Search Results

Search found 3518 results on 141 pages for 'arguments'.

Page 119/141 | < Previous Page | 115 116 117 118 119 120 121 122 123 124 125 126  | Next Page >

  • Method not being resolved for dynamic generic type

    - by kelloti
    I have these types: public class GenericDao<T> { public T Save(T t) { return t; } } public abstract class DomainObject { // Some properties protected abstract dynamic Dao { get; } public virtual void Save() { var dao = Dao; dao.Save(this); } } public class Attachment : DomainObject { protected dynamic Dao { get { return new GenericDao<Attachment>(); } } } Then when I run this code it fails with RuntimeBinderException: Best overloaded method match for 'GenericDAO<Attachment.Save(Attachment)' has some invalid arguments var obj = new Attachment() { /* set properties */ }; obj.Save(); I've verified that in DomainObject.Save() "this" is definitely Attachment, so the error doesn't really make sense. Can anyone shed some light on why the method isn't resolving? Some more information - It succeeds if I change the contents of DomainObject.Save() to use reflection: public virtual void Save() { var dao = Dao; var type = dao.GetType(); var save = ((Type)type).GetMethod("Save"); save.Invoke(dao, new []{this}); }

    Read the article

  • Memory management of objects returned by methods (iOS / Objective-C)

    - by iOSNewb
    I am learning Objective-C and iOS programming through the terrific iTunesU course posted by Stanford (http://www.stanford.edu/class/cs193p/cgi-bin/drupal/) Assignment 2 is to create a calculator with variable buttons. The chain of commands (e.g. 3+x-y) is stored in a NSMutableArray as "anExpression", and then we sub in random values for x and y based on an NSDictionary to get a solution. This part of the assignment is tripping me up: The final two [methods] “convert” anExpression to/from a property list: + (id)propertyListForExpression:(id)anExpression; + (id)expressionForPropertyList:(id)propertyList; You’ll remember from lecture that a property list is just any combination of NSArray, NSDictionary, NSString, NSNumber, etc., so why do we even need this method since anExpression is already a property list? (Since the expressions we build are NSMutableArrays that contain only NSString and NSNumber objects, they are, indeed, already property lists.) Well, because the caller of our API has no idea that anExpression is a property list. That’s an internal implementation detail we have chosen not to expose to callers. Even so, you may think, the implementation of these two methods is easy because anExpression is already a property list so we can just return the argument right back, right? Well, yes and no. The memory management on this one is a bit tricky. We’ll leave it up to you to figure out. Give it your best shot. Obviously, I am missing something with respect to memory management because I don't see why I can't just return the passed arguments right back. Thanks in advance for any answers!

    Read the article

  • Generic Class Vb.net

    - by KoolKabin
    hi guys, I am stuck with a problem about generic classes. I am confused how I call the constructor with parameters. My interface: Public Interface IDBObject Sub [Get](ByRef DataRow As DataRow) Property UIN() As Integer End Interface My Child Class: Public Class User Implements IDBObject Public Sub [Get](ByRef DataRow As System.Data.DataRow) Implements IDBObject.Get End Sub Public Property UIN() As Integer Implements IDBObject.UIN Get End Get Set(ByVal value As Integer) End Set End Property End Class My Next Class: Public Class Users Inherits DBLayer(Of User) #Region " Standard Methods " #End Region End Class My DBObject Class: Public Class DBLayer(Of DBObject As {New, IDBObject}) Public Shared Function GetData() As List(Of DBObject) Dim QueryString As String = "SELECT * ***;" Dim Dataset As DataSet = New DataSet() Dim DataList As List(Of DBObject) = New List(Of DBObject) Try Dataset = Query(QueryString) For Each DataRow As DataRow In Dataset.Tables(0).Rows **DataList.Add(New DBObject(DataRow))** Next Catch ex As Exception DataList = Nothing End Try Return DataList End Function End Class I get error in the starred area of the DBLayer Object. What might be the possible reason? what can I do to fix it? I even want to add New(byval someval as datatype) in IDBObject interface for overloading construction. but it also gives an error? how can i do it? Adding Sub New(ByVal DataRow As DataRow) in IDBObject producess following error 'Sub New' cannot be declared in an interface. Error Produced in DBLayer Object line: DataList.Add(New DBObject(DataRow)) Msg: Arguments cannot be passed to a 'New' used on a type parameter.

    Read the article

  • Java Generic Type and Reflection

    - by Tom Tucker
    I have some tricky generic type problem involving reflection. Here's the code. public @interface MyConstraint { Class<? extends MyConstraintValidator<?>> validatedBy(); } public interface MyConstraintValidator<T extends Annotation> { void initialize(T annotation); } /** @param annotation is annotated with MyConstraint. */ public void run(Annotation annotation) { Class<? extends MyConstraintValidator<? extends Annotation>> validatorClass = annotation.annotationType().getAnnotation(MyConstraint.class).validatedBy(); validatorClass.newInstance().initialize(annotation) // will not compile! } The run() method above will not compile because of the following error. The method initialize(capture#10-of ? extends Annotation) in the type MyConstraintValidator<capture#10-of ? extends Annotation> is not applicable for the arguments (Annotation) If I remove the wild cards, then it compiles and works fine. What would be the propert way to declare the type parameter for the vairable validatorClass? Thanks.

    Read the article

  • Slightly different execution times between python2 and python3

    - by user557634
    Hi. Lastly I wrote a simple generator of permutations in python (implementation of "plain changes" algorithm described by Knuth in "The Art... 4"). I was curious about the differences in execution time of it between python2 and python3. Here is my function: def perms(s): s = tuple(s) N = len(s) if N <= 1: yield s[:] raise StopIteration() for x in perms(s[1:]): for i in range(0,N): yield x[:i] + (s[0],) + x[i:] I tested both using timeit module. My tests: $ echo "python2.6:" && ./testing.py && echo "python3:" && ./testing3.py python2.6: args time[ms] 1 0.003811 2 0.008268 3 0.015907 4 0.042646 5 0.166755 6 0.908796 7 6.117996 8 48.346996 9 433.928967 10 4379.904032 python3: args time[ms] 1 0.00246778964996 2 0.00656183719635 3 0.01419159912 4 0.0406293644678 5 0.165960511097 6 0.923101452814 7 6.24257639835 8 53.0099868774 9 454.540967941 10 4585.83498001 As you can see, for number of arguments less than 6, python 3 is faster, but then roles are reversed and python2.6 does better. As I am a novice in python programming, I wonder why is that so? Or maybe my script is more optimized for python2? Thank you in advance for kind answer :)

    Read the article

  • Being pressured to GOTO the dark-side

    - by Dan McG
    We have a situation at work where developers working on a legacy (core) system are being pressured into using GOTO statements when adding new features into existing code that is already infected with spagetti code. Now, I understand there may be arguments for using 'just one little GOTO' instead of spending the time on refactoring to a more maintainable solution. The issue is, this isolated 'just one little GOTO' isn't so isolated. At least once every week or so there is a new 'one little GOTO' to add. This codebase is already a horror to work with due to code dating back to or before 1984 being riddled with GOTOs that would make many Pastafarians believe it was inspired by the Flying Spagetti Monster itself. Unfortunately the language this is written in doesn't have any ready made refactoring tools, so it makes it harder to push the 'Refactor to increase productivity later' because short-term wins are the only wins paid attention to here... Has anyone else experienced this issue whereby everybody agrees that we cannot be adding new GOTOs to jump 2000 lines to a random section, but continually have Anaylsts insist on doing it just this one time and having management approve it? tldr; How can one go about addressing the issue of developers being pressured (forced) to continually add GOTO statements (by add, I mean add to jump to random sections many lines away) because it 'gets that feature in quicker'? I'm beginning to fear we may loses valuable developers to the raptors over this...

    Read the article

  • Breaking dependencies when you can't make changes to other files?

    - by codemuncher
    I'm doing some stealth agile development on a project. The lead programmer sees unit testing, refactoring, etc as a waste of resources and there is no way to convince him otherwise. His philosophy is "If it ain't broke don't fix it" and I understand his point of view. He's been working on the project for over a decade and knows the code inside and out. I'm not looking to debate development practices. I'm new to the project and I've been tasked with adding a new feature. I've worked on legacy projects before and used agile development practices with good result but those teams were more receptive to the idea and weren't afraid of making changes to code. I've been told I can use whatever development methodology I want but I have to limit my changes to only those necessary to add the feature. I'm using tdd for the new classes I'm writing but I keep running into road blocks caused by the liberal use of global variables and the high coupling in the classes I need to interact with. Normally I'd start extracting interfaces for these classes and make their dependence on the global variables explicit by injecting them as constructor arguments or public properties. I could argue that the changes are necessary but considering the lead never had to make them I doubt he would see it my way. What techniques can I use to break these dependencies without ruffling the lead developer's feathers? I've made some headway using: Extract Interface (for the new classes I'm creating) Extend and override the wayward classes with test stubs. (luckily most methods are public virtual) But these two can only get me so far.

    Read the article

  • converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

    - by Delirium tremens
    before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

    Read the article

  • Refining Search Results [PHP/MySQL]

    - by Dae
    I'm creating a set of search panes that allow users to tweak their results set after submitting a query. We pull commonly occurring values in certain fields from the results and display them in order of their popularity - you've all seen this sort of thing on eBay. So, if a lot of rows in our results were created in 2009, we'll be able to click "2009" and see only rows created in that year. What in your opinion is the most efficient way of applying these filters? My working solution was to discard entries from the results that didn't match the extra arguments, like: while($row = mysql_fetch_assoc($query)) { foreach($_GET as $key => $val) { if($val !== $row[$key]) { continue 2; } } // Output... } This method should hopefully only query the database once in effect, as adding filters doesn't change the query - MySQL can cache and reuse one data set. On the downside it makes pagination a bit of a headache. The obvious alternative would be to build any additional criteria into the initial query, something like: $sql = "SELECT * FROM tbl MATCH (title, description) AGAINST ('$search_term')"; foreach($_GET as $key => $var) { $sql .= " AND ".$key." = ".$var; } Are there good reasons to do this instead? Or are there better options altogether? Maybe a temporary table? Any thoughts much appreciated!

    Read the article

  • How can I build a generic dataset-handling Perl library?

    - by Pep.
    Hello, I want to build a generic Perl module for handling and analysing biomedical character separated datasets and which can, most certain, be used on any kind of datasets that contain a mixture of categorical (A,B,C,..) and continuous (1.2,3,881..) and identifier (XXX1,XXX2...). The plan is to have people initialize the module and then use some arguments to point to the data file(s), the place were the analysis reports should be placed and the structure of the data. By structure of data I mean which variable is in which place and its name/type. And this is where I need some enlightenment. I am baffled how to do this in a clean way. Obviously, having people create a simple schema file, be it XML or some other format would be the cleanest but maybe not all people enjoy doing something like this. The solutions I can think of are: Create a configuration file in XML or similar and with a prespecified format. Pass the information during initialization of the module. Use the first row of the data as headers and try to guess types (ouch) Surely there must be a "canonical" way of doing this that is also usable and efficient. Thanks p.

    Read the article

  • How to write an R function that evaluates an expression within a data-frame

    - by Prasad Chalasani
    Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

    Read the article

  • summing functions handles in matlab

    - by user552231
    Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

    Read the article

  • Why does Python sometimes upgrade a string to unicode and sometimes not?

    - by samtregar
    I'm confused. Consider this code working the way I expect: >>> foo = u'Émilie and Juañ are turncoats.' >>> bar = "foo is %s" % foo >>> bar u'foo is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' And this code not at all working the way I expect: >>> try: ... raise Exception(foo) ... except Exception as e: ... foo2 = e ... >>> bar = "foo2 is %s" % foo2 ------------------------------------------------------------ Traceback (most recent call last): File "<ipython console>", line 1, in <module> UnicodeEncodeError: 'ascii' codec can't encode characters in position 0-1: ordinal not in range(128) Can someone explain what's going on here? Why does it matter whether the unicode data is in a plain unicode string or stored in an Exception object? And why does this fix it: >>> bar = u"foo2 is %s" % foo2 >>> bar u'foo2 is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' I am quite confused! Thanks for the help! UPDATE: My coding buddy Randall has added to my confusion in an attempt to help me! Send in the reinforcements to explain how this is supposed to make sense: >>> class A: ... def __str__(self): return "string" ... def __unicode__(self): return "unicode" ... >>> "%s %s" % (u'niño', A()) u'ni\xc3\xb1o unicode' >>> "%s %s" % (A(), u'niño') u'string ni\xc3\xb1o' Note that the order of the arguments here determines which method is called!

    Read the article

  • recvfrom returns invalid argument when *from* is passed

    - by Aditya Sehgal
    I am currently writing a small UDP server program in linux. The UDP server will receive packets from two different peers and will perform different operations based on from which peer it received the packet. I am trying to determine the source from where I receive the packet. However, when select returns and recvfrom is called, it returns with an error of Invalid Argument. If I pass NULL as the second last arguments, recvfrom succeeds. I have tried declaring fromAddr as struct sockaddr_storage, struct sockaddr_in, struct sockaddr without any success. Is their something wrong with this code? Is this the correct way to determine the source of the packet? The code snippet follows. ` /*TODO : update for TCP. use recv */ if((pkInfo->rcvLen=recvfrom(psInfo->sockFd, pkInfo->buffer, MAX_PKTSZ, 0, /* (struct sockaddr*)&fromAddr,*/ NULL, &(addrLen) )) < 0) { perror("RecvFrom failed\n"); } else { /*Apply Filter */ #if 0 struct sockaddr_in* tmpAddr; tmpAddr = (struct sockaddr_in* )&fromAddr; printf("Received Msg From %s\n",inet_ntoa(tmpAddr->sin_addr)); #endif printf("Packet Received of len = %d\n",pkInfo->rcvLen); } `

    Read the article

  • C: incompatible types in assignment

    - by The.Anti.9
    I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

    Read the article

  • Should we retire the term "Context"?

    - by MrGumbe
    I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

    Read the article

  • How do i make multi call with SudzC

    - by laxonline
    I am developing magento eCommerce stores in iPhone. For that, i have using Sudzc service class for SOAP WS call. Now, I'm trying to create a cart session its working fine. im getting the cardid. And i need to add one product to cart with some arguments. below is the php request example i need to call same this PHP Request Example $proxy = new SoapClient('http://beta.saletab.com/api/soap/?wsdl'); $sessionId = $proxy->login('xxxx', 'zzzzzzzzzzzzzzzzzzzzzzzzz'); //print_r($sessionId); $shoppingCartId = $proxy->call( $sessionId, 'cart.create'); $result = $proxy->call($sessionId,'cart_product.add',array($shoppingCartId,array('product_id'=>"3109",'qty' => 2)),0); echo "REQUEST HEADERS:\n" . $result->__getLastRequestHeaders() . "\n"; IOS Request im trying to send some product details like productid, sku & cardid SDZMagentoService *service = [SDZMagentoService service]; NSString *sessionId = [IMAPP_DELEGATE getUserDefault:IMAPI_SESSIONID]; NSString *cartId = [IMAPP_DELEGATE getUserDefault:IMAPI_CARTSESSIONID]; NSDictionary *argu = [[NSDictionary alloc] initWithObjectsAndKeys:@"3109",@"product_id",@"2",@"qty",cartId,@"card_id", nil]; [service call:self action:@selector(cartTest:) sessionId:sessionId resourcePath:@"cart_product.add" args:argu];

    Read the article

  • DBD::CSV: Problem with userdefined functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Regular Expressions .NET

    - by Fosa
    I need a regular expression for some arguments that must match on a string. here it is... The string exists out of minimum 8 en maximum 20 characters. These characters of this string may be characters of the alfabet or special chars --With other words..all charachters except from the whitespaces In the complete string there must be atleast 1 number. The string cannot start with a number or an underscore The last 2 characters of the string must be identical, But it doenst matter if those last --identical characters are capital or non-capital (case insensitive) Must match all : +234567899 a_1de*Gg xy1Me*__ !41deF_hij2lMnopq3ss C234567890123$^67800 *5555555 sDF564zer"" !!!!!!!!!4!!!!!!!!!! abcdefghijklmnopq9ss May not match : Cannot be less then 8 or more then 20 chars: a_1+Eff B41def_hIJ2lmnopq3stt Cannot contain a whitespace: A_4 e*gg b41def_Hij2l nopq3ss Cannot start with a number or an underscore: __1+Eff 841DEf_hij2lmnopq3stt cannot end on 2 diffrent characters: a_1+eFg b41DEf_hij2lmnopq3st Cannot be without a number in the string: abCDefghijklmnopqrss abcdef+++dF !!!!!!!!!!!!!!!!!!!! ------------------------------------------------------ This is what I have so far...But I'm really breaking my head on this... If you Don't know the answer completely it's not a problem... I just want to get in the right direction ([^0-9_])(?=.*\d)(\S{8,20})(?i:[\S])\1

    Read the article

  • Update list dom only if list displayed

    - by Nikolaj Borisik
    Sometimes we use one store for few views(list, carousel,dataviews) and when we refresh(load, filter) store data, dom of all view that use this store will be rebuild, but some views is not displayed in this time, and may be will not show with these data. How we can refresh list dom only if it displayed, not every time when it store refresh? Issue examle Ext.define("Test.view.Main", { extend: 'Ext.tab.Panel', config: { tabBarPosition: 'bottom', items: [ ] }, constructor : function(){ this.callParent(arguments); var store = Ext.create('Ext.data.Store',{ data :[ {title : 'One'}, {title : 'Two'}, {title : 'Three'} ] }), firstList = Ext.create('Ext.List',{ title : 'tab1', store : store, itemTpl : '{title}', onItemDisclosure : function(){ store.add({title : 'Four'}); } }), secondList = Ext.create('Ext.List',{ title : 'tab2' , store : store, itemTpl : '{title}' }), thirdList = Ext.create('Ext.List',{ title : 'tab3', store : store, itemTpl : '{title}' }); this.add([ firstList, secondList, thirdList ]) ; } }); When tap on item in the first list, in store will be added new item. And dom of all list will be change although second and third list not displayed I see one option. Create one main store and create separate stores for each views. And when view show fill it store from Main store. But it look not good. Any other ideas?

    Read the article

  • How to solve this problem with Python

    - by morpheous
    I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

    Read the article

  • Encode_JSON Errors in Lasso 8.6.2 After Period of Time

    - by ATP_JD
    We are in the process of converting apps from Lasso 8 to Lasso 9, and as an intermediate step, have upgraded from 8.5.5 to 8.6.2 (which runs alongside 9 on our new box, in different virtual hosts). I am finding that with 8.6.2 we are getting a slew of errors on pages that call encode_json. The weird thing with these errors is that they don't start happening until some period of time after the site starts. Then, some hours later, all encode_json calls begin to fail with error messages like this: An error occurred while processing your request. Error Information Error Message: No tag, type or constant was defined under the name "?????????????????" with arguments: array: (pair: (-find)=([\x{0020}-\x{21}\x{23}-\x{5b}\x{5d}-\x{10fff}])), (r) at: onCompare with params: 'r' at: JSON with params: 'reload', -Options=array: (-Internal) at: JSON with params: @map: (reload)=(false), (tcstring)=(LZU), (timestring)=(10:42 AM&nbsp;&nbsp;&nbsp;1442Z) at: [...].lasso with params: 'pageloadtime'='1383038310' on line: 31 at position: 1 Error Code: -9948 (Yes, those Chinese(?) characters are in the error message.) I have removed the 8.5.5 encode_json tag from LassoStartup, so we are using the correct built-in method. The encode_json method fails for any and all parameters I throw at it from simple strings to arrays of maps. Upon restarting the site, encode_json resumes working for an hour or two, seemingly depending on load. On 8.5.5, we don't have this problem. Does anyone have experience with this issue? Any advice regarding trying the 8.5.5 tag swap encode_json to see if I can override the built-in method? Maybe it will work better? Thanks in advance for your time and assistance. -Justin

    Read the article

  • Thread mutex behaviour

    - by Alberteddu
    Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

< Previous Page | 115 116 117 118 119 120 121 122 123 124 125 126  | Next Page >