physical disk drives. I am frequently seeing mount errors on startup. When I check the drive partitions using GPARTED, I see that my two "non-system created" data partitions have the wrong disk assignments (i.e. sda1 vs sdb1) or visa-versa. If I hand edit /etc/fstab to match GPARTED, the system will boot error free one time. On the second restart I will get the "serious mount problem" error for the 2 data partitions and when I check GPARTED, the disk assignments have changed again (again, GPARTED and fstab don't match). A listing of my /etc/fstab is: /etc/fstab: static file system information. # Use 'blkid' to print the universally unique identifier for a device; this may be used with UUID= as a more robust way to name devices that works even if disks are added and removed. See fstab(5). # / was on /dev/sdb2 during installation UUID=766a06a4-e5af-484a-adf0-fa1e88da7212 / ext4 errors=remount-ro,user_xattr,acl,barrier=1 0 1 swap was on /dev/sda6 during installation UUID=8c42f835-ead3-43fb-88d8-196f5dfc3aa7 none swap sw 0 0 swap was on /dev/sdb3 during installation UUID=2214deec-ba98-47da-aea7-4e46998f3e57 none swap sw 0 0 /dev/fd0 /media/floppy0 auto rw,user,noauto,exec,utf8 0 0 /dev/sda1 /media/ken/Linux-Data ext3 defaults 0 2 /dev/sda5 /media/ken/Data2 ext4 defaults 0 2 The device designations in the last 2 lines are the ones in question. The fstab entries to NOT change between system restarts but the mount points in the GPARTED display do. Does anyone have a fix for this? Thanks Mr. Young and Mr Gedak, Following is my fstab file and two blkid outputs. The fstab output is correct. The first blkid output was after a reboot and is WRONG! The sda and sdb device partition data is reversed. The 2nd blkid output was after a second reboot (fstab not changed). It shows the sda and adb partition data CORRECTLY. I didn't see any duplicate UUIDs. Does anyone have any idea why the GPARTED and blkid outputs alternate on consecutive reboots? The alternating partition data is real since when the partition assignments are reversed, the boot sequence halts with disk mounting errers (I have to press "s" to skip the mounts). Thanks again. Ken I copied the contents of a text file showing my fstab and 2 blkid outputs. The text file contents show up in the text entry box but does not appear in the main body of the question. Is there a way I can attach the text file or edit this question so that the text is displayed for question viewers?

    Read the article

  • Simple tips to design a Customer Journey Map

    - by Isabel F. Peñuelas
    “A model can abstract to a level that is comprehensible to humans, without getting lost in details.” -The Unified Modeling Language Reference Manual. Inception using Post-it, StoryBoards, Lego or Mindmaping Techniques The first step in a Customer Experience project is to describe customer interactions creating a customer journey map. Modeling is never easy, so to succeed on this effort, it is very convenient that your CX´s team have some “abstract thinking” skills. Besides is very helpful to consult a Business Service Design offered by an Interactive Agency to lead your inception process. Initially, you may start by a free discussion using post-it cards; storyboards; even lego or any other brainstorming technique you like. This will help you to get your mind into the path followed by the customer to purchase your product or to consume any business service you actually offer to your customers, or plan to offer in the near future. (from www.servicedesigntools.org) Colorful Mind Maps are very useful to document and share meeting ideas. Some Mind Maps software providers as ThinkBuzzan provide trial versions, and you will find more mindmapping options on this post by Mashable. Finally to produce a quick one, I do recommend Wise, an entirely online mindmaping service. On my view the best results in terms of communication will always come for an artistic hand-made drawing. Customer Experience Mind Map Example Making your first Customer Journey Map To add some more formalization to your thoughts, there is a wide offering for designing Customer Journey Maps. A Customer Map can be represented as an oriented graph in which another follows each step. The one below is the most simple Customer Journey you can draw. Nothing more than a couple of pictures, numbers and lines to design the customer steps sequence in the purchase process. Very simple Customer Journey for Social Mobile Shopping There are a lot of Customer Journey templates much more sophisticated available  in the Web using a variety of styles, as per example this one with a focus on underlining emotional experience, or this other worksheet template. Representing different interaction devices on the vertical axis, and touchpoints / requirements and existing gaps horizontally  is today´s most common format for Customer Journeys. From Customer Journey Maps to CX Technology Adoption Plans Once you have your map ready, you can start to identify the IT infrastructure requirements for your CXProject. By analyzing customer problems and improvement opportunities with maps, you will then identify the technology gaps and the new investment requirements in your IT infrastructure. Deeping step by step from the more abstract to the more concrete is the best guarantee to take the right IT investment decisions.  ¡Remember to keep your initial customer journey safe on your pocket in every one of your CX´s project meetings- that´s you map to success!

    Read the article

  • What&rsquo;s new in VS.10 &amp; TFS.10?

    - by johndoucette
    Getting my geek on… I have decided to call the products VS.10 (Visual Studio 2010), TP.10 (Test Professional 2010),  and TFS.10 (Team Foundation Server 2010) Thanks Neno Loje. What's new in Visual Studio & Team Foundation Server 2010? Focusing on Visual Studio Team System (VSTS) ALM-related parts: Visual Studio Ultimate 2010 NEW: IntelliTrace® (aka the historical debugger) NEW: Architecture Tools New Project Type: Modeling Project UML Diagrams UML Use Case Diagram UML Class Diagram UML Sequence Diagram (supports reverse enginneering) UML Activity Diagram UML Component Diagram Layer Diagram (with Team Build integration for layer validation) Architecuture Explorer Dependency visualization DGML Web & Load Tests Visual Studio Premium 2010 NEW: Architecture Tools Read-only model viewer Development Tools Code Analysis New Rules like SQL Injection detection Rule Sets Code Profiler Multi-Tier Profiling JScript Profiling Profiling applications on virtual machines in sampling mode Code Metrics Test Tools Code Coverage NEW: Test Impact Analysis NEW: Coded UI Test Database Tools (DB schema versioning & deployment) Visual Studio Professional 2010 Debuger Mixed Mode Debugging for 64-bit Applications Export/Import of Breakpoints and data tips Visual Studio Test Professional 2010 Microsoft Test Manager (MTM, formerly known as "Camano")) Fast Forward Testing Visual Studio Team Foundation Server 2010 Work Item Tracking and Project Management New MSF templatesfor Agile and CMMI (V 5.0) Hierarchical Work Items Custom Work Item Link Types Ready to use Excel agile project management workbooks for managing your backlogs (including capacity planing) Convert Work Item query to an Excel report MS Excel integration Support for Work Item hierarchies Formatting is preserved after doing a 'Refresh' MS Project integration Hierarchy and successor/predecessor info is now synchronized NEW: Test Case Management Version Control Public Workspaces Branch & Merge Visualization Tracking of Changesets & Work Items Gated Check-In Team Build Build Controllers and Agents Workflow 4-based build process NEW: Lab Management (only a pre-release is avaiable at the moment!) Project Portal & Reporting Dashboards (on SharePoint Portal) Burndown Chart TFS Web Parts (to show data from TFS) Administration & Operations Topology enhancements Application tier network load balancing (NLB) SQL Server scale out Improved Sharepoint flexibility Report Server flexibility Zone support Kerberos support Separation of TFS and SQL administration Setup Separate install from configure Improved installation wizards Optional components Simplified account requirements Improved Reporting Services configuration Setup consolidation Upgrading from previous TFS versions Improved IIS flexibility Administration Consolidation of command line tools User rename support Project Collections Archive/restore individual project collections Move Team Project Collections Server consolidation Team Project Collection Split Team Project Collection Isolation Server request cancellation Licensing: TFS server license included in MSDN subscriptions Removed features (former features not part of Visual Studio 2010): Debug » Start With Application Verifier Object Test Bench IntelliSense for C++ / CLI Debugging support for SQL 2000

    Read the article

  • Mysql 5.5 server not working

    - by rajesh
    I had Ubuntu 14.04 installed on my system. I recently updated ubuntu and now my mysql does not start and workbench says that mysql server has been stopped. And when i try to start it gives me the following error 2014-08-12 23:02:04 - Checking server status... 2014-08-12 23:02:04 - Trying to connect to MySQL... 2014-08-12 23:02:04 - Can't connect to MySQL server on '127.0.0.1' (111) (2003) 2014-08-12 23:02:04 - Assuming server is not running 2014-08-12 23:02:04 - Server start done. 2014-08-12 23:02:04 - Checking server status... 2014-08-12 23:02:04 - Trying to connect to MySQL... 2014-08-12 23:02:04 - Can't connect to MySQL server on '127.0.0.1' (111) (2003) 2014-08-12 23:02:04 - Assuming server is not running And also when i try to login using terminal (mysql -u root -p <password>) i get the following error: ERROR 2002 (HY000): Can't connect to local MySQL server through socket '/var/run/mysqld/mysqld.sock' (2) I have also tried to reinstall Ubuntu but i am unable to do so. Gives me the following error: Reading package lists... Done Building dependency tree Reading state information... Done mysql-server-5.5 is already the newest version. 0 upgraded, 0 newly installed, 0 to remove and 4 not upgraded. I have data which i have not taken backup of as i am unable to log into the server. I am a newbie please help me resolve this issue without losing my data. Awaiting for your earliest response. Below is the error message from cat /var/log/mysql/error.log 140813 21:22:50 [Warning] Using unique option prefix myisam-recover instead of myisam-recover-options is deprecated and will be removed in a future release. Please use the full name instead. 140813 21:22:50 [Note] Plugin 'FEDERATED' is disabled. 140813 21:22:50 InnoDB: The InnoDB memory heap is disabled 140813 21:22:50 InnoDB: Mutexes and rw_locks use GCC atomic builtins 140813 21:22:50 InnoDB: Compressed tables use zlib 1.2.8 140813 21:22:50 InnoDB: Using Linux native AIO 140813 21:22:50 InnoDB: Initializing buffer pool, size = 128.0M 140813 21:22:50 InnoDB: Completed initialization of buffer pool 140813 21:22:50 InnoDB: highest supported file format is Barracuda. 140813 21:22:50 InnoDB: Waiting for the background threads to start 140813 21:22:51 InnoDB: 5.5.38 started; log sequence number 80726593570 140813 21:22:51 [Note] Server hostname (bind-address): '127.0.0.1'; port: 3306 140813 21:22:51 [Note] - '127.0.0.1' resolves to '127.0.0.1'; 140813 21:22:51 [Note] Server socket created on IP: '127.0.0.1'. 140813 21:22:51 [ERROR] Fatal error: Can't open and lock privilege tables: Incorrect file format 'user'

    Read the article

< Previous Page | 103 104 105 106 107 108 109 110 111 112 113 114  | Next Page >