Search Results

Search found 11458 results on 459 pages for 'perl thread'.

Page 115/459 | < Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >

  • Where can I find an array of the (un)assigned Unicode code points for a particular block?

    - by gitparade
    At the moment, I'm writing these arrays by hand. For example, the Miscellaneous Mathematical Symbols-A block has an entry in hash like this: my %symbols = ( ... miscellaneous_mathematical_symbols_a => [(0x27C0..0x27CA), 0x27CC, (0x27D0..0x27EF)], ... ) The simpler, 'continuous' array miscellaneous_mathematical_symbols_a => [0x27C0..0x27EF] doesn't work because Unicode blocks have holes in them. For example, there's nothing at 0x27CB. Take a look at the code chart [PDF]. Writing these arrays by hand is tedious, error-prone and a bit fun. And I get the feeling that someone has already tackled this in Perl!

    Read the article

  • Best practice question

    - by sid_com
    Hello! Which version would you prefer? #!/usr/bin/env perl use warnings; use strict; use 5.010; my $p = 7; # 33 my $prompt = ' : '; my $key = 'very important text'; my $value = 'Hello, World!'; my $length = length $key . $prompt; $p -= $length; Option 1: $key = $key . ' ' x $p . $prompt; Option 2: if ( $p > 0 ) { $key = $key . ' ' x $p . $prompt; } else { $key = $key . $prompt; } say "$key$value"

    Read the article

  • C++ thread to seperate process

    - by silverbandit91
    Is there any way i can have a thread branch off into it's own independent process? I know there's the CreateProcess function but as far as I can tell, you can only run external applications with it. Is what I'm asking for at all possible?

    Read the article

  • C++ Win/Linux thread syncronization Event

    - by JP
    Hello I have some code that is cross-platform by unsing #ifdef OS, I have a Queue protected by a CriticalSection on Windows, and by a pthread_mutex_t on Linux. I would like to implement a Wait(timeout) call that would block a thread until something has been enqueued. I though about using WaitForSingleObject on windows but it don't seem to support CriticalSection. Which Win32 and which Linux functions should I use to Wait and Signal for a condition to happen. Thank

    Read the article

  • Can a shell loop do this?

    - by helpwithshell
    Ive seen loops to unzip all zip files in a directory, however, before I run this, I would rather make sure what Im about to run will work right: for i in dir; do cd $i; unzip '*.zip'; rm -rf *.zip; cd ..; done Basically I want it to look at the output of "dir" see all the folders, for each directory cd into it, unzip all the zip archives, then remove them, then cd back and do it again until theres no more. Is this something I should do in a single command or should I consider doing this in perl?

    Read the article

  • how to get unique values set from a repeating values list

    - by Mariselvam
    I need to parse a large log file (flat file), which contains two column of values (column-A , column-B). Values in both columns are repeating. I need to find for each unique value in column-A , I need to find a set of column-B values. Is this can be done using unix shell command or need to write any perl or python script? What are the ways this can be done? Example: xxxA 2 xxxA 1 xxxB 2 XXXC 3 XXXA 3 xxxD 4 output: xxxA - 2,1,3 xxxB - 2 xxxC - 3 xxxD - 4

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Reuse Hibernate session in thread

    - by Marco
    Hello, I've read somewhere that when a session is flushed or a transaction is committed, the session itself is closed by Hibernate. So, how can i reuse an Hibernate Session, in the same thread, that has been previously closed? Thanks

    Read the article

  • Should I convert overly-long UTF-8 strings to their shortest normal form?

    - by Grant McLean
    I've just been reworking my Encoding::FixLatin Perl module to handle overly-long UTF-8 byte sequences and convert them to the shortest normal form. My question is quite simply "is this a bad idea"? A number of sources (including this RFC) suggest that any over-long UTF-8 should be treated as an error and rejected. They caution against "naive implementations" and leave me with the impression that these things are inherently unsafe. Since the whole purpose of my module is to clean up messy data files with mixed encodings and convert them to nice clean utf8, this seems like just one more thing I can clean up so the application layer doesn't have to deal with it. My code does not concern itself with any semantic meaning the resulting characters might have, it simply converts them into a normalised form. Am I missing something. Is there a hidden danger I haven't considered?

    Read the article

  • is this class thread safe?

    - by flash
    consider this class,with no instance variables and only methods which are non-synchronous can we infer from this info that this class in Thread-safe? public class test{ public void test1{ // do something } public void test2{ // do something } public void test3{ // do something } }

    Read the article

  • IS ResultSet thread safe

    - by javatraniee
    Is ResultSet Thread safe? My question arises because in this i have used a different statement for each query i have delsared a ResultSet as an local variable but it gives me a error of Operation not allowed after ResultSet is closed. But my statements are working as i'm using the statements in insert and delete query.I have commented the ResultSet part and have not got the error !! The source code of my program can be referd to , in my earlier Question .

    Read the article

  • Decoding MIME (HTML+Attachments)

    - by MH
    I'm planning to write an application that should handle incoming mails. Basically it will act more like a ticketing system than a webmail, so I'm only interested in receiving emails, and not sending them. I have made a simple prototype that downloads mails and displays the text with downloadable attachments in a web page, but handling mails from Outlook and others is more complicated. I have looked at some of the open source ticketing systems out there, but most of the code is tied to the system and is hard to separate. Is there a library that understands "rich" mail and makes this job simpler? Preferably in Python, Java, Ruby or Perl. I'm also open to suggestions for any command line mail clients that can be used for this, since the system will not receive large amounts of mail and can afford to launch external processes.

    Read the article

  • Where can I find an array of the Unicode code points for a particular block?

    - by gitparade
    At the moment, I'm writing these arrays by hand. For example, the Miscellaneous Mathematical Symbols-A block has an entry in hash like this: my %symbols = ( ... miscellaneous_mathematical_symbols_a => [(0x27C0..0x27CA), 0x27CC, (0x27D0..0x27EF)], ... ) The simpler, 'continuous' array miscellaneous_mathematical_symbols_a => [0x27C0..0x27EF] doesn't work because Unicode blocks have holes in them. For example, there's nothing at 0x27CB. Take a look at the code chart [PDF]. Writing these arrays by hand is tedious, error-prone and a bit fun. And I get the feeling that someone has already tackled this in Perl!

    Read the article

  • Thread-safe get (accessor method)

    - by sonofdelphi
    I'm currently using the following code for thread-safe access of a variable. int gnVariable; void getVariableValue(int *pnValue) { acquireLock(); //Acquires the protection mechanism *pnValue = gnVariable; releaseLock(); //Releasing the protection mechanism } I would like to change my API signature to a more user-friendly int getVariableValue(void); How should I rewrite the function - such that the users of the API don't have to bother about the locking/unlocking details?

    Read the article

  • Best Java thread-safe locking mechanism for collections?

    - by Simon
    What would be the least-slow thread-safe mechanism for controlling multiple accesses to a collection in Java? I am adding objects to the top of a collection and i am very unsure what would be the best performing collection. Would it be a vector or a queue? I originally thought an ArrayList would be fast but i ran some experiments and it was very slow. EDIT: In my insertion testing a Vector delared using volatile seems to be the fastest?

    Read the article

  • Is there a way to test if a scalar has been stringified or not?

    - by Yobert
    I am writing a thing to output something similar to JSON, from a perl structure. I want the quoting to behave like this: "string" outputs "string" "05" outputs "05" "5" outputs "5" 5 outputs 5 05 outputs 5, or 05 would be acceptable JSON::XS handles this by testing if a scalar has been "stringified" or not, which I think is very cool. But I can't find a way to do this test myself without writing XS, which I'd rather avoid. Is this possible? I can't find this anywhere on CPAN without finding vast pedantry about Scalar::Util::looks_like_number, etc which completely isn't what I want. The only stopgap I can find is Devel::Peek, which feels evil. And also, just like JSON::XS, I'm fine with this secenario: my $a = 5; print $a."\n"; # now $a outputs "5" instead of 5)

    Read the article

  • Encoding regarding Term::Size

    - by sid_com
    Hello! The Term::Size-module jumbles up the encoding. How can I fix this? #!/usr/bin/env perl use warnings; use strict; use 5.010; use utf8; binmode STDOUT, ':encoding(UTF-8)'; use Term::Size; my $string = 'Hällö'; say $string; my $columns = ( Term::Size::chars *STDOUT{IO} )[0]; say $columns; say $string; Output: Hällö 140 H?ll?

    Read the article

  • How Can I Run a Regex that Tests Text for Characters in a Particular Alphabet or Script?

    - by Eli
    I'd like to make a regex in Perl that will test a string for a characters in a particular string. This would be something like: $text =~ .*P{'Chinese'}.* Is there a simple way of doing this, for English it's pretty easy by just testing for [a-zA-Z], but for a script like Chinese, or one of the Japanese scripts, I can't figure out any way of doing this short of writing out every character explicitly, which would make for some very ugly code. Ideas? I can't be the first/only person that's wanted to do this.

    Read the article

  • How does the #! work?

    - by mocybin
    In a script you must include a #! on the first line followed by the path to the program that will execute the script (e.g.: sh, perl). As far as I know though, the # character denotes the start of a comment and that line is supposed to be ignored by the program executing the script. It would seem though, that this first line is at some point read by something in order for the script to be executed by the proper program. Could somebody please shed more light on the workings of the #! ? Edit: I'm really curious about this, so the more in-depth the answer the better.

    Read the article

  • How can I start a new glutMainLoop() after exiting one?

    - by angaran
    I've written a PERL script using OpenGL. It calls glutMainLoop() to let the user view some stuff, then the user closes the window but I want to let him continue using the script and reopening a new window and seeing some other stuff. Is that possible? I've found that it is possible to execute this instruction: glutSetOption(GLUT_ACTION_ON_WINDOW_CLOSE,GLUT_ACTION_GLUTMAINLOOP_RETURNS); to return to the code after the window is closed. But then if I call again a glut* function it tells me that I can't call it without calling glutInit and if I call glutInit it tells me that I can't just call it again! Is there some trick?

    Read the article

  • java Thread class run() method

    - by JavaUser
    Hi, Thread class has run method to implement the business logic that could be executed in parallel.But I want implement different business logics in a single run method and to run simultaneously.How to get this feature. thanks

    Read the article

  • pyqt QObject: Cannot create children for a parent that is in a different thread

    - by memomk
    QObject: Cannot create children for a parent that is in a different thread. (Parent is QTextDocument(0x9919018), parent's thread is QThread(0x97331e0), current thread is flooderthread(0x97b4c10) error means ? am sorry because am new to pyqt here is the code : i know the code is finished yet but it should work i guess the problem is with myfun.log function... #! /usr/bin/python # -*- coding: utf-8 -*- import urllib, urllib2, itertools, threading, cookielib, Cookie, sys, time, hashlib, os from PyQt4 import QtCore, QtGui try: _fromUtf8 = QtCore.QString.fromUtf8 except AttributeError: _fromUtf8 = lambda s: s gui=QtGui.QApplication.processEvents texttoset="" class fun(): global texttoset def checkpassword(self): if ui.passwordcheck.isChecked()==True: return 1 else : return 0 def log(self, text): if text != False: firsttext=str(ui.console.toPlainText()) secondtext=firsttext+text+"\n" ui.console.setText(secondtext) log=open("log.log", "a") log.write(text+"\n") log.close() else : firsttext=str(ui.console.toPlainText()) secondtext=firsttext+texttoset+"\n" ui.console.setText(secondtext) log=open("log.log", "a") log.write(texttoset+"\n") log.close() def disable(self): MainWindow.setEnabled(False) pass def enable(self): MainWindow.setEnabled(True) pass def checkmethod(self): if ui.get.isChecked()==True: return 1 elif ui.post.isChecked()==True: return 2 else : return 0 def main(self): connecter() gui() f1.start() gui() time.sleep(3) gui() f2.start() gui() time.sleep(3) gui() f3.start() gui() time.sleep(3) gui() f4.start() gui() time.sleep(3) gui() f5.start() gui() self.sleep(3) gui() f6.start() gui() def killer(self): f1.terminate() f2.terminate() f3.terminate() f4.terminate() f5.terminate() f6.terminate() def close(self): self.killer() os.abort() sys.exit() myfun=fun() def connecter(): QtCore.QObject.connect(f1, QtCore.SIGNAL("log(bool)"), myfun.log) QtCore.QObject.connect(f1, QtCore.SIGNAL("enable()"), myfun.enable) QtCore.QObject.connect(f1, QtCore.SIGNAL("disable()"), myfun.disable) QtCore.QObject.connect(f2, QtCore.SIGNAL("log(bool)"), myfun.log) QtCore.QObject.connect(f2, QtCore.SIGNAL("enable()"), myfun.enable) QtCore.QObject.connect(f2, QtCore.SIGNAL("disable()"), myfun.disable) QtCore.QObject.connect(f3, QtCore.SIGNAL("log(bool)"), myfun.log) QtCore.QObject.connect(f3, QtCore.SIGNAL("enable()"), myfun.enable) QtCore.QObject.connect(f3, QtCore.SIGNAL("disable()"), myfun.disable) QtCore.QObject.connect(f4, QtCore.SIGNAL("log(bool)"), myfun.log) QtCore.QObject.connect(f4, QtCore.SIGNAL("enable()"), myfun.enable) QtCore.QObject.connect(f4, QtCore.SIGNAL("disable()"), myfun.disable) QtCore.QObject.connect(f5, QtCore.SIGNAL("log(bool)"), myfun.log) QtCore.QObject.connect(f5, QtCore.SIGNAL("enable()"), myfun.enable) QtCore.QObject.connect(f5, QtCore.SIGNAL("disable()"), myfun.disable) QtCore.QObject.connect(f6, QtCore.SIGNAL("log(bool)"), myfun.log) QtCore.QObject.connect(f6, QtCore.SIGNAL("enable()"), myfun.enable) QtCore.QObject.connect(f6, QtCore.SIGNAL("disable()"), myfun.disable) x=0 num=0 class flooderthread(QtCore.QThread): global texttoset def __init__(self, x, num): QtCore.QThread.__init__(self) self.x=x self.num=num def log(self, text): texttolog=str(text) time.sleep(1) self.emit(QtCore.SIGNAL("log(bool)"), False) time.sleep(2) def enable(self): time.sleep(1) self.emit(QtCore.SIGNAL("enable()")) def disable(self): time.sleep(1) self.emit(QtCore.SIGNAL("disable()")) def run(self): connecter() self.log("\n\n--------------------------------------------------new session-------------------------------------\n\n") itered=False gui() self.disable() gui() self.log("setting params...") param={ui.dataname1.text():ui.datavalue1.text(),ui.dataname3.text():ui.datavalue3.text(),ui.dataname3.text():ui.datavalue3.text(), } self.log("checking password...") if myfun.checkpassword()==1: itered=True self.log("password is true") else : self.log("password is null ") self.log("itered operation") self.log("setting url") url=str(ui.url.text()) if url[:4]!="http" and url[:3]!="ftp": self.log("url error exiting the whole function") self.log("please set a valide protocole!!") gui() self.enable() gui() return 1 pass else : self.log("valid url") gui() self.log("url is "+url) self.log("setting proxy") proxy="http://"+ui.proxyuser.text()+":"+ui.proxypass.text()+"@"+ui.proxyhost.text()+":"+ui.proxyport.text() self.log("proxy is "+proxy) gui() self.log("preparing params...") urlparam=urllib.urlencode(param) gui() self.log("params are "+urlparam) self.log("setting up headers...") header={'User-Agent':str(ui.useragent.toPlainText())} self.log("headers are "+ str(header)) self.log("setting up proxy handler..") proxyhandler=urllib2.ProxyHandler({"http":str(proxy)}) self.log("checking method") if myfun.checkmethod()==1: self.log("method is get..") self.log("setting request..") finalurl=url+urlparam gui() self.log("final url is"+finalurl) req=urllib2.Request(finalurl, None, headers) elif myfun.checkmethod()==2: self.log("method is post...") self.log("setting request..") finalurl=url gui() self.log("final url is "+finalurl) req=urllib2.Request(finalurl, urlparam, header) else : self.log("error has been accourded") self.log("please select a method!!") gui() self.log("exiting the whole functions") gui() self.enable() return 1 pass self.log("intilizing cookies..") c1=Cookie.SimpleCookie() c1[str(ui.cookiename1.text())]=str(ui.cookievalue1.text()) c1[str(ui.cookiename1.text())]['path']='/' c1[str(ui.cookiename2.text())]=str(ui.cookievalue2.text()) c1[str(ui.cookiename2.text())]['path']='/' c1[str(ui.cookiename3.text())]=str(ui.cookievalue3.text()) c1[str(ui.cookiename3.text())]['domain']=url c1[str(ui.cookiename3.text())]['path']='/' c1[str(ui.cookiename4.text())]=str(ui.cookievalue4.text()) c1[str(ui.cookiename4.text())]['domain']=url c1[str(ui.cookiename4.text())]['path']='/' self.log("cookies are.. :"+str(c1)) cj=cookielib.CookieJar() cj.set_cookie(c1) opener = urllib2.build_opener(proxyhandler, urllib2.HTTPCookieProcessor(cj)) self.log("insatlling opener") urllib2.install_opener(opener) self.log("setting the two operations....") if itered==Fasle: self.log("starting the flooding loop") gui() while true: try: gui() opener.open(req) except e: self.log("error connecting : "+e.reason) self.log("will continue....") continue gui() elif itered==True: pass f1=flooderthread(1, 1) f2=flooderthread(2, 2) f3=flooderthread(3, 3) f4=flooderthread(4, 4) f5=flooderthread(5, 5) f6=flooderthread(6, 6) class Ui_MainWindow(object): def setupUi(self, MainWindow): MainWindow.setObjectName(_fromUtf8("MainWindow")) MainWindow.setMinimumSize(QtCore.QSize(838, 500)) MainWindow.setMaximumSize(QtCore.QSize(838, 500)) MainWindow.setWindowTitle(QtGui.QApplication.translate("MainWindow", "memo flooder", None, QtGui.QApplication.UnicodeUTF8)) self.centralwidget = QtGui.QWidget(MainWindow) self.centralwidget.setObjectName(_fromUtf8("centralwidget")) self.console=QtGui.QTextEdit(self.centralwidget) self.console.setGeometry(10, 350, 800,130) self.console.setReadOnly(True) self.console.setObjectName("console") self.groupBox = QtGui.QGroupBox(self.centralwidget) self.groupBox.setGeometry(QtCore.QRect(30, 50, 71, 80)) self.groupBox.setTitle(QtGui.QApplication.translate("MainWindow", "method:", None, QtGui.QApplication.UnicodeUTF8)) self.groupBox.setObjectName(_fromUtf8("groupBox")) self.post = QtGui.QRadioButton(self.groupBox) self.post.setGeometry(QtCore.QRect(10, 20, 61, 22)) self.post.setText(QtGui.QApplication.translate("MainWindow", "post", None, QtGui.QApplication.UnicodeUTF8)) self.post.setChecked(True) self.post.setObjectName(_fromUtf8("post")) self.get = QtGui.QRadioButton(self.groupBox) self.get.setGeometry(QtCore.QRect(10, 50, 51, 22)) self.get.setText(QtGui.QApplication.translate("MainWindow", "get", None, QtGui.QApplication.UnicodeUTF8)) self.get.setObjectName(_fromUtf8("get")) self.url = QtGui.QLineEdit(self.centralwidget) self.url.setGeometry(QtCore.QRect(70, 20, 671, 27)) self.url.setInputMethodHints(QtCore.Qt.ImhUrlCharactersOnly) self.url.setObjectName(_fromUtf8("url")) self.groupBox_2 = QtGui.QGroupBox(self.centralwidget) self.groupBox_2.setGeometry(QtCore.QRect(110, 50, 371, 111)) self.groupBox_2.setTitle(QtGui.QApplication.translate("MainWindow", "data:", None, QtGui.QApplication.UnicodeUTF8)) self.groupBox_2.setObjectName(_fromUtf8("groupBox_2")) self.dataname1 = QtGui.QLineEdit(self.groupBox_2) self.dataname1.setGeometry(QtCore.QRect(20, 30, 101, 27)) self.dataname1.setObjectName(_fromUtf8("dataname1")) self.label = QtGui.QLabel(self.groupBox_2) self.label.setGeometry(QtCore.QRect(40, 10, 67, 17)) self.label.setText(QtGui.QApplication.translate("MainWindow", "name:", None, QtGui.QApplication.UnicodeUTF8)) self.label.setObjectName(_fromUtf8("label")) self.dataname2 = QtGui.QLineEdit(self.groupBox_2) self.dataname2.setGeometry(QtCore.QRect(130, 30, 113, 27)) self.dataname2.setObjectName(_fromUtf8("dataname2")) self.dataname3 = QtGui.QLineEdit(self.groupBox_2) self.dataname3.setGeometry(QtCore.QRect(250, 30, 113, 27)) self.dataname3.setObjectName(_fromUtf8("dataname3")) self.label_2 = QtGui.QLabel(self.groupBox_2) self.label_2.setGeometry(QtCore.QRect(40, 60, 67, 17)) self.label_2.setText(QtGui.QApplication.translate("MainWindow", "value:", None, QtGui.QApplication.UnicodeUTF8)) self.label_2.setObjectName(_fromUtf8("label_2")) self.datavalue1 = QtGui.QLineEdit(self.groupBox_2) self.datavalue1.setGeometry(QtCore.QRect(20, 80, 101, 27)) self.datavalue1.setObjectName(_fromUtf8("datavalue1")) self.datavalue2 = QtGui.QLineEdit(self.groupBox_2) self.datavalue2.setGeometry(QtCore.QRect(130, 80, 113, 27)) self.datavalue2.setObjectName(_fromUtf8("datavalue2")) self.datavalue3 = QtGui.QLineEdit(self.groupBox_2) self.datavalue3.setGeometry(QtCore.QRect(250, 80, 113, 27)) self.datavalue3.setObjectName(_fromUtf8("datavalue3")) self.groupBox_4 = QtGui.QGroupBox(self.centralwidget) self.groupBox_4.setGeometry(QtCore.QRect(670, 50, 151, 111)) self.groupBox_4.setTitle(QtGui.QApplication.translate("MainWindow", "password:", None, QtGui.QApplication.UnicodeUTF8)) self.groupBox_4.setObjectName(_fromUtf8("groupBox_4")) self.passname = QtGui.QLineEdit(self.groupBox_4) self.passname.setGeometry(QtCore.QRect(10, 30, 113, 27)) self.passname.setObjectName(_fromUtf8("passname")) self.passvalue = QtGui.QLineEdit(self.groupBox_4) self.passvalue.setGeometry(QtCore.QRect(10, 80, 113, 27)) self.passvalue.setObjectName(_fromUtf8("passvalue")) self.passwordcheck = QtGui.QCheckBox(self.centralwidget) self.passwordcheck.setGeometry(QtCore.QRect(670, 180, 97, 22)) self.passwordcheck.setText(QtGui.QApplication.translate("MainWindow", "password", None, QtGui.QApplication.UnicodeUTF8)) self.passwordcheck.setChecked(True) self.passwordcheck.setObjectName(_fromUtf8("passwordcheck")) self.groupBox_5 = QtGui.QGroupBox(self.centralwidget) self.groupBox_5.setGeometry(QtCore.QRect(29, 169, 441, 81)) self.groupBox_5.setTitle(QtGui.QApplication.translate("MainWindow", "proxy:", None, QtGui.QApplication.UnicodeUTF8)) self.groupBox_5.setObjectName(_fromUtf8("groupBox_5")) self.proxyhost = QtGui.QLineEdit(self.groupBox_5) self.proxyhost.setGeometry(QtCore.QRect(20, 30, 113, 27)) self.proxyhost.setObjectName(_fromUtf8("proxyhost")) self.proxyport = QtGui.QLineEdit(self.groupBox_5) self.proxyport.setGeometry(QtCore.QRect(140, 30, 51, 27)) self.proxyport.setInputMethodHints(QtCore.Qt.ImhDigitsOnly|QtCore.Qt.ImhPreferNumbers) self.proxyport.setObjectName(_fromUtf8("proxyport")) self.proxyuser = QtGui.QLineEdit(self.groupBox_5) self.proxyuser.setGeometry(QtCore.QRect(200, 30, 113, 27)) self.proxyuser.setObjectName(_fromUtf8("proxyuser")) self.proxypass = QtGui.QLineEdit(self.groupBox_5) self.proxypass.setGeometry(QtCore.QRect(320, 30, 113, 27)) self.proxypass.setObjectName(_fromUtf8("proxypass")) self.label_4 = QtGui.QLabel(self.groupBox_5) self.label_4.setGeometry(QtCore.QRect(100, 10, 67, 17)) self.label_4.setText(QtGui.QApplication.translate("MainWindow", "host", None, QtGui.QApplication.UnicodeUTF8)) self.label_4.setObjectName(_fromUtf8("label_4")) self.label_5 = QtGui.QLabel(self.groupBox_5) self.label_5.setGeometry(QtCore.QRect(150, 10, 67, 17)) self.label_5.setText(QtGui.QApplication.translate("MainWindow", "port", None, QtGui.QApplication.UnicodeUTF8)) self.label_5.setObjectName(_fromUtf8("label_5")) self.label_6 = QtGui.QLabel(self.groupBox_5) self.label_6.setGeometry(QtCore.QRect(200, 10, 67, 17)) self.label_6.setText(QtGui.QApplication.translate("MainWindow", "username", None, QtGui.QApplication.UnicodeUTF8)) self.label_6.setObjectName(_fromUtf8("label_6")) self.label_7 = QtGui.QLabel(self.groupBox_5) self.label_7.setGeometry(QtCore.QRect(320, 10, 67, 17)) self.label_7.setText(QtGui.QApplication.translate("MainWindow", "password", None, QtGui.QApplication.UnicodeUTF8)) self.label_7.setObjectName(_fromUtf8("label_7")) self.groupBox_6 = QtGui.QGroupBox(self.centralwidget) self.groupBox_6.setGeometry(QtCore.QRect(30, 260, 531, 91)) self.groupBox_6.setTitle(QtGui.QApplication.translate("MainWindow", "cookies:", None, QtGui.QApplication.UnicodeUTF8)) self.groupBox_6.setObjectName(_fromUtf8("groupBox_6")) self.cookiename1 = QtGui.QLineEdit(self.groupBox_6) self.cookiename1.setGeometry(QtCore.QRect(10, 20, 113, 27)) self.cookiename1.setObjectName(_fromUtf8("cookiename1")) self.cookiename2 = QtGui.QLineEdit(self.groupBox_6) self.cookiename2.setGeometry(QtCore.QRect(140, 20, 113, 27)) self.cookiename2.setObjectName(_fromUtf8("cookename2")) self.cookiename3 = QtGui.QLineEdit(self.groupBox_6) self.cookiename3.setGeometry(QtCore.QRect(270, 20, 113, 27)) self.cookiename3.setObjectName(_fromUtf8("cookiename3")) self.cookiename4 = QtGui.QLineEdit(self.groupBox_6) self.cookiename4.setGeometry(QtCore.QRect(390, 20, 113, 27)) self.cookiename4.setObjectName(_fromUtf8("cookiename4")) self.cookievalue1 = QtGui.QLineEdit(self.groupBox_6) self.cookievalue1.setGeometry(QtCore.QRect(10, 50, 113, 27)) self.cookievalue1.setObjectName(_fromUtf8("cookievalue1")) self.cookievalue2 = QtGui.QLineEdit(self.groupBox_6) self.cookievalue2.setGeometry(QtCore.QRect(140, 50, 113, 27)) self.cookievalue2.setObjectName(_fromUtf8("cookievalue2")) self.cookievalue3 = QtGui.QLineEdit(self.groupBox_6) self.cookievalue3.setGeometry(QtCore.QRect(270, 50, 113, 27)) self.cookievalue3.setObjectName(_fromUtf8("cookievalue3")) self.cookievalue4 = QtGui.QLineEdit(self.groupBox_6) self.cookievalue4.setGeometry(QtCore.QRect(390, 50, 113, 27)) self.cookievalue4.setObjectName(_fromUtf8("cookievalue4")) self.groupBox_7 = QtGui.QGroupBox(self.centralwidget) self.groupBox_7.setGeometry(QtCore.QRect(570, 260, 251, 80)) self.groupBox_7.setTitle(QtGui.QApplication.translate("MainWindow", "useragents:", None, QtGui.QApplication.UnicodeUTF8)) self.groupBox_7.setObjectName(_fromUtf8("groupBox_7")) self.useragent = QtGui.QTextEdit(self.groupBox_7) self.useragent.setGeometry(QtCore.QRect(10, 20, 211, 51)) self.useragent.setVerticalScrollBarPolicy(QtCore.Qt.ScrollBarAlwaysOn) self.useragent.setObjectName(_fromUtf8("useragent")) self.start = QtGui.QPushButton(self.centralwidget) self.start.setGeometry(QtCore.QRect(750, 20, 71, 27)) self.start.setText(QtGui.QApplication.translate("MainWindow", "start", None, QtGui.QApplication.UnicodeUTF8)) self.start.setObjectName(_fromUtf8("start")) self.label_3 = QtGui.QLabel(self.centralwidget) self.label_3.setGeometry(QtCore.QRect(30, 20, 67, 17)) self.label_3.setText(QtGui.QApplication.translate("MainWindow", "url :", None, QtGui.QApplication.UnicodeUTF8)) self.label_3.setObjectName(_fromUtf8("label_3")) MainWindow.setCentralWidget(self.centralwidget) QtCore.QObject.connect(self.start, QtCore.SIGNAL(_fromUtf8("clicked(bool)")), myfun.main) QtCore.QObject.connect(self.passwordcheck, QtCore.SIGNAL(_fromUtf8("clicked(bool)")), self.groupBox_4.setEnabled) QtCore.QMetaObject.connectSlotsByName(MainWindow) def __del__(): myfun.killer() os.abort() sys.exit() app = QtGui.QApplication(sys.argv) MainWindow = QtGui.QMainWindow() ui = Ui_MainWindow() ui.setupUi(MainWindow) myfun.log("\n\n--------------------------------------------------new session-------------------------------------\n\n") MainWindow.show() sys.exit(app.exec_())

    Read the article

  • Uneditable file and Unreadable(for further processing) file( WHY? ) after processing it through C++

    - by mgj
    Hi...:) This might look to be a very long question to you I understand, but trust me on this its not long. I am not able to identify why after processing this text is not being able to be read and edited. I tried using the ord() function in python to check if the text contains any Unicode characters( non ascii characters) apart from the ascii ones.. I found quite a number of them. I have a strong feeling that this could be due to the original text itself( The INPUT ). Input-File: Just copy paste it into a file "acle5v1.txt" The objective of this code below is to check for upper case characters and to convert it to lower case and also to remove all punctuations so that these words are taken for further processing for word alignment #include<iostrea> #include<fstream> #include<ctype.h> #include<cstring> using namespace std; ifstream fin2("acle5v1.txt"); ofstream fin3("acle5v1_op.txt"); ofstream fin4("chkcharadded.txt"); ofstream fin5("chkcharntadded.txt"); ofstream fin6("chkprintchar.txt"); ofstream fin7("chknonasci.txt"); ofstream fin8("nonprinchar.txt"); int main() { char ch,ch1; fin2.seekg(0); fin3.seekp(0); int flag = 0; while(!fin2.eof()) { ch1=ch; fin2.get(ch); if (isprint(ch))// if the character is printable flag = 1; if(flag) { fin6<<"Printable character:\t"<<ch<<"\t"<<(int)ch<<endl; flag = 0; } else { fin8<<"Non printable character caught:\t"<<ch<<"\t"<<int(ch)<<endl; } if( isalnum(ch) || ch == '@' || ch == ' ' )// checks for alpha numeric characters { fin4<<"char added: "<<ch<<"\tits ascii value: "<<int(ch)<<endl; if(isupper(ch)) { //tolower(ch); fin3<<(char)tolower(ch); } else { fin3<<ch; } } else if( ( ch=='\t' || ch=='.' || ch==',' || ch=='#' || ch=='?' || ch=='!' || ch=='"' || ch != ';' || ch != ':') && ch1 != ' ' ) { fin3<<' '; } else if( (ch=='\t' || ch=='.' || ch==',' || ch=='#' || ch=='?' || ch=='!' || ch=='"' || ch != ';' || ch != ':') && ch1 == ' ' ) { //fin3<<" '; } else if( !(int(ch)>=0 && int(ch)<=127) ) { fin5<<"Char of ascii within range not added: "<<ch<<"\tits ascii value: "<<int(ch)<<endl; } else { fin7<<"Non ascii character caught(could be a -ve value also)\t"<<ch<<int(ch)<<endl; } } return 0; } I have a similar code as the above written in python which gives me an otput which is again not readable and not editable The code in python looks like this: #!/usr/bin/python # -*- coding: UTF-8 -*- import sys input_file=sys.argv[1] output_file=sys.argv[2] list1=[] f=open(input_file) for line in f: line=line.strip() #line=line.rstrip('.') line=line.replace('.','') line=line.replace(',','') line=line.replace('#','') line=line.replace('?','') line=line.replace('!','') line=line.replace('"','') line=line.replace('?','') line=line.replace('|','') line = line.lower() list1.append(line) f.close() f1=open(output_file,'w') f1.write(' '.join(list1)) f1.close() the file takes ip and op at runtime.. as: python punc_remover.py acle5v1.txt acle5v1_op.txt The output of this file is in "acle5v1_op.txt" now after processing this particular output file is needed for further processing. This particular file "aclee5v1_op.txt" is the UNREADABLE Aand UNEDITABLE File that I am not being able to use for further processing. I need this for Word alignment in NLP. I tried readin this output with the following program #include<iostream> #include<fstream> using namespace std; ifstream fin1("acle5v1_op.txt"); ofstream fout1("chckread_acle5v1_op.txt"); ofstream fout2("chcknotread_acle5v1_op.txt"); int main() { char ch; int flag = 0; long int r = 0; long int nr = 0; while(!(fin1)) { fin1.get(ch); if(ch) { flag = 1; } if(flag) { fout1<<ch; flag = 0; r++; } else { fout2<<"Char not been able to be read from source file\n"; nr++; } } cout<<"Number of characters able to be read: "<<r; cout<<endl<<"Number of characters not been able to be read: "<<nr; return 0; } which prints the character if its readable and if not it doesn't print them but I observed the output of both the file is blank thus I could draw a conclusion that this file "acle5v1_op.txt" is UNREADABLE AND UNEDITABLE. Could you please help me on how to deal with this problem.. To tell you a bit about the statistics wrt the original input file "acle5v1.txt" file it has around 3441 lines in it and around 3 million characters in it. Keeping in mind the number of characters in the file you editor might/might not be able to manage to open the file.. I was able to open the file in gedit of Fedora 10 which I am currently using .. This is just to notify you that opening with a particular editor was not actually an issue at least in my case... Can I use scripting languages like Python and Perl to deal with this problem if Yes how? could please be specific on that regard as I am a novice to Perl and Python. Or could you please tell me how do I solve this problem using C++ itself.. Thank you...:) I am really looking forward to some help or guidance on how to go about this problem....

    Read the article

< Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >