Search Results

Search found 35523 results on 1421 pages for 'nullable string'.

Page 11/1421 | < Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >

  • How to decoding the string in iphone

    - by Pugal Devan
    Hi, I want to decode my string. I have used parsing and get a string from RSS feed. In a string these special characters are not allowed &,<, in my app. So server side encoding those characters and give it to the string. So now i got the string like, Actual String : <Tom&Jerry> (only these characters are not allowed in node data & < >). After Encoding: %3CTom%26Jerry%3E. But i need to display the string is <Tom&Jerry> So how can i decode the string. Please help me out. Thanks.

    Read the article

  • String operations

    - by NEO
    I am trying to find the most repeated word in a string. My code is as follows: public class Word { private String toWord; private int Count; public Word(int count, String word){ toWord = word; Count = count; } public static void main(String args[]){ String str="my name is neo and my other name is also neo because I am neo"; String []str1=str.split(" "); Word w1=new Word(0,str1[0]); LinkedList<Word> list = new LinkedList<Word>(); list.add(w1); ListIterator itr = list.listIterator(); for(int i=1;i<str1.length;i++){ while(itr.hasNext()){ if(str1[i].equalsTO(????)); else list.add(new Word(0,str1[i])); } How do I compare the string from string array str1 to the string stored in the linked list and then how do i increase the respective count. I will then print the string with the highest count, I dont know how to do that either.

    Read the article

  • String from Httpresponse not passing full value.

    - by Shekhar_Pro
    HI i am in desperate need for help here, I am making a web request and getting a json string with Response.ContentLenth=2246 but when i parse it in a string it gives only few 100 characters, i traked it down that it is only getting values less than 964. strings length is still 2246 but remaining values are just (\0) null characters. Its also giving an error Unterminated string passed in. (2246): at following line FacebookFeed feed = sr.Deserialize<FacebookFeed>(data); It works fine if the response stream contains characters less than 964 chars. Following is the extract from the full code error encountered in last line. System.Web.Script.Serialization.JavaScriptSerializer sr = new System.Web.Script.Serialization.JavaScriptSerializer(); System.Net.HttpWebRequest req = (System.Net.HttpWebRequest)System.Net.HttpWebRequest.Create(@"https://graph.facebook.com/100000570310973_181080451920964"); req.Method = "GET"; System.Net.HttpWebResponse res = (System.Net.HttpWebResponse)req.GetResponse(); byte[] resp = new byte[(int)res.ContentLength]; res.GetResponseStream().Read(resp, 0, (int)res.ContentLength); string data = Encoding.UTF8.GetString(resp); FacebookFeed feed = sr.Deserialize<FacebookFeed>(data); error given is Unterminated string passed in. (2246): {"id":"100000570310973_1810804519209........ (with rest of data in the string data including null chars) following is the shape of classes used in my code: public class FacebookFeed { public string id { get; set; } public NameIdPair from { get; set; } public NameIdPair to { get; set; } public string message { get; set; } public Uri link{get;set;} public string name{get; set;} public string caption { get; set; } public Uri icon { get; set; } public NameLinkPair[] actions { get; set; } public string type { get; set; } public NameIdPair application { get; set; } //Mentioned in Graph API as attribution public DateTime created_time { get; set; } public DateTime updated_time { get; set; } public FacebookPostLikes likes { get; set; } } public class NameIdPair { public string name { get; set; } public string id { get; set; } } public class NameLinkPair { public string name { get; set; } public Uri link{get; set;} } public class FacebookPostLikes { public NameIdPair[] data { get; set; } public int count { get; set; } }

    Read the article

  • How to replace characters in a java String?

    - by ManBugra
    I like to replace a certain set of characters of a string with a corresponding replacement character in an efficent way. For example: String sourceCharacters = "šdccŠÐCCžŽ"; String targetCharacters = "sdccSDCCzZ"; String result = replaceChars("Gracišce", sourceCharacters , targetCharacters ); Assert.equals(result,"Gracisce") == true; Is there are more efficient way than to use the replaceAll method of the String class? My first idea was: final String s = "Gracišce"; String sourceCharacters = "šdccŠÐCCžŽ"; String targetCharacters = "sdccSDCCzZ"; // preparation final char[] sourceString = s.toCharArray(); final char result[] = new char[sourceString.length]; final char[] targetCharactersArray = targetCharacters.toCharArray(); // main work for(int i=0,l=sourceString.length;i<l;++i) { final int pos = sourceCharacters.indexOf(sourceString[i]); result[i] = pos!=-1 ? targetCharactersArray[pos] : sourceString[i]; } // result String resultString = new String(result); Any ideas? Btw, the UTF-8 characters are causing the trouble, with US_ASCII it works fine.

    Read the article

  • Write Parcelable for ArrayList<String []> in android?

    - by sugan.s
    I just created model with String array and array list of string array.Like this public class LookUpModel implements Parcelable { private String [] lookup_header; private ArrayList<String []> loookup_values; public void writeToParcel(Parcel dest, int flags) { dest.writeStringArray(getLookup_header()); }; } I have implemented parcelbale then write for String [] but how to do for the ArrayList<String []> and that values need to pass to another activity.Thanks in advance.

    Read the article

  • How to Convert Boolean to String

    - by tag
    I have a boolean variable which I want to convert to a string $res = true; I need it the converted value to also be in the format "true" "false" not "0" "1" $converted_res = "true"; $converted_res = "false"; I've tried: $converted_res = string($res); $converted_res = String($res); but it tells me string and String are not recognized functions. How do I convert this boolean to a string in the format "true" or "false" in php?

    Read the article

  • How to get N random string from a {a1|a2|a3} format string?

    - by Pentium10
    Take this string as input: string s="planets {Sun|Mercury|Venus|Earth|Mars|Jupiter|Saturn|Uranus|Neptune}" How would I choose randomly N from the set, then join them with comma. The set is defined between {} and options are separated with | pipe. The order is maintained. Some output could be: string output1="planets Sun, Venus"; string output2="planets Neptune"; string output3="planets Earth, Saturn, Uranus, Neptune"; string output4="planets Uranus, Saturn";// bad example, order is not correct Java 1.5

    Read the article

  • How to remove characters from a string?

    - by masato-san
    Hi, Below is interview question so you cannot relay on the functions that predefined in libraries. Also my answer below set the element to null but there is another ways to solve the problem. Given string $string = "This is a pen", remove "is" so that return value is "Th a pen" (including whitespece). I've tried (shown below) but returned value is not correct. Thanks in advance! function remove_delimiter_from_string(&$string, $del) { for($i=0; $i<strlen($string); $i++) { for($j=0; $j<strlen($del); $j++) { if($string[$i] == $del[$j]) { $string[$i] = $string[$i+$j]; //this grabs delimiter :( } } } echo $string . "\n"; }

    Read the article

  • how to use same string in two java files

    - by Palike
    Sorry for my bad English and for maybe stupid question but I'm new in Java. I need use same string in 2 java files for example: In first java file I've got code for sending emails, I've got string set to default email: public String mail = new String ("[email protected]"); and I use this string in code for send email: email.addTo(mail); In second java file something like set up where can user set new email address I want to have same string, connected with string in first java file. When user put new email String mail will be change to new email address and in email.addTo(mail); will be use this new address How can I do this?

    Read the article

  • Matching String.

    - by Harikrishna
    I have a string String mainString="///BUY/SELL///ORDERTIME///RT///QTY///BROKERAGE///NETRATE///AMOUNTRS///RATE///SCNM///"; Now I have another strings String str1= "RT"; which should be matched only with RT which is substring of string mainString but not with ORDERTIME which is also substring of string mainString. String str2= "RATE" ; And RATE(str2) should be matched with RATE which is substring of string mainString but not with NETRATE which is also substring of string mainString. How can we do that ?

    Read the article

  • XML Serializing a class with a Dictionary<string, List<string>> object

    - by Matt
    Is it possible to implement IXmlSerializable and in my XML file capture an object of type Dictionary ? I have the following public class coolio : IXmlSerializable { private int a; private bool b; private string c; private Dictionary<string, List<string>> coco; public coolio(int _a, bool _b, string _c, Dictionary<string, List<string>> _coco) { a=_a; b=_b; c=_c; coco=_coco; } public System.Xml.Schema.XmlSchema GetSchema() { return null; } public void WriteXml(XmlWriter writer) { const string myType = "coolio"; writer.WriteStartElement(myType); writer.WriteAttributeString("a", a.ToString()); writer.WriteAttributeString("b", b.ToString()); writer.WriteAttributeString("c", c); // How do I add a subelement for Dictionary<string, List<string>> coco? writer.WriteEndElement(); } public void ReadXml(XmlReader reader) { if (reader.MoveToContent() != XmlNodeType.Element || reader.LocalName != "coolio") return; a= int.Parse(reader["a"]); b = bool.Parse(reader["b"]); c= reader["c"]; // How do I read subelement into Dictionary<string, List<string>> coco? } } But I am stumped as to how I could add the Dictionary (XML seriliazed to my XML file)

    Read the article

  • Avoiding resource (localizable string) duplication with String.Format

    - by Hrvoje Prgeša
    I'm working on a application (.NET, but not relevant) where there is large potential for resource/string duplication - most of these strings are simple like: Volume: 33 Volume: 33 (dB) Volume 33 dB Volume (dB) Command - Volume: 33 (dB) where X, Y and unit are the same. Should I define a new resource for each of the string or is it preferable to use String.Format to simplify some of these, eg.: String.Format("{0}: {1}", Resource.Volume, 33) String.Format("{0}: {1} {2}", Resource.Volume, 33, Resource.dB) Resource.Volume String.Format("{0} ({1})", 33, Resource.dB) String.Format("{0} ({1})", Resource.Volume, Resource.dB) String.Format("Command - {0}: {1} {2}", Resource.Volume, 33, Resource.dB) I would also define string formats like "{0}: {1}" in the resources so there would be a possibility of reordering words... I would not use this approach selectivly and not throughout the whole application.. And how about: String.Format("{0}: {1}", Volume, Resource.Muted_Volume) // = Volume: Muted Resource.Muted_Volume String.Format("{0}: {1} (by user {2})", Volume, Resource.Muted_Volume, "xy") // = Volume: Muted (by user xy) The advantage is cutting the number of resource by the factor of 4-5. Are there any hidden dangers of using this approach? Could someone give me an example (language) where this would not work correctly?

    Read the article

  • Optimizing a lot of Scanner.findWithinHorizon(pattern, 0) calls

    - by darvids0n
    I'm building a process which extracts data from 6 csv-style files and two poorly laid out .txt reports and builds output CSVs, and I'm fully aware that there's going to be some overhead searching through all that whitespace thousands of times, but I never anticipated converting about about 50,000 records would take 12 hours. Excerpt of my manual matching code (I know it's horrible that I use lists of tokens like that, but it was the best thing I could think of): public static String lookup(List<String> tokensBefore, List<String> tokensAfter) { String result = null; while(_match(tokensBefore)) { // block until all input is read if(id.hasNext()) { result = id.next(); // capture the next token that matches if(_matchImmediate(tokensAfter)) // try to match tokensAfter to this result return result; } else return null; // end of file; no match } return null; // no matches } private static boolean _match(List<String> tokens) { return _match(tokens, true); } private static boolean _match(List<String> tokens, boolean block) { if(tokens != null && !tokens.isEmpty()) { if(id.findWithinHorizon(tokens.get(0), 0) == null) return false; for(int i = 1; i <= tokens.size(); i++) { if (i == tokens.size()) { // matches all tokens return true; } else if(id.hasNext() && !id.next().matches(tokens.get(i))) { break; // break to blocking behaviour } } } else { return true; // empty list always matches } if(block) return _match(tokens); // loop until we find something or nothing else return false; // return after just one attempted match } private static boolean _matchImmediate(List<String> tokens) { if(tokens != null) { for(int i = 0; i <= tokens.size(); i++) { if (i == tokens.size()) { // matches all tokens return true; } else if(!id.hasNext() || !id.next().matches(tokens.get(i))) { return false; // doesn't match, or end of file } } return false; // we have some serious problems if this ever gets called } else { return true; // empty list always matches } } Basically wondering how I would work in an efficient string search (Boyer-Moore or similar). My Scanner id is scanning a java.util.String, figured buffering it to memory would reduce I/O since the search here is being performed thousands of times on a relatively small file. The performance increase compared to scanning a BufferedReader(FileReader(File)) was probably less than 1%, the process still looks to be taking a LONG time. I've also traced execution and the slowness of my overall conversion process is definitely between the first and last like of the lookup method. In fact, so much so that I ran a shortcut process to count the number of occurrences of various identifiers in the .csv-style files (I use 2 lookup methods, this is just one of them) and the process completed indexing approx 4 different identifiers for 50,000 records in less than a minute. Compared to 12 hours, that's instant. Some notes (updated): I don't necessarily need the pattern-matching behaviour, I only get the first field of a line of text so I need to match line breaks or use Scanner.nextLine(). All ID numbers I need start at position 0 of a line and run through til the first block of whitespace, after which is the name of the corresponding object. I would ideally want to return a String, not an int locating the line number or start position of the result, but if it's faster then it will still work just fine. If an int is being returned, however, then I would now have to seek to that line again just to get the ID; storing the ID of every line that is searched sounds like a way around that. Anything to help me out, even if it saves 1ms per search, will help, so all input is appreciated. Thankyou! Usage scenario 1: I have a list of objects in file A, who in the old-style system have an id number which is not in file A. It is, however, POSSIBLY in another csv-style file (file B) or possibly still in a .txt report (file C) which each also contain a bunch of other information which is not useful here, and so file B needs to be searched through for the object's full name (1 token since it would reside within the second column of any given line), and then the first column should be the ID number. If that doesn't work, we then have to split the search token by whitespace into separate tokens before doing a search of file C for those tokens as well. Generalised code: String field; for (/* each record in file A */) { /* construct the rest of this object from file A info */ // now to find the ID, if we can List<String> objectName = new ArrayList<String>(1); objectName.add(Pattern.quote(thisObject.fullName)); field = lookup(objectSearchToken, objectName); // search file B if(field == null) // not found in file B { lookupReset(false); // initialise scanner to check file C objectName.clear(); // not using the full name String[] tokens = thisObject.fullName.split(id.delimiter().pattern()); for(String s : tokens) objectName.add(Pattern.quote(s)); field = lookup(objectSearchToken, objectName); // search file C lookupReset(true); // back to file B } else { /* found it, file B specific processing here */ } if(field != null) // found it in B or C thisObject.ID = field; } The objectName tokens are all uppercase words with possible hyphens or apostrophes in them, separated by spaces. Much like a person's name. As per a comment, I will pre-compile the regex for my objectSearchToken, which is just [\r\n]+. What's ending up happening in file C is, every single line is being checked, even the 95% of lines which don't contain an ID number and object name at the start. Would it be quicker to use ^[\r\n]+.*(objectname) instead of two separate regexes? It may reduce the number of _match executions. The more general case of that would be, concatenate all tokensBefore with all tokensAfter, and put a .* in the middle. It would need to be matching backwards through the file though, otherwise it would match the correct line but with a huge .* block in the middle with lots of lines. The above situation could be resolved if I could get java.util.Scanner to return the token previous to the current one after a call to findWithinHorizon. I have another usage scenario. Will put it up asap.

    Read the article

  • Why is django admin not accepting Nullable foreign keys?

    - by p.g.l.hall
    Here is a simplified version of one of my models: class ImportRule(models.Model): feed = models.ForeignKey(Feed) name = models.CharField(max_length=255) feed_provider_category = models.ForeignKey(FeedProviderCategory, null=True) target_subcategories = models.ManyToManyField(Subcategory) This class manages a rule for importing a list of items from a feed into the database. The admin system won't let me add an ImportRule without selecting a feed_provider_category despite it being declared in the model as nullable. The database (SQLite at the moment) even checks out ok: >>> .schema ... CREATE TABLE "someapp_importrule" ( "id" integer NOT NULL PRIMARY KEY, "feed_id" integer NOT NULL REFERENCES "someapp_feed" ("id"), "name" varchar(255) NOT NULL, "feed_provider_category_id" integer REFERENCES "someapp_feedprovidercategory" ("id"), ); ... I can create the object in the python shell easily enough: f = Feed.objects.get(pk=1) i = ImportRule(name='test', feed=f) i.save() ...but the admin system won't let me edit it, of course. How can I get the admin to let me edit/create objects without specifying that foreign key?

    Read the article

  • Best way to check for nullable bool in a condition expression (if ...)

    - by FireSnake
    I was wondering what was the most clean and understandable syntax for doing condition checks on nullable bools. Is the following good or bad coding style? Is there a way to express the condition better/more cleanly? bool? nullableBool = true; if (nullableBool ?? false) { ... } else { ... } especially the if (nullableBool ?? false) part. I don't like the if (x.HasValue && x.Value) style ... (not sure whether the question has been asked before ... couldn't find something similar with the search)

    Read the article

  • AdvancedFormatProvider: Making string.format do more

    - by plblum
    When I have an integer that I want to format within the String.Format() and ToString(format) methods, I’m always forgetting the format symbol to use with it. That’s probably because its not very intuitive. Use {0:N0} if you want it with group (thousands) separators. text = String.Format("{0:N0}", 1000); // returns "1,000"   int value1 = 1000; text = value1.ToString("N0"); Use {0:D} or {0:G} if you want it without group separators. text = String.Format("{0:D}", 1000); // returns "1000"   int value2 = 1000; text2 = value2.ToString("D"); The {0:D} is especially confusing because Microsoft gives the token the name “Decimal”. I thought it reasonable to have a new format symbol for String.Format, "I" for integer, and the ability to tell it whether it shows the group separators. Along the same lines, why not expand the format symbols for currency ({0:C}) and percent ({0:P}) to let you omit the currency or percent symbol, omit the group separator, and even to drop the decimal part when the value is equal to the whole number? My solution is an open source project called AdvancedFormatProvider, a group of classes that provide the new format symbols, continue to support the rest of the native symbols and makes it easy to plug in additional format symbols. Please visit https://github.com/plblum/AdvancedFormatProvider to learn about it in detail and explore how its implemented. The rest of this post will explore some of the concepts it takes to expand String.Format() and ToString(format). AdvancedFormatProvider benefits: Supports {0:I} token for integers. It offers the {0:I-,} option to omit the group separator. Supports {0:C} token with several options. {0:C-$} omits the currency symbol. {0:C-,} omits group separators, and {0:C-0} hides the decimal part when the value would show “.00”. For example, 1000.0 becomes “$1000” while 1000.12 becomes “$1000.12”. Supports {0:P} token with several options. {0:P-%} omits the percent symbol. {0:P-,} omits group separators, and {0:P-0} hides the decimal part when the value would show “.00”. For example, 1 becomes “100 %” while 1.1223 becomes “112.23 %”. Provides a plug in framework that lets you create new formatters to handle specific format symbols. You register them globally so you can just pass the AdvancedFormatProvider object into String.Format and ToString(format) without having to figure out which plug ins to add. text = String.Format(AdvancedFormatProvider.Current, "{0:I}", 1000); // returns "1,000" text2 = String.Format(AdvancedFormatProvider.Current, "{0:I-,}", 1000); // returns "1000" text3 = String.Format(AdvancedFormatProvider.Current, "{0:C-$-,}", 1000.0); // returns "1000.00" The IFormatProvider parameter Microsoft has made String.Format() and ToString(format) format expandable. They each take an additional parameter that takes an object that implements System.IFormatProvider. This interface has a single member, the GetFormat() method, which returns an object that knows how to convert the format symbol and value into the desired string. There are already a number of web-based resources to teach you about IFormatProvider and the companion interface ICustomFormatter. I’ll defer to them if you want to dig more into the topic. The only thing I want to point out is what I think are implementation considerations. Why GetFormat() always tests for ICustomFormatter When you see examples of implementing IFormatProviders, the GetFormat() method always tests the parameter against the ICustomFormatter type. Why is that? public object GetFormat(Type formatType) { if (formatType == typeof(ICustomFormatter)) return this; else return null; } The value of formatType is already predetermined by the .net framework. String.Format() uses the StringBuilder.AppendFormat() method to parse the string, extracting the tokens and calling GetFormat() with the ICustomFormatter type. (The .net framework also calls GetFormat() with the types of System.Globalization.NumberFormatInfo and System.Globalization.DateTimeFormatInfo but these are exclusive to how the System.Globalization.CultureInfo class handles its implementation of IFormatProvider.) Your code replaces instead of expands I would have expected the caller to pass in the format string to GetFormat() to allow your code to determine if it handles the request. My vision would be to return null when the format string is not supported. The caller would iterate through IFormatProviders until it finds one that handles the format string. Unfortunatley that is not the case. The reason you write GetFormat() as above is because the caller is expecting an object that handles all formatting cases. You are effectively supposed to write enough code in your formatter to handle your new cases and call .net functions (like String.Format() and ToString(format)) to handle the original cases. Its not hard to support the native functions from within your ICustomFormatter.Format function. Just test the format string to see if it applies to you. If not, call String.Format() with a token using the format passed in. public string Format(string format, object arg, IFormatProvider formatProvider) { if (format.StartsWith("I")) { // handle "I" formatter } else return String.Format(formatProvider, "{0:" + format + "}", arg); } Formatters are only used by explicit request Each time you write a custom formatter (implementer of ICustomFormatter), it is not used unless you explicitly passed an IFormatProvider object that supports your formatter into String.Format() or ToString(). This has several disadvantages: Suppose you have several ICustomFormatters. In order to have all available to String.Format() and ToString(format), you have to merge their code and create an IFormatProvider to return an instance of your new class. You have to remember to utilize the IFormatProvider parameter. Its easy to overlook, especially when you have existing code that calls String.Format() without using it. Some APIs may call String.Format() themselves. If those APIs do not offer an IFormatProvider parameter, your ICustomFormatter will not be available to them. The AdvancedFormatProvider solves the first two of these problems by providing a plug-in architecture.

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • How to restrict a content of string to less than 4MB and save that string in DB using C#

    - by Pranay B
    I'm working on a project where I need to get the Text data from pdf files and dump the whole text in a DB column. With the help of iTextsharp, I got the data and referred it String. But now I need to check whether the string exceeds the 4MB limit or not and if it is exceeding then accept the string data which is less than 4MB in size. This is my code: internal string ReadPdfFiles() { // variable to store file path string filePath = null; // open dialog box to select file OpenFileDialog file = new OpenFileDialog(); // dilog box title name file.Title = "Select Pdf File"; //files to be accepted by the user. file.Filter = "Pdf file (*.pdf)|*.pdf|All files (*.*)|*.*"; // set initial directory of computer system file.InitialDirectory = Environment.GetFolderPath(Environment.SpecialFolder.Desktop); // set restore directory file.RestoreDirectory = true; // execute if block when dialog result box click ok button if (file.ShowDialog() == DialogResult.OK) { // store selected file path filePath = file.FileName.ToString(); } //file path /// use a string array and pass all the pdf for searching //String filePath = @"D:\Pranay\Documentation\Working on SSAS.pdf"; try { //creating an instance of PdfReader class using (PdfReader reader = new PdfReader(filePath)) { //creating an instance of StringBuilder class StringBuilder text = new StringBuilder(); //use loop to specify how many pages to read. //I started from 5th page as Piyush told for (int i = 5; i <= reader.NumberOfPages; i++) { //Read the pdf text.Append(PdfTextExtractor.GetTextFromPage(reader, i)); }//end of for(i) int k = 4096000; //Test whether the string exceeds the 4MB if (text.Length < k) { //return the string text1 = text.ToString(); } //end of if } //end of using } //end try catch (Exception ex) { MessageBox.Show(ex.Message, "Please Do select a pdf file!!", MessageBoxButtons.OK, MessageBoxIcon.Warning); } //end of catch return text1; } //end of ReadPdfFiles() method Do help me!

    Read the article

  • C++ Check Substring of a String

    - by user69514
    I'm trying to check whether or not the second argument in my program is a substring of the first argument. The problem is that it only work if the substring starts with the same letter of the string. .i.e Michigan - Mich (this works) Michigan - Mi (this works) Michigan - igan (this doesn't work) #include <stdio.h> #include <string.h> #include <string> using namespace std; bool my_strstr( string str, string sub ) { bool flag = true; int startPosition = -1; char subStart = str.at(0); char strStart; //find starting position for(int i=0; i<str.length(); i++){ if(str.at(i) == subStart){ startPosition = i; break; } } for(int i=0; i<sub.size(); i++){ if(sub.at(i) != str.at(startPosition)){ flag = false; break; } startPosition++; } return flag; } int main(int argc, char **argv){ if (argc != 3) { printf ("Usage: check <string one> <string two>\n"); } string str1 = argv[1]; string str2 = argv[2]; bool result = my_strstr(str1, str2); if(result == 1){ printf("%s is a substring of %s\n", argv[2], argv[1]); } else{ printf("%s is not a substring of %s\n", argv[2], argv[1]); } return 0; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Get context for search string in text in C#

    - by soundslike
    Given a string text which contains newline there is a search keyword which matches an item within the text. How do I implement the following in C#: searchIdx = search index (starting with 0, then 1, etc. for each successive call to GetSearchContext. Initially start with 0. contextsTxt = string data to search in searchTxt = keyword to search for in contextsTxt numLines = number of lines to return surrounding the searchTxt found (ie. 1 = the line the searchTxt is found on, 2 = the line the searchTxt is found on, 3 = the line above the searchTxt is found on, the line the searchTxt is found on, and the line below the searchTxt is found on) returns the "context" based on the parameters string GetSearchContext(int searchIdx, string contentsTxt, string searchTxt, int numLines); If there's a better function interface to accomplish this feel free to suggest that as well. I tried the following but doesn't seem to work properly all the time: private string GetSearchContext(string contentValue, string search, int numLines) { int searchIdx = contentValue.IndexOf(search); int startIdx = 0; int lastIdx = 0; while (startIdx != -1 && (startIdx = contentValue.IndexOf('\n', startIdx+1)) < searchIdx) { lastIdx = startIdx; } startIdx = lastIdx; if (startIdx < 0) startIdx = 0; int endIdx = searchIdx; int lineCnt = 0; while (endIdx != -1 && lineCnt++ < numLines) { endIdx = contentValue.IndexOf('\n', endIdx + 1); } if (endIdx == -1 || endIdx > contentValue.Length - 1) endIdx = contentValue.Length - 1; string lines = contentValue.Substring(startIdx, endIdx - startIdx + 1); if (lines[0] == '\n') lines = lines.Substring(1); if (lines[lines.Length - 1] == '\n') { lines = lines.Substring(0, lines.Length - 1); } if (lines[lines.Length - 1] == '\r') { lines = lines.Substring(0, lines.Length - 1); } return lines; }

    Read the article

  • Nullable One To One Relationships with Integer Keys in LINQ-to-SQL

    - by Craig Walker
    I have two objects (Foo and Bar) that have a one-to-zero-or-one relationship between them. So, Foo has a nullable foreign key reference to Bar.ID and a (nullbusted) unique index to enforce the "1" side. Bar.ID is an int, and so Foo.BarID is a nullable int. The problem occurs in the LINQ-to-SQL DBML mapping of .NET types to SQL datatypes. Since int is not a nullable type in .NET, it gets wrapped in a Nullable<int>. However, this is not the same type as int, and so Visual Studio gives me this error message when I try to create the OneToOne Association between them: Cannot create an association "Bar_Foo". Properties do not have matching types: "ID", "BarID". Is there a way around this?

    Read the article

< Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >