Search Results

Search found 9349 results on 374 pages for 'turing complete'.

Page 119/374 | < Previous Page | 115 116 117 118 119 120 121 122 123 124 125 126  | Next Page >

  • Auto-Completion in Unix VI editor

    - by IllustratedInsomnia
    Hey guys, after using graphical IDE's like Visual Studio, I'm used to pressing CTRL+Space to auto-complete a variable or function name. Now, I know such a thing isn't completely possible in VI, but I heard there was a list of commands that could be mapped that allowed automatic completion of variables and functions in the current file opened. Does anyone know what this sequence is? Thanks in advance.

    Read the article

  • Code Contracts Vs. Object Initializers (.net 4.0)

    - by Mystagogue
    At face value, it would seem that object initializers present a problem for .net 4.0 "code contracts", where normally the invariant should be established by the time the object constructor is finished. Presumably, however, object-initializers require properties to be set after construction is complete. My question is if the invariants of "code contracts" are able to handle object initializers, "as if" the properties were set before the constructor completes? That would be very nice indeed!!

    Read the article

  • Javascript expando objects

    - by xyz
    What are expando objects in javascripts? For what purpose we need this ? Any complete example will be appreciated I found 1 article here Javascript: The red-headed stepchild of web development Thanks

    Read the article

  • Connect to SQLite Database using Eclipse (Java)

    - by bnabilos
    Hello, I'm trying to connect to SQLite database with Ecplise but I have some errors. This is my Java code and the errors that I get on output. Please see if you can help me. Thank you in advance. package jdb; import java.sql.*; public class Test { public static void main(String[] args) throws Exception { Class.forName("org.sqlite.JDBC"); Connection conn = DriverManager.getConnection("jdbc:sqlite:/Applications/MAMP/db/sqlite/test.sqlite"); Statement stat = conn.createStatement(); stat.executeUpdate("drop table if exists people;"); stat.executeUpdate("create table people (name, occupation);"); PreparedStatement prep = conn.prepareStatement( "insert into people values (?, ?);"); prep.setString(1, "Gandhi"); prep.setString(2, "politics"); prep.addBatch(); prep.setString(1, "Turing"); prep.setString(2, "computers"); prep.addBatch(); prep.setString(1, "Wittgenstein"); prep.setString(2, "smartypants"); prep.addBatch(); conn.setAutoCommit(false); prep.executeBatch(); conn.setAutoCommit(true); ResultSet rs = stat.executeQuery("select * from people;"); while (rs.next()) { System.out.println("name = " + rs.getString("name")); System.out.println("job = " + rs.getString("occupation")); } rs.close(); conn.close(); } } ans that what I get in Ecplise : Exception in thread "main" java.lang.ClassNotFoundException: org.sqlite.JDBC at java.net.URLClassLoader$1.run(URLClassLoader.java:200) at java.security.AccessController.doPrivileged(Native Method) at java.net.URLClassLoader.findClass(URLClassLoader.java:188) at java.lang.ClassLoader.loadClass(ClassLoader.java:315) at sun.misc.Launcher$AppClassLoader.loadClass(Launcher.java:330) at java.lang.ClassLoader.loadClass(ClassLoader.java:250) at java.lang.ClassLoader.loadClassInternal(ClassLoader.java:398) at java.lang.Class.forName0(Native Method) at java.lang.Class.forName(Class.java:169) at jdb.Test.main(Test.java:7) Thank you

    Read the article

  • Restoring older firmware through XCode?

    - by Moshe
    I'm trying to restore iPhone OS 3.1.3 to a 3GS that has been upgraded to iOS 4. iTunes refuses to complete the install. What needs to be done? I am currently using the GM XCode. Should I be using the latest public stable version instead? Update: XCode reports that "The baseband cannot be rolled back".

    Read the article

  • Removing the transperancy from image while keeping the actual image

    - by KPL
    Hello people, I have three images,and , they are not square or rectangular in shape. They are just like face of anyone. So,basically, my images are in the size 196x196 or anything like that, but complete square or rectangle with the face in the middle and transperant background in the rest of the portion. Now, I want to remove the transperant background too and just keep the faces. Don't know if this is possible and mind you, this isn't a programming question.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to keep iPhone app out of iPad store?

    - by Eric
    I have an iPhone app that I have started to turn into a universal app, however the process is not complete and I want to release an update to the iPhone version. I know that you can specify device capabilities in the Info.plist file to restrict your app to certain devices, but how can I do this to prevent the unfinished universal version from appearing in the iPad store? Is checking the LSRequiresiPhoneOS BOOL entry (in the Info.plist file) enough? Thanks!

    Read the article

  • Is it possible to download a .zip file into iPhone when user clicks a link inside UIWebView?

    - by Horace Ho
    In a new app, I plan to let users download their own files and stored them inside iPhone. The process is typically: iPhone present a web page by UIWebView, in which there are several links to .zip files the user browser the page and click on one of the .zip file link iPhone downloads the file into the iPhone document folder, closes WebView, acknowledges the user when download is complete How can that be done? Thanks

    Read the article

  • Compare structures of two databases?

    - by streetparade
    Hello, I wanted to ask whether it is possible to compare the complete database structure of two huge databases. We have two databases, the one is a development database, the other a production database. I've sometimes forgotten to make changes in to the production database, before we released some parts of our code, which results that the production database doesn't have the same structure, so if we release something we got some errors. Is there a way to compare the two, or synchronize?

    Read the article

  • Same keyword for two purposes in java? [closed]

    - by gurukulki
    Possible Duplicates: Same keyword for two purposes in java? Same keyword for two purposes in java? As we use "default" keyword as a access specifier, and it can be used in switch statements as well with complete different purpose, So i was curious that is there any other keywords in java which can be used in more then one purposes

    Read the article

  • rails backgroundjob running jobs in parallel?

    - by Damir Horvat
    I'm very happy with By so far, only I have this one issue: When one process takes 1 or 2 hours to complete, all other jobs in the queue seem to wait for that one job to finish. Worse still is when uploading to a server which time's out regularly. My question: is Bj running jobs in parallel or one after another? Thank you, Damir

    Read the article

  • Python urllib.urlopen() call doesn't work with a URL that a browser accepts

    - by Charles Anderson
    If I point Firefox at http://bitbucket.org/tortoisehg/stable/wiki/Home/ReleaseNotes, I get a page of HTML. But if I try this in Python: import urllib site = 'http://bitbucket.org/tortoisehg/stable/wiki/Home/ReleaseNotes' req = urllib.urlopen(site) text = req.read() I get the following: 500 Internal Server Error The server encountered an internal error or misconfiguration and was unable to complete your request. What am I doing wrong?

    Read the article

  • Detecting I/O errors in a NON BLOCKING SOCKET

    - by ripunjay-tripathi-gmail-com
    I am writing a client - server system in which I used NON-BLOCKING sockets. My problem is to detect error { while performing send() or write() } that may occur while data transfer. Example lets say, while the data is being transferred the peer crashes. Another case there is some network problem, something like wire unplugged etc. As of now, I am using a high level ACK, that peer sends after receiving the complete data. Ripunjay Tripathi

    Read the article

  • How to apply css locally on any online page?

    - by metal-gear-solid
    For testing I don't want to upload css to FTP on each change till site complete , but site and content is online. (i'm not talking about saving page locally then apply css) Can i just apply css locally to any online page. it would be easier to edit and see changes locally till css work end. and i want to see applied effect on FF and IE. How to do that? Is it possible.

    Read the article

  • Is there a guide to debugging Java processes in Eclipse across OSs?

    - by Jekke
    I have an application written in Java to run on Linux. I'm developing in Eclipse under windows. I would like to run the code on the Linux box and debug it on the Windows one remotely. I've found some information about how to do so, but it's pretty sparse. Does anyone have (or can point to) a complete explanation of the process? Any help would be appreciated.

    Read the article

  • Where can I find a good software implementation plan template?

    - by Corpsekicker
    This is not "programming" related as much as it is "software engineering" related. I am required to produce an implementation for additional functionality to a complete system. All I am armed with is knowledge of the existing architecture and a functional spec with visual requirements, user stories and use cases. Is there a standardised way to go about this? I suck at documentation.

    Read the article

  • Consuming and Provide webservice to client

    - by Jason
    Hi, I got a requirement to implement a website in java which will utilize another web service. Here is the scenario I am providing the product compare results to client and assume i am using amazon and other web services. Initially client invoke our web service and then we fetch results from merchants. I don't want complete solution just look for consuming and create web service in java example. I searched on google but couldn't found relevant example. I prefer if example is using eclipse :) Thanks

    Read the article

  • Best editor for CodeIgniter?

    - by Rismo
    I'm learning CodeIgniter and I come from Microsoft Visual Studio so I'm used to the auto complete feature. I've been using notepad++ so far but I wonder if anyone knows an editor that works better with CodeIgniter. I would love to see features like: Right-click - Add new model Right-click - Add new view Autocomplete with CodeIgniter helpers and libraries

    Read the article

< Previous Page | 115 116 117 118 119 120 121 122 123 124 125 126  | Next Page >