Search Results

Search found 6630 results on 266 pages for 'everyone'.

Page 11/266 | < Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >

  • Hyper-V Manager version 6.2, an experience in virtual switch setup

    - by Kevin Shyr
    The version number of Hyper-V manager is 6.2.9200.16384   This is what came with my Windows 8 work laptop (by enabling Windows features) The blogs I read indicated that I need an external switch for my guest OS to access internet, and an internal one for them to share folder with my Host OS.  I proceeded to create an external virtual switch, and here is the screenshot. After setting up the network adapters on the guest OS, I peeked into host OS networking, and saw that Network Bridge was already created.  GREAT!  So I fired up my guest OS and darn, no internet.  Then I noticed that my host internet was gone, too.  I looked further and found that even though I have a network bridge, no connection has the status "Bridged"Once I removed the bridge (by removing individual connection from the bridge, I know, weird, since none of them say "Bridged" in status)  I re-selected the connection that I want and add them to the bridge to create a new network bridge.  Once my wireless connection status shows "Bridged", I was able to get to internet from my guest OS.Two things I noticed after I got internet for everyone ( my host and guest OS):My network adapters in the host OS no longer shows "Bridged", but everyone can still get to the internetThe virtual switch that I set up for "External" is now showing to be "Internal", and I was able to create shared folder between host and guest OS.  This means I didn't have to create the other "Internal" virtual switch.

    Read the article

  • Algorithm for grouping friends at the cinema [closed]

    - by Tim Skauge
    I got a brain teaser for you - it's not as simple as it sounds so please read and try to solve the issue. Before you ask if it's homework - it's not! I just wish to see if there's an elegant way of solving this. Here's the issue: X-number of friends want's to go to the cinema and wish to be seated in the best available groups. Best case is that everyone sits together and worst case is that everyone sits alone. Fewer groups are preferred over more groups. Sitting alone is least preferred. Input is the number of people going to the cinema and output should be an array of integer arrays that contains: Ordered combinations (most preferred are first) Number of people in each group Below are some examples of number of people going to the cinema and a list of preferred combinations these people can be seated: 1 person: 1 2 persons: 2, 1+1 3 persons: 3, 2+1, 1+1+1 4 persons: 4, 2+2, 3+1, 2+1+1, 1+1+1+1 5 persons: 5, 3+2, 4+1, 2+2+1, 3+1+1, 2+1+1+1, 1+1+1+1+1 6 persons: 6, 3+3, 4+2, 2+2+2, 5+1, 3+2+1, 2+2+1+1, 2+1+1+1+1, 1+1+1+1+1+1 Example with more than 7 persons explodes in combinations but I think you get the point by now. Question is: What does an algorithm look like that solves this problem? My language by choice is C# so if you could give an answer in C# it would be fantastic!

    Read the article

  • What is the best objective way to measure language popularity trends? (What's better than TIOBE?)

    - by Eric Wilson
    The best way to get data on computer language popularity that I know is the TIOBE index. But everyone knows that TIOBE is hopelessly flawed. (If someone provides a link to support this, I'll add it here.) So is there any data on programming language popularity that is generally considered meaningful? The only other option I know is to look at the trends at indeed.com, which is inherently flawed, being based on job postings. It isn't like I would make a future language decision solely based on an index, but it might provide a useful balance to the skewed perspective one obtains by talking to ones friends and colleagues. To illustrate that bias, I'll point out that based on the experience of those I personally know, the only languages used professionally today (in order of popularity) are Java, C#, Groovy, JavaScript, Ruby, Objective C, and Perl. (Though it is evident that C, C++ and PHP were used in the past.) So my question is, everyone bashes TIOBE, but is there anything else? If so, can anyone explain how we know the alternative has better methodology? Thanks.

    Read the article

  • Getting Requirements Right

    - by Tim Murphy
    Originally posted on: http://geekswithblogs.net/tmurphy/archive/2013/10/28/getting-requirements-right.aspxI had a meeting with a stakeholder who stated “I bet you wish I wasn’t in these meetings”.  She said this because she kept changing what we thought the end product should look like.  My reply was that it would be much worse if she came in at the end of the project and told us we had just built the wrong solution. You have to take the time to get the requirements right.  Be honest with all involved parties as to the amount of time it is taking to refine the requirements.  The only thing worse than wrong requirements is a surprise in budget overages.  If you give open visibility to your progress then management has the ability to shift priorities if needed. In order to capture the best requirements use different approaches to help your stakeholders to articulate their needs.  Use mock ups and matrix spread sheets to allow them to visualize and confirm that everyone has the same understanding.  The goals isn’t to record every last detail, but to have the major landmarks identified so there are fewer surprises along the way. Help the team members to understand that you all have the same goal.  You want to create the best possible solution for the given business problem.  If you do this everyone involved will do there best to outline a picture of what is to be built and you will be able to design an appropriate solution to fill those needs more easily. Technorati Tags: requirements gathering,PSC Group,PSC

    Read the article

  • Using javascript to limit survey choices to three unique values

    - by leanne
    I'm required to use a limited survey application, and have to adapt the provided code to meet more advanced functionality. I need to create a weighted ranking question, so users can select their top three choices and the data will go into the survey application and be accessible in the survey reports. The application only supports 2 types of questions (text fill & multiple choice) but I can alter the code, as long as it still sends the form data back to the survey application. The code is set up so it will show a drop-down menu of 0-3 for each option. Now I want to limit the user's choices so they can only select one "1" "2" or "3", three choices total. Ideally, if the user already had "2" selected for one option and they tried to select it for another option, it would set the first "2" as "0" or blank. Is this possible to do with javascript? If so, does anyone know of a site that might show code like this, or provide similar enough examples that I could adapt it? Current code here: <html> <head><title>Survey</title></head> <!-- Changes - remove br to put dropdown next to text for each item. Switch text & dropdown order for each item. - add comments to separate each question - removed blue title font - add instructions Goals - limit choices to one 1 one 2 and one 3, three choices total. --> <link href="---" rel="stylesheet" type="text/css"> <body bgcolor="#3c76a3"> <!-- TRANSITIONAL DIALOG BOX --> <table border="0" align="center" cellpadding="0" cellspacing="0" style="background-attachment: scroll; background-color: #3c76a3; background-repeat: no-repeat; background-position: left top;" bgcolor="#3c76a3" topmargin="0" marginwidth="0" marginheight="0" width="100%" height="100%"> <tr> <td> <table border="0" align="center" cellpadding="0" cellspacing="0" id="survey"> <tr> <td><p>&nbsp;</p> <!-- HEADER END --> <!-- FORM START TAG --><form name="survey" action="---" method="POST"> <FONT face="Verdana, Arial, Helvetica, sans-serif"> <b>survey</b><hr> <!-- 1 --> <input type=hidden name="Buy R.J. a DeLorean_multiple_answers" value="one"> <font size=2><select name="Buy R.J. a DeLorean" SIZE=1> <option value=""> <option value="0">0 <option value="1">1 <option value="2">2 <option value="3">3 </select></font> <input type="hidden" name="Buy R.J. a DeLorean_help" value=""> <b><font size=2>Buy R.J. a DeLorean</font></b> <hr size=1> <!-- 2 --> <input type=hidden name="Fill Lisa's office with marshmallows._multiple_answers" value="one"> <font size=2><select name="Fill Lisa's office with marshmallows." SIZE=1> <option value=""> <option value="0">0 <option value="1">1 <option value="2">2 <option value="3">3 </select></font> <input type="hidden" name="Fill Lisa's office with marshmallows._help" value=""> <b><font size=2>Fill Lisa's office with marshmallows.</font></b> <hr size=1> <!-- 3 --> <input type=hidden name="Install a beer fridge in everyone's filing cabinets._multiple_answers" value="one"> <font size=2><select name="Install a beer fridge in everyone's filing cabinets." SIZE=1> <option value=""> <option value="0">0 <option value="1">1 <option value="2">2 <option value="3">3 </select></font> <input type="hidden" name="Install a beer fridge in everyone's filing cabinets._help" value=""> <b><font size=2>Install a beer fridge in everyone's filing cabinets.</font></b> <hr size=1> <!-- 4 --> <input type=hidden name="Buy a company Cessna_multiple_answers" value="one"> <font size=2><select name="Buy a company Cessna" SIZE=1> <option value=""> <option value="0">0 <option value="1">1 <option value="2">2 <option value="3">3 </select></font> <input type="hidden" name="Buy a company Cessna_help" value=""> <b><font size=2>Buy a company Cessna</font></b><br> <hr size=1> <!-- 5 --> <input type=hidden name="Replace Conf2's chairs with miniature ponies._multiple_answers" value="one"> <font size=2><select name="Replace Conf2's chairs with miniature ponies." SIZE=1> <option value=""> <option value="0">0 <option value="1">1 <option value="2">2 <option value="3">3 </select></font> <input type="hidden" name="Replace Conf2's chairs with miniature ponies._help" value=""> <b><font size=2>Replace Conf2's chairs with miniature ponies.</font></b> <hr size=1> <input type="hidden" name="question_names" value="{Buy R.J. a DeLorean} {Fill Lisa's office with marshmallows.} {Install a beer fridge in everyone's filing cabinets.} {Buy a company Cessna} {Replace Conf2's chairs with miniature ponies.}"> <p align="right"><input type="image" BORDER=0 title="Save Changes" alt="Save Changes" src="---" name="button_save_changes"> <input type="hidden" name="showconfirm" value="T"> <input type="hidden" name="showresults" value="F"> <input type="hidden" name="preventdupesmemberid" value="T"> <input type="hidden" name="preventdupesip" value="F"> <input type="hidden" name="numberquestions" value="F"> <input type="hidden" name="destinationurl" value=""> <input type="hidden" name="original_survey_id" value="62"> <!-- FORM END TAG --></form> <!-- FOOTER START --> </td> </tr> </table> </td> </tr> </table> <!-- END HEADER --> </body> </html>

    Read the article

  • It’s nice to be important, but it’s more important to be nice

    - by BuckWoody
    I’ve been a little “preachy” lately, telling you that you should let people finish their sentences, and always check a problem out before you tell a user that their issue is “impossible”. Well, I’ll round that out with one more tip today. Keep in mind that all of these things are actions I’ve been guilty of, hopefully in the past. I’m kind of a “work in progress”. And yes, I know these tips are coming from someone who picks on people in presentations, but that is of course done in fun, and (hopefully) with the audience’s knowledge.   (No, this isn’t aimed at any one person or event in particular – I just see it happen a lot)   I’ve seen, unfortunately over and over, someone in authority react badly to someone who is incorrect, or at least perceived to be incorrect. This might manifest itself in a comment, post, question or whatever, but the point is that I’ve seen really intelligent people literally attack someone they view as getting something wrong. Don’t misunderstand me; if someone posts that you should always drop a production database in the middle of the day I think you should certainly speak up and mention that this might be a bad idea!  No, I’m talking about generalizations or even incorrect statements done in good faith. Let me explain with an example.   Suppose someone makes the statement: “If you don’t have enough space on your system, you can just use a DBCC command to shrink the database”. Let’s take two responses to this statement.   Response One: “That’s insane. Everyone knows that shrinking a database is a stupid idea, you’re just going to fragment your indexes all over the place.” Response Two: “That’s an interesting take – in my experience and from what I’ve read here (someurl.com) I think this might not be a universal best practice.”   Of course, both responses let the person making the statement and those reading it know that you don’t agree, and that it’s probably wrong. But the person you responded to and the general audience hearing you (or reading your response) might form two different opinions of you.   The first response says to me “this person really needs to be right, and takes arguments personally. They aren’t thinking of the other person at all, or the folks reading or hearing the exchange. They turned an incorrect technical statement into a personal attack. They haven’t left the other party any room to ‘save face’, and they have potentially turned what could be a positive learning experience for everyone into a negative. Also, they sound more than just a little arrogant.”   The second response says to me “this person has left room for everyone to save face, has presented evidence to the contrary and is thinking about moving the ball forward and getting it right rather than attacking someone for getting it wrong.” It’s the idea of questioning a statement rather than attacking a person.   Perhaps you have a different take. Maybe you think the “direct” approach is best – and maybe that’s worked for you. Something to consider is what you’ve really accomplished while using that first method. Sure, the info you provide is correct, and perhaps someone out there won’t shrink a database because of your response – but perhaps you’ve turned a lot more people off, and now they won’t listen to your other valuable information. You’ll be an expert, but another one of the nameless, arrogant jerks in technology. And I don’t think anyone likes to be thought of that way.   OK, I’ll get down off of the high-horse now. And I’ll keep the title of this entry (said to me by my grandmother when I was a little kid) in mind when I dismount. Share this post: email it! | bookmark it! | digg it! | reddit! | kick it! | live it!

    Read the article

  • It’s nice to be important, but it’s more important to be nice

    - by BuckWoody
    I’ve been a little “preachy” lately, telling you that you should let people finish their sentences, and always check a problem out before you tell a user that their issue is “impossible”. Well, I’ll round that out with one more tip today. Keep in mind that all of these things are actions I’ve been guilty of, hopefully in the past. I’m kind of a “work in progress”. And yes, I know these tips are coming from someone who picks on people in presentations, but that is of course done in fun, and (hopefully) with the audience’s knowledge.   (No, this isn’t aimed at any one person or event in particular – I just see it happen a lot)   I’ve seen, unfortunately over and over, someone in authority react badly to someone who is incorrect, or at least perceived to be incorrect. This might manifest itself in a comment, post, question or whatever, but the point is that I’ve seen really intelligent people literally attack someone they view as getting something wrong. Don’t misunderstand me; if someone posts that you should always drop a production database in the middle of the day I think you should certainly speak up and mention that this might be a bad idea!  No, I’m talking about generalizations or even incorrect statements done in good faith. Let me explain with an example.   Suppose someone makes the statement: “If you don’t have enough space on your system, you can just use a DBCC command to shrink the database”. Let’s take two responses to this statement.   Response One: “That’s insane. Everyone knows that shrinking a database is a stupid idea, you’re just going to fragment your indexes all over the place.” Response Two: “That’s an interesting take – in my experience and from what I’ve read here (someurl.com) I think this might not be a universal best practice.”   Of course, both responses let the person making the statement and those reading it know that you don’t agree, and that it’s probably wrong. But the person you responded to and the general audience hearing you (or reading your response) might form two different opinions of you.   The first response says to me “this person really needs to be right, and takes arguments personally. They aren’t thinking of the other person at all, or the folks reading or hearing the exchange. They turned an incorrect technical statement into a personal attack. They haven’t left the other party any room to ‘save face’, and they have potentially turned what could be a positive learning experience for everyone into a negative. Also, they sound more than just a little arrogant.”   The second response says to me “this person has left room for everyone to save face, has presented evidence to the contrary and is thinking about moving the ball forward and getting it right rather than attacking someone for getting it wrong.” It’s the idea of questioning a statement rather than attacking a person.   Perhaps you have a different take. Maybe you think the “direct” approach is best – and maybe that’s worked for you. Something to consider is what you’ve really accomplished while using that first method. Sure, the info you provide is correct, and perhaps someone out there won’t shrink a database because of your response – but perhaps you’ve turned a lot more people off, and now they won’t listen to your other valuable information. You’ll be an expert, but another one of the nameless, arrogant jerks in technology. And I don’t think anyone likes to be thought of that way.   OK, I’ll get down off of the high-horse now. And I’ll keep the title of this entry (said to me by my grandmother when I was a little kid) in mind when I dismount. Share this post: email it! | bookmark it! | digg it! | reddit! | kick it! | live it!

    Read the article

  • Silverlight Cream for January 11, 2011 -- #1024

    - by Dave Campbell
    1,000 blogposts is quite a few, but to die-hard geeks, 1000 isn't the number... 1K is the number, and today is my 1K blogpost! I've been working up to this for at least 11 months. Way back at MIX10, I approached some vendors about an idea I had. A month ago I contacted them and others, and everyone I contacted was very generous and supportive of my idea. My idea was not to run a contest, but blog as normal, and whoever ended up on my 1K post would get some swag... and I set a cut-off at 13 posts. So... blogging normally, I had some submittals, and then ran my normal process to pick up the next posts until I hit a total of 13. To provide a distribution channel for the swag, everyone on the list, please send me your snail mail (T-shirts) and email (licenses) addresses as soon as possible.   I'd like to thank the following generous sponsors for their contributions to my fun (in alphabetic order): and Rachel Hawley for contributing 4 Silverlight control sets First Floor Software and Koen Zwikstra for contributing 13 licenses for Silverlight Spy and Sara Faatz/Jason Beres for contributing 13 licenses for Silverlight Data Visualization controls and Svetla Stoycheva for contributing T-Shirts for everyone on the post and Ina Tontcheva for contributing 13 licenses for RadControls for Silverlight + RadControls for Windows Phone and Charlene Kozlan for contributing 1 combopack standard, 2 DataGrid for Silverlight, and 2 Listbox for Silverlight Standard And now finally...in this Issue: Nigel Sampson, Jeremy Likness, Dan Wahlin, Kunal Chowdhurry, Alex Knight, Wei-Meng Lee, Michael Crump, Jesse Liberty, Peter Kuhn, Michael Washington, Tau Sick, Max Paulousky, Damian Schenkelman Above the Fold: Silverlight: "Demystifying Silverlight Dependency Properties" Dan Wahlin WP7: "Using Windows Phone Gestures as Triggers" Nigel Sampson Expression Blend: "PathListBox: making data look cool" Alex Knight From SilverlightCream.com: Using Windows Phone Gestures as Triggers Nigel Sampson blogged about WP7 Gestures, the Toolkit, and using Gestures as Triggers, and actually makes it looks simple :) Jounce Part 9: Static and Dynamic Module Management Jeremy Likness has episode 9 of his explanation of his MVVM framework, Jounce, up... and a big discussion of Modules and Module Management from a Jounce perspective. Demystifying Silverlight Dependency Properties Dan Wahlin takes a page from one of his teaching opportunities, and shares his knowledge of Dependency Properties with us... beginning with what they are, defining them in code, and demonstrating their use. Customizing Silverlight ChildWindow Style using Blend Kunal Chowdhurry has a great post up about getting your Child Windows to match the look & feel of the rest of youra app... plus a bunch of Blend goodness thrown in. PathListBox: making data look cool File this post by Alex Knight in the 'holy crap' file along with the others in this series! ... just check out that cool Ticker Style Path ListBox at the top of the blog... too cool! Web Access in Windows Phone 7 Apps Wei-Meng Lee has the 3rd part of his series on WP7 development up and in this one is discussing Web Access... I mean *discussing* it... tons of detail, code, and explanation... great post. Prevent your Silverlight XAP file from caching in your browser. Michael Crump helps relieve stress on Silverlight developers everywhere by exploring how to avoid caching of your XAP in the browser... (WPFS) MVVM Light Toolkit: Soup To Nuts Part I Jesse Liberty continues his Windows Phone from Scratch series with a new segment exploring Laurent Bugnion's MVVMLight Toolkit beginning with acquiring and installing the toolkit, then proceeds to discuss linking the View and ViewModel, the ViewModel Locator, and page navigation. Silverlight: Making a DateTimePicker Peter Kuhn attacks a problem that crops up on the forums a lot -- a DateTimePicker control for Silverlight... following the "It's so simple to build one yourself" advice, he did so, and provides the code for all of us! Windows Phone 7 Animated Button Press Michael Washington took exception to button presses that gave no visual feedback and produced a behavior that does just that. Using TweetSharp in a Windows Phone 7 app Tau Sick demonstrates using TweetSharp to put a twitter feed into a WP7 app, as he did in "Hangover Helper"... all the instructions from getting Tweeetshaprt to the code necessary. Bindable Application Bar Extensions for Windows Phone 7 Max Paulousky has a post discussing some real extensions to the ApplicationBar for WP7.. he begins with a bindable application bar by Nicolas Humann that I've missed, probably because his blog is in French... and extends it to allow using DelegateCommand. How to: Load Prism modules packaged in a separate XAP file in an OOB application Damian Schenkelman posts about Prism, AppModules in separate XAPs and running OOB... if you've tried this, you know it's a hassle.. Damian has the solution. Stay in the 'Light! Twitter SilverlightNews | Twitter WynApse | WynApse.com | Tagged Posts | SilverlightCream Join me @ SilverlightCream | Phoenix Silverlight User Group Technorati Tags: Silverlight    Silverlight 3    Silverlight 4    Windows Phone MIX10

    Read the article

  • Cowboy Agile?

    - by Robert May
    In a previous post, I outlined the rules of Scrum.  This post details one of those rules. I’ve often heard similar phrases around Scrum that clue me in to someone who doesn’t understand Scrum.  The phrases go something like this: “We don’t do Agile because the idea of letting people just do whatever they want is wrong.  We believe in a more structured approach.” (i.e. Work is Prison, and I’m the Warden!) “I love Agile.  Agile lets us do whatever we want!” (Cowboy Agile?) “We’re Agile, but we use a process that I’ve created.” (Cowboy Agile?) All of those phrases have one thing in common:  The assumption that Agile, and I mean Scrum, lets you do whatever you want.  This is simply not true. Executing Scrum properly requires more dedication, rigor, and diligence than happens in most traditional development methods. Scrum and Waterfall Compared Since Scrum and Waterfall are two of the most commonly used methodologies, a little bit of contrasting and comparing is in order. Waterfall Scrum A project manager defines all tasks and then manages the tasks that team members are working on. The team members define the tasks and estimates of the stories for the current iteration.  Any team member may work on any task in the iteration. Usually only a few milestones that need to be met, the milestones are measured in months, and these milestones are expected to be missed.  Little work is ever done to improve estimates and poor estimators can hide behind high estimates. Stories must be delivered every iteration, milestones are measured in hours, and the team is expected to figure out why their estimates were wrong, even when they were under.  Repeated misses can get the entire team fired. Partially completed work is normal. Partially completed work doesn’t count. Nobody knows the task you’re working on. Everyone knows what you’re working on, whether or not you’re making progress and how much longer you think its going to take, in hours. Little requirement to show working code.  Prototypes are ok. Working code must be shown each iteration.  No smoke and mirrors allowed.  Testing is done in lengthy cycles at the end of development.  Developers aren’t held accountable. Testing is part of the team.  If the testers don’t accept the story as complete, the team can’t count it.  Complete means that the story’s functionality works as designed.  The team can’t have any open defects on the story. Velocity is rarely truly measured and difficult to evaluate. Velocity is integral to the process and can be seen at a glance and everyone in the company knows what it is. A business analyst writes requirements.  Designers mock up screens.  Developers hide behind “I did it just like the spec doc told me to and made the screen exactly like the picture” Developers are expected to collaborate in real time.  If a design is bad or lacks needed details, the developers are required to get it right in the iteration, because all software must be functional.  Designers and Business Analysts are part of the team and must do their work in iterations slightly ahead of the developers. Upper Management is often surprised.  “You told me things were going well two months ago!” Management receives updates at the end of every iteration showing them exactly what the team did and how that compares to what' is remaining in the backlog.  Managers know every iteration what their money is buying. Status meetings are rare or don’t occur.  Email is a primary form of communication. Teams coordinate every single day with each other and use other high bandwidth communication channels to make sure they’re making progress.  Email is used only as a last resort.  Instead, team members stand up, walk to each other, and talk, face to face.  If that’s not possible, they pick up the phone. IF someone asks what happened, its at the end of a lengthy development cycle measured in months, and nobody really knows why it happened. Someone asks what happened every iteration.  The team talks about what happened, and then adapts to make sure that what happened either never happens again or happens every time.   That’s probably enough for now.  As you can see, a lot is required of Scrum teams! One of the key differences in Scrum is that the burden for many activities is shifted to a group of people who share responsibility, instead of a single person having responsibility.  This is a very good thing, since small groups usually come up with better and more insightful work than single individuals.  This shift also results in better velocity.  Team members can take vacations and the rest of the team simply picks up the slack.  With Waterfall, if a key team member takes a vacation, delays can ensue. Scrum requires much more out of every team member and as a result, Scrum teams outperform non-Scrum teams working 60 hour weeks. Recommended Reading Everyone considering Scrum should read Mike Cohn’s excellent book, User Stories Applied. Technorati Tags: Agile,Scrum,Waterfall

    Read the article

  • How You Helped Shape Java EE 7...

    - by reza_rahman
    I have been working with the JCP in various roles since EJB 3/Java EE 5 (much of it on my own time), eventually culminating in my decision to accept my current role at Oracle (despite it's inevitable set of unique challenges, a role I find by and large positive and fulfilling). During these years, it has always been clear to me that pretty much everyone in the JCP genuinely cares about openness, feedback and developer participation. Perhaps the most visible sign to date of this high regard for grassroots level input is a survey on Java EE 7 gathered a few months ago. The survey was designed to get open feedback on a number of critical issues central to the Java EE 7 umbrella specification including what APIs to include in the standard. When we started the survey, I don't think anyone was certain what the level of participation from developers would really be. I also think everyone was pleasantly surprised that a large number of developers (around 1100) took the time out to vote on these very important issues that could impact their own professional life. And it wasn't just a matter of the quantity of responses. I was particularly impressed with the quality of the comments made through the survey (some of which I'll try to do justice to below). With Java EE 7 under our belt and the horizons for Java EE 8 emerging, this is a good time to thank everyone that took the survey once again for their thoughts and let you know what the impact of your voice actually was. As an aside, you may be happy to know that we are working hard behind the scenes to try to put together a similar survey to help kick off the agenda for Java EE 8 (although this is by no means certain). I'll break things down by the questions asked in the survey, the responses and the resulting change in the specification. APIs to Add to Java EE 7 Full/Web Profile The first question in the survey asked which of four new candidate APIs (WebSocket, JSON-P, JBatch and JCache) should be added to the Java EE 7 Full and Web profile respectively. Developers by and large wanted all the new APIs added to the full platform. The comments expressed particularly strong support for WebSocket and JCache. Others expressed dissatisfaction over the lack of a JSON binding (as opposed to JSON processing) API. WebSocket, JSON-P and JBatch are now part of Java EE 7. In addition, the long-awaited Java EE Concurrency Utilities API was also included in the Full Profile. Unfortunately, JCache was not finalized in time for Java EE 7 and the decision was made not to hold up the Java EE release any longer. JCache continues to move forward strongly and will very likely be included in Java EE 8 (it will be available much sooner than Java EE 8 to boot). An emergent standard for JSON-B is also a strong possibility for Java EE 8. When it came to the Web Profile, developers were supportive of adding WebSocket and JSON-P, but not JBatch and JCache. Both WebSocket and JSON-P are now part of the Web Profile, now also including the already popular JAX-RS API. Enabling CDI by Default The second question asked whether CDI should be enabled in Java EE by default. The overwhelming majority of developers supported the default enablement of CDI. In addition, developers expressed a desire for better CDI/Java EE alignment (with regards to EJB and JSF in particular). Some developers expressed legitimate concerns over the performance implications of enabling CDI globally as well as the potential conflict with other JSR 330 implementations like Spring and Guice. CDI is enabled by default in Java EE 7. Respecting the legitimate concerns, CDI 1.1 was very careful to add additional controls around component scanning. While a lot of work was done in Java EE 6 and Java EE 7 around CDI alignment, further alignment is under serious consideration for Java EE 8. Consistent Usage of @Inject The third question was around using CDI/JSR 330 @Inject consistently vs. allowing JSRs to create their own injection annotations (e.g. @BatchContext). A majority of developers wanted consistent usage of @Inject. The comments again reflected a strong desire for CDI/Java EE alignment. A lot of emphasis in Java EE 7 was put into using @Inject consistently. For example, the JBatch specification is focused on using @Inject wherever possible. JAX-RS remains an exception with it's existing custom injection annotations. However, the JAX-RS specification leads understand the importance of eventual convergence, hopefully in Java EE 8. Expanding the Use of @Stereotype The fourth question was about expanding CDI @Stereotype to cover annotations across Java EE beyond just CDI. A solid majority of developers supported the idea of making @Stereotype more universal in Java EE. The comments maintained the general theme of strong support for CDI/Java EE alignment Unfortunately, there was not enough time and resources in Java EE 7 to implement this fairly pervasive feature. However, it remains a serious consideration for Java EE 8. Expanding Interceptor Use The final set of questions was about expanding interceptors further across Java EE. Developers strongly supported the concept. Along with injection, interceptors are now supported across all Java EE 7 components including Servlets, Filters, Listeners, JAX-WS endpoints, JAX-RS resources, WebSocket endpoints and so on. I hope you are encouraged by how your input to the survey helped shape Java EE 7 and continues to shape Java EE 8. Participating in these sorts of surveys is of course just one way of contributing to Java EE. Another great way to stay involved is the Adopt-A-JSR Program. A large number of developers are already participating through their local JUGs. You could of course become a Java EE JSR expert group member or observer. You should stay tuned to The Aquarium for the progress of Java EE 8 JSRs if that's something you want to look into...

    Read the article

  • Windows CE Chat Transcript (March 30, 2010)

    - by Bruce Eitman
    For those of you who missed the chat today, here is the raw transcript.   By raw, I mean that I copied and pasted the discussion without any edits. This is divided into two parts, the top part is the answers from the Microsoft Experts and the bottom part is the questions from the audience. Answers from Microsoft:   Karel Danihelka [MS] (Expert)[2010-3-30 12:2]: Hi everyone, my name is Karel Danihelka and I am developer in partner response team. Sing Wee [MS] (Expert)[2010-3-30 12:2]: Hi, I'm Sing Wee, part of the CoreOS/BSP Test Team. GLanger_MS (Expert)[2010-3-30 12:2]: Hi, I'm Glen Langer, program manager on the Core Team. Karel Danihelka [MS] (Expert)[2010-3-30 12:3]: Q: I need to implement hardware timers on my windows CE 6.0 device to trigger events at microsecond intervals. Where should i start? A: Until you are using CPU with GHz frequency your only chance is use interrupt handler and implement all funcionality there. But it will be really tricky and may reduce system performance. If period will be near to millisecond timeframe you can use normal thread wait for event pattern. Karel Danihelka [MS] (Expert)[2010-3-30 12:5]: Q: I want to partition my NAND Flash device. One partition to use for hive ragistry and the other for the apps and data. The only way to do it is programmatically or setting some registry values ? A: It need to be set in registry - generally you need mark this partition as boot partition. Karel Danihelka [MS] (Expert)[2010-3-30 12:7]: Q: My CPU is Intel celeron M processor 1Ghz. A: In this case you can try use normal approach - in interrupt handler return SYSINTR and start thread in device driver which will spin thread waiting on event attached to this SYSINTR. Karel Danihelka [MS] (Expert)[2010-3-30 12:7]: Q: If i need to implement it using interrupt handlers, What are all the files that I should look at? A: Good quesiton - I would recommend documentation and there was BSP development book to download for free. mikehall_ms (Moderator)[2010-3-30 12:8]: Q: Hi guys, what's the formal way to report bugs back to the core team / product team? The mechanism of calling the support phone number every time is really onerous and time-consuming. Is there another mechanism? A: Using product support is the formal way to report bugs/issues - Product support can then create an issue that can be tracked. Karel Danihelka [MS] (Expert)[2010-3-30 12:9]: Q: But the operation for creating the partitions ? A: This is tricky - if you will make it autopartition & autoformat it will be created by filesystem. But generally it depends on your boot loader. mikehall_ms (Moderator)[2010-3-30 12:10]: Q: Is Windows Phone 7 related to Windows CE? If so, can you tell me what version of Windows CE is the basis? Is it in fact the new version of Windows Mobile? A: At MIX 2010 Charlie Kindel presented a session that described some of the core technologies that make up Windows Phone 7 Series, including the underlying operating system (Windows CE) and the new ISV programming model based on Silverlight and .NET - check out the Mix Online Videos to get more information. davbo-msft (Moderator)[2010-3-30 12:10]: Q: Is Windows Phone 7 related to Windows CE? If so, can you tell me what version of Windows CE is the basis? Is it in fact the new version of Windows Mobile? A: This forum is to discussed released products in the industry. Windows Mobile & Windows CE are based on the same Windows CE Kernel/system. Windows CE is focused on deliverying the OS for embedded customers in the market where Windows Mobile is focused on deliverying compelling Windows Phone platform. davbo-msft (Moderator)[2010-3-30 12:11]: Q: Is Windows Phone 7 related to Windows CE? If so, can you tell me what version of Windows CE is the basis? Is it in fact the new version of Windows Mobile? A: http://en.wikipedia.org/wiki/Windows_CE Wikipedia gives a good breakdown of the version history. Travis Hobrla [MS] (Expert)[2010-3-30 12:13]: Q: I created a OS design with KITL and kernel debugger enabled. But I am unable to connect to the target for debugging. I am getting the following error when i try to connect with the device. PB Debugger Cannot initialize the Kernel Debugger. PB Debugger Debugger could not initialize connection. PB Debugger The Kernel Debugger is waiting to connect with target. PB Debugger The Kernel Debugger has been disconnected successfully. A: One possibility is that a rogue cesvchost.exe has co-opted the debugger. I am assuming this is CE 6.0? Can you try exiting visual studio and manually killing the cesvchost.exe process from the Task Manager? davbo-msft (Moderator)[2010-3-30 12:14]: Q: Hi guys, what's the formal way to report bugs back to the core team / product team? The mechanism of calling the support phone number every time is really onerous and time-consuming. Is there another mechanism? A: For info on contacting Microsoft support refer to the support page on the Embedded website: http://msdn.microsoft.com/en-us/windowsembedded/dd897633.aspx Sing Wee [MS] (Expert)[2010-3-30 12:16]: Q: Do u mean ISR/IST implementation? How can i register an interrupt? What kind of interrupt should i register? A: A good introduction to interrupts in WinCE 6.0 can be found here (aside from the documentation on MSDN): http://download.microsoft.com/download/9/c/f/9cffaa58-4000-48d6-a4b2-5fed9e4e6410/Chapter%206%20-%20Developing%20Device%20Drivers.pdf mikehall_ms (Moderator)[2010-3-30 12:16]: Q: What will be different in Windows Compact 7 from CE 6.0? A: Unfortunately we cannot discuss unreleased products on this chat - keep an eye on the Windows Embedded web site and blogs to keep up to date with product announcements. Travis Hobrla [MS] (Expert)[2010-3-30 12:16]: Q: I am using CE 6.0. There is no cesvchost process running in my system. A: What operating system are you using? Karel Danihelka [MS] (Expert)[2010-3-30 12:16]: Q: So...I have to modify file system code to create 2 partition at system startup ?!! I haven't understood.... A: You don't need to modify code, there are registry settings to achive this (look to documentation). But you may need to create partition table in boot loader. Unfortunatelly there isn't simple way how to do it. davbo-msft (Moderator)[2010-3-30 12:18]: Q: I would like to get a handle to a Silverlight screen section, is that possiable? A: Windows Embedded CE 6.0 R3 includes Sliverlight for Windows Embedded. Refer to New Features overview on the embedded web site. http://www.microsoft.com/windowsembedded/en-us/products/windowsce/default.mspx. Silverlight - The power of Silverlight brought to Windows Embedded CE to create rich applications and user interfaces is new part of Windows CE Embedded. mikehall_ms (Moderator)[2010-3-30 12:20]: Q: The link for developing device drivers is not working. can u please check that? A: http://msdn.microsoft.com/en-us/library/ms923714.aspx davbo-msft (Moderator)[2010-3-30 12:20]: Q: I would like to get a handle to a Silverlight screen section, is that possiable? A: Sorry misunderstood the question I thought you were asking if embedded CE could handle Silverlight. Please repost so that the question goes back into the active queue because once answered no way to put the status back to open. Travis Hobrla [MS] (Expert)[2010-3-30 12:21]: Q: sorry! Windows XP SP3 A: Can you try exiting VS2005 and confirming cesvchost.exe is not running, then renaming C:\Documents and Settings\USERNAME\Local Settings\Application Data\Microsoft\CoreCon\1.0 to 1.0_backup, then restarting VS2005? Sing Wee [MS] (Expert)[2010-3-30 12:24]: Q: Can I have the book's name please? A: I believe the downloadable version is related to the last link I sent. If you go to the following website, I believe you can download the whole thing: http://msdn.microsoft.com/en-us/windowsembedded/ce/cc294468.aspx davbo-msft (Moderator)[2010-3-30 12:24]: Q: If one has an image on a Silverlight page, it seems to be cached. How would one refresh that cache after changing the underlying image? A: change the URI of the image or use a writeable bitmap if they want to manually toggle the pixels Sing Wee [MS] (Expert)[2010-3-30 12:25]: A: Whoops, hit [ENTER] too early. On the right side, you'll see there an "Exam Preparation Kit" link that can be downloaded in several different languages. Sing Wee [MS] (Expert)[2010-3-30 12:25]: Q: Can I have the book's name please? A: Whoops, hit [ENTER] too early. On the right side, you'll see there an "Exam Preparation Kit" link that can be downloaded in several different languages. Karel Danihelka [MS] (Expert)[2010-3-30 12:26]: Q: I have a NAND Flash on my target device. On this flash I have the hive registry and an application.I have observed that when the NAND flash is fully, the system startup time is longer....is there a degradation of NAND use that influences the startup time ? Why ? A: Yes - on boot flash abstraction library (old one) read metadata from all sectors to rebuild physical - logical mapping table. davbo-msft (Moderator)[2010-3-30 12:27]: Q: I would like to get a handle to a Silverlight screen section, is that possiable? A: Need addition info on this question. Can you provide more details on what you are trying to do in Silverlight? davbo-msft (Moderator)[2010-3-30 12:27]: Q: If one has an image on a Silverlight page, it seems to be cached. How would one refresh that cache after changing the underlying image? A: Additonal Info: if you want to manually touch the pixels use WriteableBitmap if you want to use the underlying HWND then use IXRVisualHost::GetHWND() davbo-msft (Moderator)[2010-3-30 12:28]: Q: Writable bitmap, is there an example of the syntax? A: if you want to manually touch the pixels use WriteableBitmap if you want to use the underlying HWND then use IXRVisualHost::GetHWND() davbo-msft (Moderator)[2010-3-30 12:29]: Q: I would like to get a handle to a Silverlight screen section, is that possiable? A: Can I get more information about this question about what you are trying to accomplish in Silverlight? davbo-msft (Moderator)[2010-3-30 12:31]: Q: IXRVisualHost::GetHWND() exactly what I needed Thanks, A: Your welcome Sing Wee [MS] (Expert)[2010-3-30 12:31]: Q: ok. thanks for the book's link A: No problem. Travis Hobrla [MS] (Expert)[2010-3-30 12:32]: Q: Typically for SoC devices you name your hardware specific libraries in the form "SOCDIRNAME_LIBNAME". In our platform "OMAP35XX_TPS659XX_TI_V1" if you do this we cause the catalog parser to die... For example if we have a library "Musbfn_OMAP35XX_TPS659XX_TI_V1.dll" entering this in the catalogs pbcxml file in a <module> section causes the XML parser to fail with : Error 3 The 'urn:Microsoft.PlatformBuilder/Catalog:Module' element is        invalid - The value '012345678901234567890123456789.dll' is invalid         according to its datatype         'urn:Microsoft.PlatformBuilder/Catalog:CatalogFileName' - The actual         length is greater than the MaxLength value. A: There are a couple workarounds I can think of. I believe the Module element is only used when doing SYSGEN parsing to make sure dependent SYSGENs are present when the item is selected, so I believe it is optional to the catalog. The other obvious workaround is to shorten the soc name. I realize neither of these solutions is ideal. This is not something we anticipated when we tested CE6.0, sorry. Travis Hobrla [MS] (Expert)[2010-3-30 12:33]: Q: I am getting this error only when I select the KdStub as the debugger in Target device connectivity. A: Right, but KdStub is the debugger that you should use. Have you tried the steps I suggested? Travis Hobrla [MS] (Expert)[2010-3-30 12:36]: Q: If I select Active KTIL, My OS doesn't boots. It says "loading NK.EXE at 0x<xxxxx> location" after that nothing comes in the debug log. A: Can you look at the serial debug output and see what is happening there? Often it can give you a clue to the KITL driver malfunctioning. Travis Hobrla [MS] (Expert)[2010-3-30 12:38]: Q: I have tried that and I am getting the same error. A: I am assuming you have a device created in Target -> Connectivity Options in Platform Builder. What are the Kernel download / Kernel transport for your device? Travis Hobrla [MS] (Expert)[2010-3-30 12:40]: Q: KITL: *** Device Name CEPC56059 *** WARN: KITL will run in polling mode VBridge:: built on [Jul 10 2009] time [10:20:14] VBridgeInit()...TX = [16384] bytes -- Rx = [16384] bytes Tx buffer [0xA1B84860] to [0xA1B88860]. Rx buffer [0xA1B88880] to [0xA1B8C880]. VBridge:: NK add MAC: [0-60-65-2-DA-FB] Connecting to Desktop KITL: Connected host IP: 1 Port: 1086 .. this is the output of the serial debug A: This looks reasonable and does not give clues as to why boot would halt at that point. If you capture a network trace or turn on KITL debug zones via dpCurSettings in kitl.dll, do you see KITL active after this? Travis Hobrla [MS] (Expert)[2010-3-30 12:41]: Q: Both is happening via Ethernet. A: Only thing I have left to suggest is a Platform Builder installation Repair, then. Karel Danihelka [MS] (Expert)[2010-3-30 12:42]: Q: Hi, I saw that the ATADISK is quite generic and des not have any optimizations. Do you have any advice to consider while tryin to improve the performance of it? A: If I remember correctly sample code has support for some specific hardware controllers (little obsolete now). This should be good start point (if you will not decide take existing driver as sample and write you own). Travis Hobrla [MS] (Expert)[2010-3-30 12:44]: Q: I didn't do that. I have to try. A: I think that's the next valid step. You need to figure out whether KITL is hanging or the device - use instrumented serial debug messages and network trace to determine this. Sing Wee [MS] (Expert)[2010-3-30 12:46]: Q: KITL: *** Device Name CEPC56059 *** WARN: KITL will run in polling mode VBridge:: built on [Jul 10 2009] time [10:20:14] VBridgeInit()...TX = [16384] bytes -- Rx = [16384] bytes Tx buffer [0xA1B84860] to [0xA1B88860]. Rx buffer [0xA1B88880] to [0xA1B8C880]. VBridge:: NK add MAC: [0-60-65-2-DA-FB] Connecting to Desktop KITL: Connected host IP: 1 Port: 1086 .. this is the output of the serial debug A: Neo, have you by any chance tried looking into your firewall to see if it might be blocking traffic on any particular ports? Wireshark/netmon might be able to help you here if that's the issue. davbo-msft (Moderator)[2010-3-30 12:48]: Q: I lost spell check, how can i get it back A: Hello - can you give additional details about your question? Is this related to a Windows CE Embedded application? masatos_MSFT (Expert)[2010-3-30 12:51]: Q: When attempting to run the CETK cellcore tests the documentation states the pre-requisites include "stinger.ini", "ltk.ini" but windows CE doesn't provide these or document what they fully need to contain. Implicitly you also need "datatrans.xml" which isn't supplied. If you get around this error and steal these from Windows Mobile instead, when you try and run the CETK tests you get a data abort in radiometricsdll.dll. How should we invoke the cellcore parts of CETK? A: Hi Pev, what version of Windows CE and CETK are you using? I do not have the expertise to answer this question, but can find somebody who can. Travis Hobrla [MS] (Expert)[2010-3-30 12:52]: Q: I don't see a kitlcore.dll in my OS. is my debug image fails to load because of that? A: kitl.dll should be all that's needed, kitlcore.lib is linked into that. Travis Hobrla [MS] (Expert)[2010-3-30 12:55]: Q: I've got a platform (not developed by myself) where I2C bus support has to be provided through the OAL as the kernel needs to talk to devices such as the power management IC and gas gauge so a 'proper' I2C driver hanging off device manager isn't possible. This happens to be a polled driver, so obviously it hits the system hard when either under lots of traffic or an error condition occurs and the driver constantly polls. I originally thought that there was no straightforward way to make such code interrupt driven in the kernel (as it's a cludge) but I realised that that's exactly what ETHDBG drivers do. Is there any reason why I shouldn't have a go at implementing a similar mechanism for our kernel resident I2C driver? If not, are there any obvious pitfalls - I've not seen any other BSP's do this in the past... A: You can make a 'proper' driver that calls down into the OAL to do the actual I2C transactions. Alternatively you can build an interrupt-based version in the OAL where you handle everything in the ISR. There is nothing wrong with that so long as the rest of your drivers and app threads can handle longer times with interrupts off while you are servicing I2C interrupts. Sing Wee [MS] (Expert)[2010-3-30 12:55]: Q: I am having trouble with my mouse, I have the microsoft wireless mobile mouse 3000, when I push the scroll button I am suppose to have autoscroll instead it shows other web pages,Can you help me out tell me what to do!!! A: Sorry, this current chat is about Windows Embedded Compact. Hope you're able to find an answer to your question elsewhere. davbo-msft (Moderator)[2010-3-30 12:56]: Q: Is the Silverlight Animation "Spline" a BezierSpline? A: Spline - http://msdn.microsoft.com/en-us/library/ee501495.aspx<BR< a>>   masatos_MSFT (Expert)[2010-3-30 12:57]: Thanks for the info Pev. I will follow up with the CETK experts here and get back to you. davbo-msft (Moderator)[2010-3-30 12:59]: Q: Spline- bad link A: http://msdn.microsoft.com/en-us/library/ee501495.aspx davbo-msft (Moderator)[2010-3-30 13:0]: Q: Sorry, got to tirm the ">" A: No Worries http://msdn.microsoft.com/en-us/library/ee501495.aspx davbo-msft (Moderator)[2010-3-30 13:0]: Hello everyone, we are just about out of time. Thank you for joining us for our Windows Embedded CE 6.0 chat today! <http://www.Microsoft.com/Embedded>; A special thank you to the product group members for coming out. The transcript of today’s chat will be posted online as soon as possible, to <http://msdn.microsoft.com/en-us/chats>;. We’ll see you again for another chat next month. Please check <http://msdn.microsoft.com/en-us/chats>; for the list of upcoming chats. If you still have unanswered questions, let me suggest that you post them on one of our newsgroups on <http://msdn.microsoft.com/en-us/windowsembedded/ce/default.aspx> -Windows Embedded CE 6.0 R3 Now Available! <http://msdn.microsoft.com/windowsembedded/ce/dd630616.aspx>; davbo-msft (Moderator)[2010-3-30 13:1]: Q: hi everybody. I would like to know if there is something know about a bug in RTC API (VOIP), especially when using SIP. According the to the analysis with application verifyier there is a heap link in rtcdllmedia.dll. All of the unreleased chunks seem to have a size of 6560 bytes. A: I will follow up with the Networking Team for a response. davbo-msft (Moderator)[2010-3-30 13:1]: Q: Hi, we've problems with debugging of applications (= breakpoints in Platform Builder will be ignored) over KITL on Windows CE 5.0, if the PDB files are large (over 60MB). Are there any limitations to size of the PDB files? A: I will follow up with the tools team for a response and post with the transcript. Sing Wee [MS] (Expert)[2010-3-30 13:1]: Q: I am unable to use the target control in my development environment. any ideas? A: Make sure you have SYSGEN_SHELL=1 set in your build environment. davbo-msft (Moderator)[2010-3-30 13:3]: Q: what are the main differences between Object Store and RAM disk ? They are both in RAM...are there performance differences ? access differences ? A: I will follow up with the Core Team and get a response posted with the transcript to MSDN  The Questions   [2010-3-30 12:57]: Thanks for the info Pev. I will follow up with the CETK experts here and get back to you. [2010-3-30 12:59]:   [2010-3-30 13:0]:   [2010-3-30 13:0]: Hello everyone, we are just about out of time. Thank you for joining us for our Windows Embedded CE 6.0 chat today! <http://www.Microsoft.com/Embedded>; A special thank you to the product group members for coming out. The transcript of today’s chat will be posted online as soon as possible, to <http://msdn.microsoft.com/en-us/chats>;. We’ll see you again for another chat next month. Please check <http://msdn.microsoft.com/en-us/chats>; for the list of upcoming chats. If you still have unanswered questions, let me suggest that you post them on one of our newsgroups on <http://msdn.microsoft.com/en-us/windowsembedded/ce/default.aspx> -Windows Embedded CE 6.0 R3 Now Available! <http://msdn.microsoft.com/windowsembedded/ce/dd630616.aspx>; [2010-3-30 13:1]: [2010-3-30 13:1]: [2010-3-30 13:1]: [2010-3-30 13:3]: neo (Guest)[2010-3-30 11:37]: Hi all KellyG (Guest)[2010-3-30 11:37]: Hi KellyG (Guest)[2010-3-30 11:37]: I have a question unrelated to windows Ce embedded, can you please help me?? neo (Guest)[2010-3-30 11:38]: I need to implement hardware timers on my windows CE 6.0 device to trigger events at microsecond intervals! c neo (Guest)[2010-3-30 11:38]: yes. post it. May be i cud give a try KellyG (Guest)[2010-3-30 11:38]: My Product key listed on my tower is not the product key I need for microsoft office, but that is the only product key listed. neo (Guest)[2010-3-30 11:39]: I hope this is a chat for windows embedded. please post ur queries in office forums KellyG (Guest)[2010-3-30 11:39]: it is but i could not find a forum for office neo (Guest)[2010-3-30 11:40]: I think moderators will help u out. @ davbo-msft: can u help this guy? neo (Guest)[2010-3-30 11:41]: Q: I need to implement hardware timers on my windows CE 6.0 device to trigger events at microsecond intervals. Where should i start? davbo-msft (Moderator)[2010-3-30 11:50]: Our chat today covers the topic of Windows Embedded CE! 1. This chat will last for one hour. During this hour, our Experts will respond to as many questions as they can. Please understand that there may be some questions we cannot respond to due to lack of information or because the information is not yet public. 2. We encourage you to submit questions for our Experts. To do so, type your questions in the send box, select the “ask the Experts” box and click SEND. Questions sent directly to the Guest Chat room will not be answered by the Experts, but we encourage other community members to assist. 3. We ask that you stay on topic for the duration of the chat. This helps the Guests and Experts follow the conversation more easily. We invite you to ask off topic questions after this chat is over, but not during. 4. Please abide by the Chat Code of Conduct. Chat code of conduct: <http://msdn.microsoft.com/chats/chatroom.aspx?ctl=hlp#Conduct>; Pev (Guest)[2010-3-30 11:54]: Evening! davbo-msft (Moderator)[2010-3-30 11:54]: Hello everyone this is Dave Boyce - I worked in the Multimedia area for Windows CE. neo (Guest)[2010-3-30 11:55]: hello dave neo (Guest)[2010-3-30 11:55]: The chat code of conduct link is not working! Pev (Guest)[2010-3-30 11:56]: Best be polite just in case then ;-) neo (Guest)[2010-3-30 11:56]: davbo-msft (Moderator)[2010-3-30 11:57]: I'll check out the issue w/ the link paolopat (Guest)[2010-3-30 12:0]: Hello davbo-msft (Moderator)[2010-3-30 12:0]: We are pleased to welcome our Experts for today’s chat. I will have them introduce themselves now. Chat will begin in a couple of minutes. <http://www.Microsoft.com/Embedded>; paolopat (Guest)[2010-3-30 12:3]: Hello Experts ! neo (Guest)[2010-3-30 12:3]: Welcome all! paolopat (Guest)[2010-3-30 12:3]: Q: I want to partition my NAND Flash device. One partition to use for hive ragistry and the other for the apps and data. The only way to do it is programmatically or setting some registry values ? neo (Guest)[2010-3-30 12:3]: Q: I need to implement hardware timers on my windows CE 6.0 device to trigger events at microsecond intervals. Where should i start? neo (Guest)[2010-3-30 12:5]: Q: My CPU is Intel celeron M processor 1Ghz. Pev (Guest)[2010-3-30 12:5]: neo: if your silicon has multiple general purpose timers, pick one that's not in use for the system timer / profiler and set it up to trigger irqs for your purpose. You can't guarantee hard realtime type responses though... GarySwalling (Guest)[2010-3-30 12:5]: Q: Is Windows Phone 7 related to Windows CE? If so, can you tell me what version of Windows CE is the basis? Is it in fact the new version of Windows Mobile? Pev (Guest)[2010-3-30 12:6]: Q: Hi guys, what's the formal way to report bugs back to the core team / product team? The mechanism of calling the support phone number every time is really onerous and time-consuming. Is there another mechanism? paolopat (Guest)[2010-3-30 12:6]: Q: But the operation for creating the partitions ? neo (Guest)[2010-3-30 12:6]: Q: If i need to implement it using interrupt handlers, What are all the files that I should look at? GPM (Guest)[2010-3-30 12:6]: Q: I would like to get a handle to a Silverlight screen section, is that possiable? Jhony (Guest)[2010-3-30 12:7]: Q: I created a OS design with KITL and kernel debugger enabled. But I am unable to connect to the target for debugging. I am getting the following error when i try to connect with the device. PB Debugger Cannot initialize the Kernel Debugger. PB Debugger Debugger could not initialize connection. PB Debugger The Kernel Debugger is waiting to connect with target. PB Debugger The Kernel Debugger has been disconnected successfully. Charles (Guest)[2010-3-30 12:7]: What will be different in Windows Compact 7 from CE 6.0? neo (Guest)[2010-3-30 12:8]: Can I have the book's name please? kiefs_dev (Guest)[2010-3-30 12:8]: Q: hi everybody. I would like to know if there is something know about a bug in RTC API (VOIP), especially when using SIP. According the to the analysis with application verifyier there is a heap link in rtcdllmedia.dll. All of the unreleased chunks seem to have a size of 6560 bytes. paolopat (Guest)[2010-3-30 12:10]: Q: So...I have to modify file system code to create 2 partition at system startup ?!! I haven't understood.... neo (Guest)[2010-3-30 12:10]: Q: Do u mean ISR/IST implementation? How can i register an interrupt? What kind of interrupt should i register? neo (Guest)[2010-3-30 12:11]: Q: Can I have the book's name please? Charles (Guest)[2010-3-30 12:11]: Q: What will be different in Windows Compact 7 from CE 6.0? PaulT (Guest)[2010-3-30 12:11]: neo: I'd say that you really need the docs for YOUR BSP, not generic documents for BSPs in general. Each BSP may be architected differently. If you're using the CEPC BSP, then the documentation that comes with Platform Builder is a reasonable place to look. GPM (Guest)[2010-3-30 12:11]: Q: If one has an image on a Silverlight page, it seems to be cached. How would one refresh that cache after changing the underlying image? Elektrobit (Guest)[2010-3-30 12:12]: Q: Hi, we've problems with debugging of applications (= breakpoints in Platform Builder will be ignored) over KITL on Windows CE 5.0, if the PDB files are large (over 60MB). Are there any limitations to size of the PDB files? Jhony (Guest)[2010-3-30 12:15]: Q: I am using CE 6.0. There is no cesvchost process running in my system. alexquisi (Guest)[2010-3-30 12:15]: Q: Hi, I saw that the ATADISK is quite generic and des not have any optimizations. Do you have any advice to consider while tryin to improve the performance of it? Jhony (Guest)[2010-3-30 12:17]: Windows XP service pack 1 Jhony (Guest)[2010-3-30 12:17]: Q: sorry! Windows XP SP3 neo (Guest)[2010-3-30 12:19]: Q: The link for developing device drivers is not working. can u please check that? paolopat (Guest)[2010-3-30 12:20]: Q: I have a NAND Flash on my target device. On this flash I have the hive registry and an application.I have observed that when the NAND flash is fully, the system startup time is longer....is there a degradation of NAND use that influences the startup time ? Why ? Pev (Guest)[2010-3-30 12:20]: Q: When attempting to run the CETK cellcore tests the documentation states the pre-requisites include "stinger.ini", "ltk.ini" but windows CE doesn't provide these or document what they fully need to contain. Implicitly you also need "datatrans.xml" which isn't supplied. If you get around this error and steal these from Windows Mobile instead, when you try and run the CETK tests you get a data abort in radiometricsdll.dll. How should we invoke the cellcore parts of CETK? Pev (Guest)[2010-3-30 12:21]: Hi all, Pev (Guest)[2010-3-30 12:21]: oops Pev (Guest)[2010-3-30 12:21]: :-D Pev (Guest)[2010-3-30 12:24]: Typically for SoC devices you name your hardware specific libraries in the form "SOCDIRNAME_LIBNAME". In our platform "OMAP35XX_TPS659XX_TI_V1" if you do this we cause the catalog parser to die... For example if we have a library "Musbfn_OMAP35XX_TPS659XX_TI_V1.dll" entering this in the catalogs pbcxml file in a <module> section causes the XML parser to fail with : Pev (Guest)[2010-3-30 12:25]: Q: Error 3 The 'urn:Microsoft.PlatformBuilder/Catalog:Module' element is        invalid - The value '012345678901234567890123456789.dll' is invalid         according to its datatype         'urn:Microsoft.PlatformBuilder/Catalog:CatalogFileName' - The actual         length is greater than the MaxLength value. GPM (Guest)[2010-3-30 12:25]: Q: Writable bitmap, is there an example of the syntax? Pev (Guest)[2010-3-30 12:25]: Q: Typically for SoC devices you name your hardware specific libraries in the form "SOCDIRNAME_LIBNAME". In our platform "OMAP35XX_TPS659XX_TI_V1" if you do this we cause the catalog parser to die... For example if we have a library "Musbfn_OMAP35XX_TPS659XX_TI_V1.dll" entering this in the catalogs pbcxml file in a <module> section causes the XML parser to fail with : Error 3 The 'urn:Microsoft.PlatformBuilder/Catalog:Module' element is        invalid - The value '012345678901234567890123456789.dll' is invalid         according to its datatype         'urn:Microsoft.PlatformBuilder/Catalog:CatalogFileName' - The actual         length is greater than the MaxLength value. Pev (Guest)[2010-3-30 12:25]: sorry, messed up submission there! GPM (Guest)[2010-3-30 12:26]: Q: I would like to get a handle to a Silverlight screen section, is that possiable? GPM (Guest)[2010-3-30 12:28]: Q: IXRVisualHost::GetHWND() exactly what I needed Thanks, PaulT (Guest)[2010-3-30 12:29]: GPM: You don't have to keep submitting the questions. The chat experts have an application that they're using to follow the chat and all Ask the Experts questions are logged. Jhony (Guest)[2010-3-30 12:29]: Q: I am getting this error only when I select the KdStub as the debugger in Target device connectivity. neo (Guest)[2010-3-30 12:30]: Q: ok. thanks for the book's link Pev (Guest)[2010-3-30 12:31]: Hm, did those two I submitted get picked up by anyone? neo (Guest)[2010-3-30 12:33]: Q: If I select Active KTIL, My OS doesn't boots. It says "loading NK.EXE at 0x<xxxxx> location" after that nothing comes in the debug log. PaulT (Guest)[2010-3-30 12:34]: Pev: PaulT (Guest)[2010-3-30 12:35]: Pev: I'm sure they did. The guys who are actually on the chat may not be experts in that part of things. That's usually the explanation when you don't get an answer in 10 minutes or so. Pev (Guest)[2010-3-30 12:36]: Ah, fair enough Susie (Guest)[2010-3-30 12:36]: My Outlook Express incoming mail is corrput. No ONE has been able to fix the problem, Dell or Norton. I have dial up I'm in a rural area Jhony (Guest)[2010-3-30 12:37]: Q: I have tried that and I am getting the same error. Pev (Guest)[2010-3-30 12:37]: Susie : Use Thunderbird instead :-D PaulT (Guest)[2010-3-30 12:37]: Susie: Sorry, but this chat is not about Windows, but Embedded (like what runs on a phone). Your best chance is to find a local expert or talk to your ISP. paolopat (Guest)[2010-3-30 12:37]: Q: what are the main differences between Object Store and RAM disk ? They are both in RAM...are there performance differences ? access differences ? Susie (Guest)[2010-3-30 12:38]: My computer knowlege is very limited, what is Thunderbird? Pev (Guest)[2010-3-30 12:38]: A different email client :-D neo (Guest)[2010-3-30 12:39]: Q: KITL: *** Device Name CEPC56059 *** WARN: KITL will run in polling mode VBridge:: built on [Jul 10 2009] time [10:20:14] VBridgeInit()...TX = [16384] bytes -- Rx = [16384] bytes Tx buffer [0xA1B84860] to [0xA1B88860]. Rx buffer [0xA1B88880] to [0xA1B8C880]. VBridge:: NK add MAC: [0-60-65-2-DA-FB] Connecting to Desktop KITL: Connected host IP: 1 Port: 1086 .. this is the output of the serial debug Susie (Guest)[2010-3-30 12:39]: Do I need to uninstall Outlook Express youngboyzie (Guest)[2010-3-30 12:39]: I need to start battery calibration for my new battery for my dell inspiron 1525 laptop and should be able to reach the BIOS screen by hitting f2 but this isnt working... help? Pev (Guest)[2010-3-30 12:39]: Nah, you can run it instead - you'll still need help from your ISP to configure it I expect Jhony (Guest)[2010-3-30 12:39]: Q: Both is happening via Ethernet. PaulT (Guest)[2010-3-30 12:40]: youngboyzie: You're off-topic. This is not a general chat for Windows and certainly not for Dell. You'll have to ask Dell how to get to setup; it's their machine. bill (Guest)[2010-3-30 12:41]: I lost spell check, how can i get et back neo (Guest)[2010-3-30 12:42]: Q: I didn't do that. I have to try. Jhony (Guest)[2010-3-30 12:43]: Q: Ok. I will do it then. bill (Guest)[2010-3-30 12:43]: Q: I lost spell check, how can i get it back PaulT (Guest)[2010-3-30 12:44]: bill: This isn't a general Windows chat. There are some Web forums that you might try. GarySwalling (Guest)[2010-3-30 12:45]: Q: Thanks, I found the Phone 7 presentation at http://live.visitmix.com/MIX10/Sessions/CL13 GPM (Guest)[2010-3-30 12:45]: Q: Is the Silverlight Animation "Spline" a BezierSpline? neo (Guest)[2010-3-30 12:46]: Q: ok. I'll do it. thanks Pev (Guest)[2010-3-30 12:46]: Whowever was asking about KITL connection : I've had this loads in the past. I think I started debugging last time by using wireshark to see what was happening on the network then setting up the OAL_ETHER and OAL_FUNC and OAL_VERBOSE as well as OAL_KITL flags to see what was actually happening in the driver.... Pev (Guest)[2010-3-30 12:47]: I'd generally make sure that you're testing though a 10baseT hub (instead of anything faster) and forcing Active KITL in polled mode too... neo (Guest)[2010-3-30 12:48]: Q: I disabled the firewall in my PC. Pev (Guest)[2010-3-30 12:50]: Q: I've got a platform (not developed by myself) where I2C bus support has to be provided through the OAL as the kernel needs to talk to devices such as the power management IC and gas gauge so a 'proper' I2C driver hanging off device manager isn't possible. This happens to be a polled driver, so obviously it hits the system hard when either under lots of traffic or an error condition occurs and the driver constantly polls. I originally thought that there was no straightforward way to make such code interrupt driven in the kernel (as it's a cludge) but I realised that that's exactly what ETHDBG drivers do. Is there any reason why I shouldn't have a go at implementing a similar mechanism for our kernel resident I2C driver? If not, are there any obvious pitfalls - I've not seen any other BSP's do this in the past... neo (Guest)[2010-3-30 12:51]: Q: I don't see a kitlcore.dll in my OS. is my debug image fails to load because of that? Pev (Guest)[2010-3-30 12:52]: Q: Hi masatos, I'm using Windows Embedded CE 6.0 with R3 and patched to feb 2010's QFE's (with it's associated CETK version) this is a machine with only CE 6.0 on (no conflicts with earlier CE or WM...) neo (Guest)[2010-3-30 12:54]: ok. Got it neo (Guest)[2010-3-30 12:54]: Q: ok. Got it Roundman (Guest)[2010-3-30 12:55]: Q: I am having trouble with my mouse, I have the microsoft wireless mobile mouse 3000, when I push the scroll button I am suppose to have autoscroll instead it shows other web pages,Can you help me out tell me what to do!!! Pev (Guest)[2010-3-30 12:55]: Hey neo, debugging kitl issues is really frustrating but dont lose heart :-) neo (Guest)[2010-3-30 12:55]: @ pev : u fixed the problem of KITL after that? neo (Guest)[2010-3-30 12:56]: I am getting the same error again and again. I even cleaned my environment and tried in a fresh PC. But didn't succeed yet Pev (Guest)[2010-3-30 12:56]: Well, eventually - my experiences probably won't help you as different platforms have different reasons for doing that neo (Guest)[2010-3-30 12:56]: I think so PaulT (Guest)[2010-3-30 12:58]: neo: Have you searched the old messages in microsoft.public.windowsce.platbuilder? It seems to me that there was a packet size situation where it was possible to have problems with KITL connections based on a setting on the PC. Google Groups, groups.google.com, Advanced Groups Search will allow you to search a single newsgroup or a set of newsgroups easily. GPM (Guest)[2010-3-30 12:58]: Q: Spline- bad link PaulT (Guest)[2010-3-30 12:58]: GPM: without the > at the end does it work? It seems to for me... neo (Guest)[2010-3-30 12:58]: But some times if i try to connect to the device again. The Image information is seen in the serial debug. what does that mean?Download BIN file information: ----------------------------------------------------- [0]: Base Address=0x220000 Length=0x18DAADC Received a broadcast message !CheckUDP: Not UDP (proto = 0x00000001) after this i am getting the old errors. PB debugger cannot initialize ... GPM (Guest)[2010-3-30 12:59]: Q: Sorry, got to tirm the ">" neo (Guest)[2010-3-30 12:59]: ok paul. I ll look into that. davbo-msft (Moderator)[2010-3-30 13:0]: Hello everyone, we are just about out of time. Thank you for joining us for our Windows Embedded CE 6.0 chat today! <http://www.Microsoft.com/Embedded>; A special thank you to the product group members for coming out. The transcript of today’s chat will be posted online as soon as possible, to <http://msdn.microsoft.com/en-us/chats>;. We’ll see you again for another chat next month. Please check <http://msdn.microsoft.com/en-us/chats>; for the list of upcoming chats. If you still have unanswered questions, let me suggest that you post them on one of our newsgroups on <http://msdn.microsoft.com/en-us/windowsembedded/ce/default.aspx> -Windows Embedded CE 6.0 R3 Now Available! <http://msdn.microsoft.com/windowsembedded/ce/dd630616.aspx>; neo (Guest)[2010-3-30 13:1]: Q: I am unable to use the target control in my development environment. any ideas? Pev (Guest)[2010-3-30 13:1]: Sure, if KITL isn't connected target control won't work as it runs over kitl... neo (Guest)[2010-3-30 13:1]: ok .thanks pev neo (Guest)[2010-3-30 13:2]: yes. sysgen_shell is set to 1 neo (Guest)[2010-3-30 13:2]: Q: yes. sysgen_shell is set to 1 Marcelovk (Guest)[2010-3-30 13:2]: Q: Is there any way to extract the default command lines of the tests in CETK? I want to have it running unconnected from the desktop.   Copyright © 2010 – Bruce Eitman All Rights Reserved

    Read the article

  • Stop Spinning Your Wheels&hellip; Sage Advice for Aspiring Developers

    - by Mark Rackley
    So… lately I’ve been tasked with helping bring some non-developers over the hump and become full-fledged, all around, SharePoint developers. Well, only time will tell if I’m successful or a complete failure. Good thing about failures though, you know what NOT to do next time! Anyway, I’ve been writing some sort of code since I was about 10 years old; so I sometimes take for granted the effort some people have to go through to learn a new technology. I guess if I had to say I was an “expert” in one thing it would be learning (and getting “stuff” done) in new technologies. Maybe that’s why I’ve embraced SharePoint and the SharePoint community. SharePoint is the first technology I haven’t been able to master or get everything done without help from other people. I KNOW I’ll never know it all and I learn something new every day.  It keeps it interesting, it keeps me motivated, and keeps me involved. So, what some people may consider a downside of SharePoint, I definitely consider a plus. Crap.. I’m rambling. Where was I? Oh yeah… me trying to be helpful. Like I said, I am able to quickly and effectively pick up new languages, technology, etc. and put it to good use. Am I just brilliant? Well, my mom thinks so.. but maybe not. Maybe I’ve just been doing it for a long time…. 25 years in some form or fashion… wow I’m old… Anyway, what I lack in depth I make up for in breadth and being the “go-to” guy wherever I work when someone needs to “get stuff done”.  Let’s see if I can take some of that experience and put it to practical use to help new people get up to speed faster, learn things more effectively, and become that go-to guy. First off…  make sure you… Know The Basics I don’t have the time to teach new developers the basics, but you gotta know them. I’ve only been “taught” two languages.. Fortran 77 and C… everything else I’ve picked up from “doing”. I HAD to know the basics though, and all new developers need to understand the very basics of development.  97.23% of all languages will have the following: Variables Functions Arrays If statements For loops / While loops If you think about it, most development is “if this, do this… or while this, do this…”.  “This” may be some unique method to your language or something you develop, but the basics are the basics. YES there are MANY other development topics you need to understand, but you shouldn’t be scratching your head trying to figure out what a ”for loop” is… (Also learn about classes and hashtables as quickly as possible). Once you have the basics down it makes it much easier to… Learn By Doing This may just apply to me and my warped brain.  I don’t learn a new technology by reading or hearing someone speak about it. I learn by doing. It does me no good to try and learn all of the intricacies of a new language or technology inside-and-out before getting my hands dirty. Just show me how to do one thing… let me get that working… then show me how to do the next thing.. let me get that working… Now, let’s see what I can figure out on my own. Okay.. now it starts to make sense. I see how the language works, I can step through the code, and before you know it.. I’m productive in a new technology. Be careful here though…. make sure you… Don’t Reinvent The Wheel People have been writing code for what… 50+ years now? So, why are you trying to tackle ANYTHING without first Googling it with Bing to see what others have done first? When I was first learning C# (I had come from a Java background) I had to call a web service.  Sure! No problem! I’d done this many times in Java. So, I proceeded to write an HTTP Handler, called the Web Service and it worked like a charm!!!  Probably about 2.3 seconds after I got it working completely someone says to me “Why didn’t you just add a Web Reference?” Really? You can do that?  oops… I just wasted a lot of time. Before undertaking the development of any sort of utility method in a new language, make sure it’s not already handled for you… Okay… you are starting to write some code and are curious about the possibilities? Well… don’t just sit there… Try It And See What Happens This is actually one of my biggest pet peeves. “So… ‘x++’ works in C#, but does it also work in JavaScript?”   Really? Did you just ask me that? In the time it spent for you to type that email, press the send button, me receive the email, get around to reading it, and replying with “yes” you could have tested it 47 times and know the answer! Just TRY it! See what happens! You aren’t doing brain surgery. You aren’t going to kill anyone, and you BETTER not be developing in production. So, you are not going to crash any production systems!! Seriously! Get off your butt and just try it yourself. The extra added benefit is that it doesn’t work, the absolute best way to learn is to… Learn From Your Failures I don’t know about you… but if I screw up and something doesn’t work, I learn A LOT more debugging my problem than if everything magically worked. It’s okay that you aren’t perfect! Not everyone can be me? In the same vein… don’t ask someone else to debug your problem until you have made a valiant attempt to do so yourself. There’s nothing quite like stepping through code line by line to see what it’s REALLY doing… and you’ll never feel more stupid sometimes than when you realize WHY it’s not working.. but you realize... you learn... and you remember. There is nothing wrong with failure as long as you learn from it. As you start writing more and more and more code make sure that you ALWAYS… Develop for Production You will soon learn that the “prototype” you wrote last week to show as a “proof of concept” is going to go directly into production no matter how much you beg and plead and try to explain it’s not ready to go into production… it’s going to go straight there.. and it’s like herpes.. it doesn’t go away and there’s no fixing it once it’s in there.  So, why not write ALL your code like it will be put in production? It MIGHT take a little longer, but in the long run it will be easier to maintain, get help on, and you won’t be embarrassed that it’s sitting on a production server for everyone to use and see. So, now that you are getting comfortable and writing code for production it is important to to remember the… KISS Principle… Learn It… Love It… Keep It Simple Stupid Seriously.. don’t try to show how smart you are by writing the most complicated code in history. Break your problem up into discrete steps and write each step. If it turns out you have some redundancy, you can always go back and tweak your code later.  How bad is it when you write code that LOOKS cocky? I’ve seen it before… some of the most abstract and complicated classes when a class wasn’t even needed! Or the most elaborate unreadable code jammed into one really long line when it could have been written in three lines, performed just as well, and been SOOO much easier to maintain. Keep it clear and simple.. baby steps people. This will help you learn the technology, debug problems, AND it will help others help you find your problems if they don’t have to decipher the Dead Sea Scrolls just to figure out what you are trying to do…. Really.. don’t be that guy… try to curb your ego and… Keep an Open Mind No matter how smart you are… how fast you type… or how much you get paid, don’t let your ego get in the way. There is probably a better way to do everything you’ve ever done. Don’t become so cocky that you can’t think someone knows more than you. There’s a lot of brilliant, helpful people out there willing to show you tricks if you just give them a chance. A very super-awesome developer once told me “So what if you’ve been writing code for 10 years or more! Does your code look basically the same? Are you not growing as a developer?” Those 10 years become pretty meaningless if you just “know” that you are right and have not picked up new tips, tricks, methods, and patterns along the way. Learn from others and find out what’s new in development land (you know you don’t have to specifically use pointers anymore??). Along those same lines… If it’s not working, first assume you are doing something wrong. You have no idea how much it annoys people who are trying to help you when you first assume that the help they are trying to give you is wrong. Just MAYBE… you… the person learning is making some small mistake? Maybe you didn’t describe your problem correctly? Maybe you are using the wrong terminology? “I did exactly what you said and it didn’t work.”  Oh really? Are you SURE about that? “Your solution doesn’t work.”  Well… I’m pretty sure it works, I’ve used it 200 times… What are you doing differently? First try some humility and appreciation.. it will go much further, especially when it turns out YOU are the one that is wrong. When all else fails…. Try Professional Training Some people just don’t have the mindset to go and figure stuff out. It’s a gift and not everyone has it. If everyone could do it I wouldn’t have a job and there wouldn’t be professional training available.  So, if you’ve tried everything else and no light bulbs are coming on, contact the experts who specialize in training. Be careful though, there is bad training out there. Want to know the names of some good places? Just shoot me a message and I’ll let you know. I’m boycotting endorsing Andrew Connell anymore until I get that free course dangit!! So… that’s it.. that’s all I got right now. Maybe you thought all of this is common sense, maybe you think I’m smoking crack. If so, don’t just sit there, there’s a comments section for a reason. Finally, what about you? What tips do you have to help this aspiring to learn the dark arts??

    Read the article

  • Code to plug into a Zend Framework project

    - by bluedaniel
    Hello everyone, Im currently working on a website in the Zend Framework and finding it very useful indeed. I want both a blog and a forum in this website and wondered if there are any open-source projects of this nature that I would be able to simply copy and paste into my modular project. I was using Wordpress and BBpress previously so something like that would be good, although I do not want to hack my Zend Auth to use the Wordpress authentication system, seems like too much hard work/hacky to do. So any ideas? Plus where are the best Zend framework 'plugins' (similar to wordpress)? Thanks everyone.

    Read the article

  • Clickonce intranet application trust

    - by Mark
    Hi, we have a VSTO outlook add-in we'd like to silently deploy to everyone via AD. I'm signing the App with a "Code signing" certificate (requested certmgr from AD). If I add this certificate to my Trusted Publishers, then I can silently install the signed app via the VSTOInstaller.exe (with the /S switch). We don't want to have to install my certificate as a trusted publisher on everyone's machine - we'd like to be able to say that any code signed by a certificate issued within our AD is trusted. Is there some way to do this?

    Read the article

  • Best way to learn iphone audio queue services, step by step tutorial

    - by optician
    Hi Everyone, I'm trying to learn how to handle audio at a fairly low level with audio queue services. I have been progrmaing in memory managed languages for quite a while, and have just completed the c programing tutorial by vtc (2007). This has left me comfortable with the understanding of pointers and memory allocation, but the apple documention still leaves me wanting for a simpler implenation and explaination. Maybe I need to learn objective c and cocoa better. I have heard that this book is good. Cocoa(R) Programming for Mac(R) OS X (3rd Edition) Could someone suggest a learning path that is going to help me get an better understanding of working with audio and an iphone. I want to be able to play mp3 files back and also alter the pitch of them as they are playing. I am prepared that I may have to temporarily convert the mp3 files into pcm files to do things like that to them. Thanks everyone.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Code Igniter email protocols and rendering HTML emails?

    - by John
    I have a website built in code igniter that emails users. I use CI's email class from the controller to do mail out, but I discovered that if I use the "mail" protocol, some (not all) users see un-rendered html emails with the html mark up viewable, while others do not. But if I use the "sendmail" protocol, all users get rendered html emails. So if I did this $config['protocol'] = 'mail'; // add a few more config entries $this->email->initialize($config); Not everyone sees html emails If I did this $config['protocol'] = 'sendmail'; // add a few more config entries $this->email->initialize($config); Everyone sees html emails Why does the protocol matter? Are the email headers different between the two?

    Read the article

  • JQUERY CYCLE - Can I add page links to anchors assigned to Cycle's pager?

    - by christianDuncan
    Hello everyone. Seems I've outdone myself. All the while I was creating this pretty little 'latest news' widget that fades on mouseover of each anchor. Then my colleague says, "Hey, Chris, these links don't work" ...oops. I would like to find out if I can have these anchors take the user to the relvent page on click. Currently Cycle is set to do its hocus pocus on mouseover. This is my Cycle code: $('#newsSlider .slides ul').cycle({ fx: 'fade', speed: 1000, timeout: 0, pager: '.slides-nav', pagerEvent: 'mouseover', pagerAnchorBuilder: function(idx, slide) { // return sel string for existing anchor return '.slides-nav li:eq(' + (idx) + ') a'; } And here is the dev site: http://slg-development.co.uk/Gradient_12859/ Any help would be hugely appriciated. Thanks everyone! Christian

    Read the article

  • Pair programming: How should the pairs be chosen?

    - by Jon Seigel
    This topic has been covered peripherally in bits and pieces in some of the other pair-programming questions, but I want to (a) consolidate this knowledge into a separate question, and, most importantly, (b) go into much more depth on the subject. From the perspective of being an effective manager, how should pairs be arranged for pair programming to maximize both the happiness and productivity of the overall team? Some ideas to get started: Should two people never be paired (because of personalities, for example)? How much overlap in skillsets is needed? How much disconnect in skillsets is too much to overcome? (No two people will overlap 100%, and a disconnect in skills can be very beneficial to both people.) Should everyone pair with everyone else on a fixed/rotating basis? Should certain pairs be arranged to accomplish specific tasks? How important a role does HR play when growing or reorganizing the team?

    Read the article

  • multiplayer / visitors interactions with Ruby on Rails?

    - by Jordi
    I want to have interactions between visitors on my site. Imagine a chat room. It basically involves getting the data from everyone and sending it to everyone, this can be done by ajax and what not but I wonder if there is something already there in the wild that would do the heavy lifting for me. I have to say that I got very lost once I start programming Ajax, dont even know how to make tests for it... I have found the Q42multiplayer library that looks like what I want but they use C# as backend. There is something similar or any other multiplayer thingy I can get some idea or rip some code from (the whole thing will be opensource) for Ruby on Rails?

    Read the article

  • Managing web.config for teams in VS2010 & TFS

    - by Jarrett
    With VS2010's mandate that web.config be included in the project, how do we allow everyone to keep their own custom config file without getting into source control problems? Previously, we would simply leave web.config out of our project, allowing everyone to keep their own local version of web.config on their machine. We moved to VS2010, and it is now forcing me to add web.config to my project in order to run debug mode. Because our project is linked to TFS, it automatically adds web.config to source control and tries to maintain it that way. Is there a way to run in debug mode without including web.config in your project? Or is there a better way to manage config files?

    Read the article

  • All comments get marked as spam regardless (Wordpress MU)

    - by meds
    Everyone (besides me) who comments on another persons blog gets marked as spam when they comment on other peoples blogs. When they comment on their own its fine. Might be related, I've installed reCaptcha and have disabled it for logged in users yet everyone who is logged in still sees it, I don't, and incidentally my comments don't get marked as spam. I don't have akismet or hashcash or any other form of spam filtering turned out (with the exception of super captcha for registration). Any idea what's wrong or where I should look first?

    Read the article

< Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >