Search Results

Search found 36172 results on 1447 pages for 'unicode string'.

Page 11/1447 | < Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • delphi 2010 variant to unicode problem

    - by Crudler
    Please advise how I can achieve this. I am working in a dll in delphi 2010. This dll has a exported procedure that receives an array of variants. I want to be able to take one of these variants, and convert it into a string, but i keep getting ????? I cannot change the input variable - it HAS to be an array of variants. The host app that calls the dll cannot be changed. It is written in Delphi2006. sample dll's code is: Procedure TestArr(ArrUID : array of variant);stdcall; var i : integer; s:string; begin s:= string(String(Arruid[0])); showmessage(s); end; obviously in D2006 my dll works fine. I have tried using VartoStr - no luck. When I try test the VaType I am getting a varString Any suggestions?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Convert Unicode char to closest (most similar) char in ASCII (.net)

    - by Andrey
    Hi all! Do you have any idea how to covert different Unicode characters to their closest ASCII equivalents? Like Ä - A. A googled but didn't find any suitable solution. Trick Encoding.ASCII.GetBytes("Ä")[0] didn't work. (Result was ?). I found that there is class Encoder that has Fallback property that is exactly for cases when char can't be converted, but implementations (EncoderReplacementFallback) are stupid and convert to ?. Any ideas? Thanks, Andrey

    Read the article

  • SHA-1 and Unicode

    - by Andrew
    Hi everyone, Is behavior of SHA-1 algorithm defined for Unicode strings? I do realize that SHA-1 itself does not care about the content of the string, however, it seems to me that in order to pass standard tests for SHA-1, the input string should be encoded with UTF-8.

    Read the article

  • Insert unicode strings into CleverCSS

    - by Brian M. Hunt
    How can one insert a Unicode string CSS into CleverCSS? In particular, how could one produce the following CSS using CleverCSS: li:after { content: "\00BB \0020"; } I've figured out CleverCSS's parsing rules, but suffice that the permutations I've thought sensible have failed, for example: li: content: "\\00BB \\0020" // becomes content: 'BB 0' EDIT: My other examples and the rest of my post weren't saved. Suffice that I had a longer list of examples that also failed, as did my closing which was something like: I'd be grateful for any thoughts and input. Brian

    Read the article

  • java: can I convert strings with String.getBytes() without the BOM?

    - by Cheeso
    Suppose I have this code: String encoding = "UTF-16"; String text = "[Hello StackOverflow]"; byte[] message= text.getBytes(encoding); If I display the byte array in message, the result is: 0000 FE FF 00 5B 00 48 00 65 00 6C 00 6C 00 6F 00 20 ...[.H.e.l.l.o. 0010 00 53 00 74 00 61 00 63 00 6B 00 4F 00 76 00 65 .S.t.a.c.k.O.v.e 0020 00 72 00 66 00 6C 00 6F 00 77 00 5D .r.f.l.o.w.] As you can see, there's a BOM in the beginning. How can I: generate a UTF-16 byte array that lacks a BOM ? convert from a byte array that contains UTF=16 chars but lacks a BOM, back to a string?

    Read the article

  • Need a simple tool for analysing unicode characters

    - by Steve Bennett
    I'm surprised I can't find a simple tool for this. Basically, sometimes as a result of text munging, or using some piece of software, I end up with some text that has some troublesome characters - such as looking a lot like other characters, but being distinct from them. I'd like a tool (preferably online, javascript based) where I can paste the text, and it will tell me all the characters involved, their names, unicode codes etc.

    Read the article

  • Convert or strip out "illegal" Unicode characters

    - by Oli
    I've got a database in MSSQL that I'm porting to SQLite/Django. I'm using pymssql to connect to the database and save a text field to the local SQLite database. However for some characters, it explodes. I get complaints like this: UnicodeDecodeError: 'ascii' codec can't decode byte 0x97 in position 1916: ordinal not in range(128) Is there some way I can convert the chars to proper unicode versions? Or strip them out?

    Read the article

  • lxml unicode entity parse problems

    - by Jon Hadley
    I'm using lxml as follows to parse an exported XML file from another system: xmldoc = open(filename) etree.parse(xmldoc) But im getting: lxml.etree.XMLSyntaxError: Entity 'eacute' not defined, line 4495, column 46 Obviously it's having problems with unicode entity names - but how would i get round this? Via open() or parse()?

    Read the article

  • Are Blogengine.net support posts in other language like Hindi when they written through unicode font

    - by steven spielberg
    when i test a post written in Hindi that i got the error that "Url : http://localhost:50263/BlogEngine.Web/admin/Pages/Add_entry.aspx?id=c3b7497c-60e7-41c7-ac10-36f21999f82f Raw Url : /BlogEngine.Web/admin/Pages/Add_entry.aspx?id=c3b7497c-60e7-41c7-ac10-36f21999f82f Message : A potentially dangerous Request.Form value was detected from the client (ctl00$cphAdmin$txtContent$TinyMCE1$txtContent=" ..."). Source : System.Web StackTrace : at System.Web.HttpRequest.ValidateString(String value, String collectionKey, RequestValidationSource requestCollection) at System.Web.HttpRequest.ValidateNameValueCollection(NameValueCollection nvc, RequestValidationSource requestCollection) at System.Web.HttpRequest.get_Form() at System.Web.HttpRequest.get_Item(String key) at BlogEngine.Core.Web.HttpModules.CompressionModule.context_PostReleaseRequestState(Object sender, EventArgs e) in D:\Projects\Be-1610\BlogEngine\DotNetSlave.BusinessLogic\Web\HttpModules\CompressionModule.cs:line 62 at System.Web.HttpApplication.SyncEventExecutionStep.System.Web.HttpApplication.IExecutionStep.Execute() at System.Web.HttpApplication.ExecuteStep(IExecutionStep step, Boolean& completedSynchronously) " what is meaning of this error. are this support unicode ?

    Read the article

  • UILabel displaying Unicode Characters

    - by Lee Armstrong
    Hello, I have an NSString that then sets a UILabel. This contains unicode such as... E = MC Hammer\U00ac\U2264 and complete ones such as \U2013\U00ee\U2013\U00e6\U2013\U2202\U2013\U220f\U2013\U03c0 \U2013\U00ee\U2013\U220f\U2013\U03c0\U2013\U00aa\U2013\U221e\U2014\U00c5 These are not displaying correctly, is there anything I need to do to parse these at all?

    Read the article

  • Unicode characters not showing in System.Windows.Forms.TextBox

    - by Sean
    These characters show fine when I cut-and-paste them here from the VisualStudio debugger, but both in the debugger, and in the TextBox where I am trying to display this text, it just shows squares. ??\r\n???????,3-9 ?????????,???2 ?,???3 ?;10 ????4 ???????????,???2 ??\r\n??\r\n??????????,???????\r\n I thought that the TextBox supported Unicode text. Any idea how I can get this text to display in my application?

    Read the article

  • php mysql flex unicode

    - by JonoB
    I have a problem with saving the £ symbol to a mysql database. I am running a flex front end, with a php + mysql backend When I save a record from flex, the string gets sent to the server as "This amount is £10" php views the string as above, and when it gets saved into the DB, it gets saved as "This amount is £10". My understanding is that this is correct based on MySQL or PHP is appending a  whenever the £ is used I now retrieve the above record, and it gets sent to flex as "This amount is £10". Flex correctly displays this in a textarea as "This amount is £10" I change another field in the same record in flex, and re-save the transaction. The string now gets sent to the server as "This amount is £10" The record is now saved into the DB as "The amount is £10". Each time the record is re-saved, this effect snowballs. Thanks for any advice you can give.

    Read the article

  • Unicode troubles

    - by user343803
    Hello, i have just known Python for few days. Unicode seems to be a problem with Python. i have a text file stores a text string like this '\u0110\xe8n \u0111\u1ecf n\xfat giao th\xf4ng Ng\xe3 t\u01b0 L\xe1ng H\u1ea1' i can read the file and print the string out but it displays incorrectly. How can i print it out to screen correctly as follow: "Ðèn d? nút giao thông Ngã tu Láng H?" Thanks in advance

    Read the article

  • MySQL don't want to store unicode charecter

    - by Qiao
    Why MySQl don't wont to store unicode character ??? Yes, it is rare hieroglyph, you wouldn't see it in the browser. UTF16 is U+2B5EE Warning: #1366 Incorrect string value: '\xF0\xAB\x97\xAE' for column 'ch' at row 1 Is it possible to store this character in MySQL?

    Read the article

  • Unicode Regex; Invalid XML characters

    - by Ambush Commander
    The list of valid XML characters is well known, as defined by the spec it's: #x9 | #xA | #xD | [#x20-#xD7FF] | [#xE000-#xFFFD] | [#x10000-#x10FFFF] My question is whether or not it's possible to make a PCRE regular expression for this (or its inverse) without actually hard-coding the codepoints, by using Unicode general categories. An inverse might be something like [\p{Cc}\p{Cs}\p{Cn}], except that improperly covers linefeeds and tabs and misses some other invalid characters.

    Read the article

  • Does Lua support Unicode?

    - by TimK
    Based on the link below, I'm confused as to whether the Lua programming language supports Unicode. http://lua-users.org/wiki/LuaUnicode It appears it does but has limitations. I simply don't understand, are the limitation anything big/key or not a big deal?

    Read the article

  • Unicode filename to python subprocess.call()

    - by otrov
    I'm trying to run subprocess.call() with unicode filename, and here is simplified problem: n = u'c:\\windows\\notepad.exe ' f = u'c:\\temp\\nèw.txt' subprocess.call(n + f) which raises famous error: UnicodeEncodeError: 'ascii' codec can't encode character u'\xe8' Encoding to utf-8 produces wrong filename, and mbcs passes filename as new.txt without accent I just can't read any more on this confusing subject and spin in circle. I found here lot of answers for many different problems in past so I thought to join and ask for help myself Thanks

    Read the article

< Previous Page | 7 8 9 10 11 12 13 14 15 16 17 18  | Next Page >